association	dataset	threshold value	standardized value
MEIS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.7266
Acute Myeloid Leukemia_LAML_TCGA-AB-3007-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A9FU-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-46-6026-01A-11R-1820-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE213588_9_v_12_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Duodenal atresia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.149
HPBALL	CCLE Cell Line Gene CNV Profiles	-1.0	-1.57441
GTEX-NPJ8-0011-R11A-SM-2YUMS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.87619
GTEX-OXRN-2626-SM-48TBX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.27297
CRCGN017_MCF10A.WT.HP_24H:H08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.07028
NCI-H1573	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.968186
X-linked lissencephaly 2	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.051
hsa-miR-509-3-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
GSE164874_5_v_1_prednisolone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-WEY5-0426-SM-3GIKT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.875009
Lung adenocarcinoma_LUAD_TCGA-55-8507-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ER-23166858-MCF-7-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YW-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X585-0011-R11B-SM-46MUZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.97508
CRCGN015_HEPG2_48H:M16	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.77144
Crus I, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.22806
GTEX-PVOW-2626-SM-32PL8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.68061
GTEX-T6MO-1426-SM-4DM73	GTEx Tissue Sample Gene Expression Profiles	1.0	0.879588
GSE182179_2_v_3_kdsr_human	RummaGEO Gene Perturbation Signatures	1.0	null
RD-90-OY66_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.364871
molecular_function	GO Molecular Function Annotations 2015	1.0	null
RPL30	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.38296
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-VS-A8Q9-01A-12R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN014_HEPG2_3H:J10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.07111
RIPOR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.07005
GTEX-Q2AH-1526-SM-48TZG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10334
CAL33	CCLE Cell Line Gene CNV Profiles	-1.0	-1.69904
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A1ZF-06A-12R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2862-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OHPK-1626-SM-2YUN3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.96701
substantia nigra, reticular part	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.12877
GTEX-QV44-0526-SM-2S1RE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.828009
H1_Derived_Mesenchymal_Stem_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.1144
PE01	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.831879
skin_6a	HPA Tissue Sample Gene Expression Profiles	1.0	1.391
globose nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.65675
PMC5497057-ncomms15921-s2.xlsx-AA_PCa_vs_AA_NP-Unnamed_2_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
ZNF8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	42.081
IA-76-ZU47_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.3308
NCKAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.43998
CRCGN015_MCF10A_48H:M23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.21107
PAX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.7214
AARS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.65076
GSE234514,GSE234516_1_v_3_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
MOLM6	CCLE Cell Line Gene CNV Profiles	1.0	1.44388
POU3F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	58.7189
GTEX-WWYW-0011-R11A-SM-3NB38	GTEx Tissue Sample Gene Expression Profiles	1.0	2.37498
Rectum adenocarcinoma_READ_TCGA-EI-7002-01A-11R-1928-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55F-1226-SM-2TF59	GTEx Tissue Sample Gene Expression Profiles	1.0	1.86097
GTEX-PLZ4-1226-SM-2I5FE	GTEx Tissue Sample Gene Expression Profiles	1.0	0.981667
ACTL6A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.08958
trochlear nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.10429
COBL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.40629
Uterine Carcinosarcoma_UCS_TCGA-N5-A4RS-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4713-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WWYW-0005-SM-3NB3K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.38385
HUG1N	CCLE Cell Line Gene CNV Profiles	1.0	1.59676
rostral subdivision of paraventricular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.46413
RKO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.49314
Kidney renal papillary cell carcinoma_KIRP_TCGA-J7-A8I2-01A-12R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-VN-A88M-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XOTO-2826-SM-4B65I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18733
hsa-miR-1278	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
GTEX-VJYA-1426-SM-4KL1Y	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09122
TSPAN13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0371
MEF2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.0961
GTEX-PWOO-0826-SM-48TCL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.893629
THRA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.2637
GTEX-QLQW-1326-SM-2S1QS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.68591
GTEX-T5JC-2126-SM-32PMO	GTEx Tissue Sample Gene Expression Profiles	1.0	0.852893
Prostate adenocarcinoma_PRAD_TCGA-XQ-A8TA-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-2A-A8VX-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KE97	CCLE Cell Line Gene CNV Profiles	-1.0	-2.07255
MYCN-19997598-NEUROBLASTOMA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
POU3F2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	50.8233
Brain Lower Grade Glioma_LGG_TCGA-TQ-A7RK-02A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5LD-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCC-9	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.17672
VZ in caudal hippocampal proper	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.18619
SP in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.05285
CRCGN008_HEPG2_24H:O01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.17377
Liver hepatocellular carcinoma_LIHC_TCGA-DD-A4ND-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S4UY-0008-SM-3NM8H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00392
digestive gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
496100622_HIP_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.13802
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HR-01A-21R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NL3H-0011-R11A-SM-2I3E6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41887
Rectum adenocarcinoma_READ_TCGA-CI-6619-01B-11R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
medial portion of the shell	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.908261
subthalamic nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.11638
positive regulation of biological process	GO Biological Process Annotations 2015	1.0	null
TBX19	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	43.9712
UMC-11	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.2733
CRCGN010_HEPG2_24H:O06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.2134
GTEX-POMQ-1426-SM-3P61D	GTEx Tissue Sample Gene Expression Profiles	1.0	0.831097
CRCGN014_HEPG2_24H:L05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.16425
GTEX-XMD1-2826-SM-4AT5F	GTEx Tissue Sample Gene Expression Profiles	1.0	0.918253
AC-41-IB85_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.215919
SLF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.2663
JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.3845
MIS18BP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.08338
GTEX-OHPM-0526-SM-2YUMJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.950846
Sarcoma_SARC_TCGA-K1-A42X-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U3ZN-1926-SM-4DXSG	GTEx Tissue Sample Gene Expression Profiles	1.0	0.85543
CEBPG	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.8726
metal ion binding	GO Molecular Function Annotations 2015	1.0	null
SJCRH30	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.27601
MFM-223	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.851371
Acute Myeloid Leukemia_LAML_TCGA-AB-2956-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC630	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.00111
chr10_46030216_C_T_b38	GTEx eQTL 2025	1.0	2.59384
GTEX-U3ZH-1626-SM-3DB74	GTEx Tissue Sample Gene Expression Profiles	1.0	0.93799
GTEX-U4B1-1426-SM-4DXTX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23844
TM31	CCLE Cell Line Gene CNV Profiles	1.0	3.2803
CD4_Memory_Primary_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	0.907101
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A67V-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KMS-12-PE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.896617
GTEX-V955-0005-SM-3P5ZC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.872433
Prostate adenocarcinoma_PRAD_TCGA-EJ-A7NH-01A-12R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC9714459-DataSheet3.xlsx-Supplement_3A-1166_common_elements_in_MSC_and_Fibroblasts_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A44R-06A-41R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
outer CP in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.97972
GTEX-RM2N-1626-SM-2TF5N	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.25202
nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
CRCGN010_HEPG2_24H:C24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.0306
PDLIM7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.15976
EN1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.2926
CRCGN012_HEPG2_24H:O01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.17712
SCML1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17261
GTEX-XBEW-0006-SM-4AT4E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.03974
GTEX-U8XE-0726-SM-3DB8O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.41408
outer portion of medial ganglionic eminence	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.45577
Brain Lower Grade Glioma_LGG_TCGA-TQ-A7RJ-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-MP-A4T4-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
layer V of area 35c	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.940487
GTEX-PWCY-0005-SM-33HBP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.34059
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A80Q-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
periaqueductal gray substance, ventral portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.67778
SNU398	CCLE Cell Line Gene CNV Profiles	1.0	1.79179
external granular (germinal) layer of lower rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.4541
NCI-H596	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.94272
CA-75-HA22_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.355798
PDCD11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48997
PHTF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.12328
NFYB-21822215-K562-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-D6-A74Q-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
etoposide_homo sapiens_gpl10558_gse33990	GEO Signatures of Differentially Expressed Genes for Small Molecules	-1.0	null
vorinostat_homo sapiens_gpl571_gse18544	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
Cholelithiasis	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.203
HIF-2alpha_DEPLETION_GDS2760_643_human_Hypoxic MCF-7 breast cancer cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
oral mucosa	HPA Tissue Protein Expression Profiles	1.0	0.925208
VZ in superolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.849398
EPB41L4B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.75488
POU3F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.7389
GTEX-RU72-2626-SM-4GIE1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24368
PDX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.907
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8YT-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8709578-elife-69843-supp2.xlsx-HSF1_KO_2_E2_30min-Nearest_Ensembl_HSF1	Rummagene Transcription Factor Associations 2026	1.0	null
cerebral hemisphere	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GSE216274,GSE216292_4_v_3_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
hsa-miR-4329	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
GTEX-OIZH-1626-SM-2HMKI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.25092
GTEX-OHPM-1826-SM-2YUNF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.838566
GTEX-S4P3-0006-SM-3K2AW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.88212
MDA-MB-415	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.39631
hsa-miR-548c-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
GTEX-S341-1526-SM-4AD6K	GTEx Tissue Sample Gene Expression Profiles	1.0	0.919649
GTEX-XUYS-0326-SM-47JX2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.37412
GTEX-WRHU-1226-SM-4E3IJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.3645
CRCGN015_MCF10A_48H:L01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.47003
HEC1A	CCLE Cell Line Gene CNV Profiles	-1.0	-1.82756
RXRA::VDR	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.8
CRCGN009_HEPG2_24H:O03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.79514
NMT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.65766
Lung squamous cell carcinoma_LUSC_TCGA-22-4591-01A-01R-1201-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE213588_9_v_13_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Sickle Cell Anemia_Endothelial cell_GSE9877	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-0.453609
Sarcoma_SARC_TCGA-PT-A8TR-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55C-1726-SM-3GADJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.876734
Lung squamous cell carcinoma_LUSC_TCGA-98-A53I-01A-31R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H2106	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.44251
SOX18	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.6667
PAX9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.5541
HCC-15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0021
PMC5029704-oncotarget-07-24326-s006.xlsx-Sheet1-Genes_that_are_downregulated_in_low_TET1_compared_to_high_TET1_TET1	Rummagene Transcription Factor Associations 2026	1.0	null
JHUEM1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.90339
Prostate adenocarcinoma_PRAD_TCGA-M7-A725-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-37-4129-01A-01R-1100-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70W-01A-12R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SJXC-2026-SM-4DM6N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.66922
Brain Lower Grade Glioma_LGG_TCGA-TQ-A7RI-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4988-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OHPM-1626-SM-2HMK4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-3.38627
GTEX-QESD-1626-SM-2S1RB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.56148
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9R9-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
V, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.08091
JAK2_knockdown_192_GSE54645	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-1.49648
GTEX-QDT8-3026-SM-32PKB	GTEx Tissue Sample Gene Expression Profiles	1.0	2.59798
Lung adenocarcinoma_LUAD_TCGA-50-5051-01A-21R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QEG4-0126-SM-48TZE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.34961
GTEX-WH7G-1726-SM-4LVKY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35296
GABPA_HeLa-S3_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
pituitary	GTEx Tissue Gene Expression Profiles	1.0	1.42041
JDP2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.6145
POU2F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.823
Liver hepatocellular carcinoma_LIHC_TCGA-G3-A7M6-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN014_HEPG2_24H:K06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.8486
BD-96-HO33_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.200697
dorsal subdivision of VLC	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.60932
Spinal cord	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.905
GSE76425_1_v_10_lenalidomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
FA-88-II68_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.295657
Liver hepatocellular carcinoma_LIHC_TCGA-BC-A216-01A-11R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A708-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SG in temporal polar cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.16181
FOSL2::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.1713
UNCX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.0243
Endometriosis_Endometrium_GSE6364	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-2.01462
epididymis	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
heart	GTEx Tissue Gene Expression Profiles	-1.0	-0.891341
NCI-H2081	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.08049
MEIS2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.7292
GGNBP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2811
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A4OZ-01A-12R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
u138mg	HPA Cell Line Gene Expression Profiles	-1.0	-0.904904
GTPase activator activity	GO Molecular Function Annotations 2025	1.0	null
GTEX-RU72-0126-SM-2TF6Z	GTEx Tissue Sample Gene Expression Profiles	1.0	0.869291
GTEX-XMK1-2426-SM-4B66I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.15182
GTEX-RN64-0326-SM-2TC5J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.22351
NCI-H650	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.968186
regulation of hydrolase activity	GO Biological Process Annotations 2015	1.0	null
GSPT1	MSigDB Cancer Gene Co-expression Modules	1.0	null
caudal prosubiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.41972
Sarcoma_SARC_TCGA-WK-A8XQ-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN015_HEPG2_48H:G13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.49984
GTEX-U8T8-0005-SM-3DB8F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.99591
GTEX-SIU7-0006-SM-2XCE6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.30047
GTEX-OXRP-0006-SM-2I3FN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-3.22085
raphe magnus nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.15668
GTEX-OHPM-1426-SM-3TW8Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.909842
Lung squamous cell carcinoma_LUSC_TCGA-85-8352-01A-31R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-Q2AG-0826-SM-2HMKF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07029
pcgf2_17452456_medulloblastoma_lof_human_gpl570_gds2724	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.322597
Kidney Chromophobe_KICH_TCGA-KN-8427-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7475-01A-11R-2027-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF326	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.1087
GTEX-NPJ7-2826-SM-2I3FU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.4907
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-FA-A6HN-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr10_46016280_TCTAAGTAGTTAGTAATCTAA_T_b38	GTEx eQTL 2025	1.0	3.51336
HNF1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.2412
PMC11447041-41598_2024_74391_MOESM2_ESM.xlsx-D_ATF4-def_vs_HCT116_Tg2-Unnamed_1_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
cerebellum	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
gonad	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
NCI-H1651	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
MEOX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.929
AR-25329375-VCAP-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
SCC9	CCLE Cell Line Gene CNV Profiles	-1.0	-1.34193
Lung squamous cell carcinoma_LUSC_TCGA-90-A59Q-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
USF1_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
786O	CCLE Cell Line Gene CNV Profiles	-1.0	-1.66521
RAB10	MSigDB Cancer Gene Co-expression Modules	1.0	null
CRCGN015_HEPG2_48H:O12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.13923
GTEX-Q2AG-0005-SM-33HBX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.32663
testis_4a	HPA Tissue Sample Gene Expression Profiles	1.0	0.874089
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HK-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-TM-A7CF-02A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VIIIA, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.2835
NR1D1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.9024
MRPL17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.25047
zona incerta, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.936766
GTEX-P4PP-0005-SM-2HMKX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.4069
G-361	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.08049
UACC-257	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.37388
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EX-A1H6-01B-11R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCRT1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.9777
CRCGN010_HEPG2_24H:O03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.22139
GTEX-PLZ6-1126-SM-3P5ZR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.0931
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YU-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN009_HEPG2_24H:O06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.75151
MCM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.46929
HOXA10	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.62
GTEX-WHSE-0011-R3A-SM-3P5ZM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.31477
Brain Lower Grade Glioma_LGG_TCGA-TQ-A7RK-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CEBPB	JASPAR Predicted Transcription Factor Targets	1.0	null
MDA-MB-330	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.69292
GTEX-PSDG-0008-SM-48TE5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867871
GTEX-UTHO-3126-SM-3P5ZB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.5586
CRCGN008_HEPG2_24H:O15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.35845
POU2F2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.8118
GTEX-WK11-0926-SM-3NMAU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.05847
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HQ-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-POYW-0826-SM-2XCEM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.51274
GTEX-T2IS-0626-SM-32QP6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41151
SP in caudal subicular cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.59317
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A4FD-06A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CP67-MEL	GDSC Cell Line Gene Expression Profiles	-1.0	-2.32385
CRCGN016_MCF10A.WT.HP_24H:F14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.03509
CRCGN015_MCF10A_48H:C20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.66422
GTEX-XQ3S-0006-SM-4BOQ4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.51003
central nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
TDG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.14215
Sarcoma_SARC_TCGA-QQ-A5VA-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4873-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IX, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.838539
spleen	GTEx Tissue Gene Expression Profiles	1.0	1.06626
Brain Lower Grade Glioma_LGG_TCGA-DH-A7UR-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC15	CCLE Cell Line Gene CNV Profiles	-1.0	-1.41059
X, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.939071
GTEX-XMK1-1026-SM-4B65H	GTEx Tissue Sample Gene Expression Profiles	1.0	0.878875
501A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.895824
POU2F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.3073
NDUFAF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41532
ETV5::FOXO1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.7865
ABL1_mutant_179_GSE45452	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	1.0	2.11624
GTEX-REY6-2126-SM-48FD9	GTEx Tissue Sample Gene Expression Profiles	1.0	0.988281
MKN-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02066
Lung squamous cell carcinoma_LUSC_TCGA-37-A5EN-01A-21R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HW-A5KJ-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CHTF18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19072
GTEX-U3ZG-0006-SM-47JWX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.32528
Head and Neck squamous cell carcinoma_HNSC_TCGA-MZ-A7D7-01A-21R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100376_FWM_probable Alzheimer's disease_TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.34843
GTEX-P4PQ-0326-SM-2HMJ8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.966645
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4981-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A8HU-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-DQ-7591-01A-11R-2081-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U3ZH-0926-SM-4DXU4	GTEx Tissue Sample Gene Expression Profiles	1.0	0.961688
hsa-miR-448	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
GTEX-U3ZN-0006-SM-3DB7Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.917657
Sarcoma_SARC_TCGA-X2-A95T-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OIZG-1326-SM-2HMIQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02732
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7H5-01B-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CLMP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.24788
Colorectal mucosa	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.644
Brain Lower Grade Glioma_LGG_TCGA-S9-A6TU-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XOTO-0006-SM-4B64T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.976733
GTEX-RWSA-2426-SM-47JXR	GTEx Tissue Sample Gene Expression Profiles	1.0	0.9973
496100606_PCx_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.08727
GTEX-XGQ4-0526-SM-4AT6C	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.984724
NCI-H358	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38713
CRCGN008_HEPG2_24H:O03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.1769
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A553-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IRF3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	48.3312
hsa-miR-1296-5p	MiRTarBase microRNA Targets	1.0	null
GTEX-XXEK-2026-SM-4BRVE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.68397
Parietal lobe	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.857
GSE195559_8_v_7_notch1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5888-01A-11R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOSL1::JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.2104
GTEX-N7MT-1226-SM-2D7W4	GTEx Tissue Sample Gene Expression Profiles	1.0	2.346
GTEX-S7SE-0011-R8A-SM-2XCDG	GTEx Tissue Sample Gene Expression Profiles	1.0	0.894619
MEF2A	JASPAR Predicted Transcription Factor Targets	1.0	null
GTEX-REY6-0126-SM-48FDT	GTEx Tissue Sample Gene Expression Profiles	1.0	0.977828
GTEX-V1D1-0926-SM-4JBHQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.91237
Brain Lower Grade Glioma_LGG_TCGA-DU-A5TS-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
esophagus	HPA Tissue Protein Expression Profiles	1.0	0.925208
GTEX-U8XE-0126-SM-4E3I3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20324
large intestine	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-WZTO-0011-R11A-SM-4E3K9	GTEx Tissue Sample Gene Expression Profiles	1.0	2.19214
PMC10725467-41467_2023_44159_MOESM4_ESM.xlsx-Supplementary_Data_10-Supplementary_Data_10_Nonsynonymous_mutations_in_TFE3-RCC_TFE3	Rummagene Transcription Factor Associations 2026	1.0	null
Lung adenocarcinoma_LUAD_TCGA-97-A4M2-01A-12R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11161988-12906_2024_4523_MOESM3_ESM.pdf-109-MTF2_MTF2	Rummagene Transcription Factor Associations 2026	1.0	null
TBL1-22424771-293T-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
H2AC13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.15511
SPI1	ENCODE Transcription Factor Targets	1.0	null
RBM8A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82079
Liver hepatocellular carcinoma_LIHC_TCGA-ED-A7PY-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-CF-A8HX-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE158975_0_v_1_spp1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GATA1::TAL1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	53.1996
GTEX-XXEK-0526-SM-4BRWD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08203
HSF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.316
prostate_4a	HPA Tissue Sample Gene Expression Profiles	1.0	1.32508
DB	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19235
TAF15_02_140	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	-1.0	-0.61055
Lung squamous cell carcinoma_LUSC_TCGA-58-8390-01A-11R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XOT4-0326-SM-4B66S	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41986
NCI-H1703	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.15293
PMC3355086-pgen.1002728.s003.xlsx-Tabelle1-HEY1_upregulated_HEY1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-T6MO-0006-SM-32QOU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.900585
GTEX-QMR6-0011-R11A-SM-32PKK	GTEx Tissue Sample Gene Expression Profiles	1.0	2.05496
HOXB3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.8558
MOLM-16	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.918901
Prostate adenocarcinoma_PRAD_TCGA-HC-7817-01B-11R-A29R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A44P-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DCTN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.999
GTEX-SE5C-0726-SM-4BRWY	GTEx Tissue Sample Gene Expression Profiles	1.0	0.927194
ZNF574	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19398
NCI-H187	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02066
JUN::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.56
Lung squamous cell carcinoma_LUSC_TCGA-94-A4VJ-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PWN1-1626-SM-2S1OL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.20477
GSE232558_0_v_2_fbxl12_human	RummaGEO Gene Perturbation Signatures	-1.0	null
stratum pyramidale of rostral CA2	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.10568
S0-EE-Y79N_0.1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.203465
Lung squamous cell carcinoma_LUSC_TCGA-56-A4ZJ-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-DR-A0ZM-01A-12R-A10U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WZTO-2826-SM-3NM8P	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83355
Acute Myeloid Leukemia_LAML_TCGA-AB-2820-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2872-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE158182_5_v_0_pnpla3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
L-428	GDSC Cell Line Gene Expression Profiles	1.0	2.93115
Brain Lower Grade Glioma_LGG_TCGA-E1-5304-01A-01R-1470-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3363-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
THUMPD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.23344
Kidney - Medulla	GTEx Tissue Gene Expression Profiles 2023	1.0	4.14478
TRPS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.7116
CRLF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.13746
POU2F2_GM12878_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCAPD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.13215
CRCGN011_HEPG2_24H:O05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.79235
CRCGN015_HEPG2_48H:J17	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.35547
GTEX-XQ8I-0006-SM-4BOQ5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.97634
GSE213228_4_v_5_irak2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
liver	HPA Tissue Gene Expression Profiles	-1.0	-1.17594
hepg2	HPA Cell Line Gene Expression Profiles	1.0	0.918392
Head and Neck squamous cell carcinoma_HNSC_TCGA-IQ-7631-01A-11R-2081-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN008_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.91475
GTEX-X4XX-2926-SM-3NMB1	GTEx Tissue Sample Gene Expression Profiles	1.0	0.986389
Kidney renal papillary cell carcinoma_KIRP_TCGA-SX-A71R-01A-12R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-86-8673-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN015_HEPG2_48H:J10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.29843
GTEX-V1D1-1926-SM-4JBGX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.13849
GSE216273,GSE216292_0_v_6_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
hsa-miR-635	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
Lung squamous cell carcinoma_LUSC_TCGA-77-A5G8-01B-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GUK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22824
CD8_Naive_Primary_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.33706
496100307_FWM_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.52728
CRCGN011_HEPG2_24H:I02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.33428
HOXA7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.1221
LB373-MEL-D	GDSC Cell Line Gene Expression Profiles	-1.0	-1.41797
GTEX-P44H-1126-SM-48TBU	GTEx Tissue Sample Gene Expression Profiles	1.0	0.939117
RUNX2-22187159-PCA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
GSE135350_3_v_4_dexamethasone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CRCGN015_HEPG2_48H:L05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.15559
COR-L47	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.84046
GTEX-T6MN-0011-R2A-SM-32QOW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.2422
IFT20	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.02994
outer SZ in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.21767
GTEX-WHSE-0011-R6A-SM-3P5ZP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.891776
Lung adenocarcinoma_LUAD_TCGA-MP-A4T8-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
basomedial nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.24856
chr10_46016304_A_T_b38	GTEx eQTL 2025	1.0	5.80303
GTEX-V955-1926-SM-4KL1L	GTEx Tissue Sample Gene Expression Profiles	1.0	1.407
pancreas	HPA Tissue Gene Expression Profiles	-1.0	-1.50464
rectum	HPA Tissue Protein Expression Profiles	1.0	0.925208
Bladder Urothelial Carcinoma_BLCA_TCGA-XF-A8HI-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FAM3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.09073
Lung adenocarcinoma_LUAD_TCGA-78-7161-01A-11R-2039-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN016_MCF10A.TP53.M_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.23937
GTEX-OXRK-1826-SM-2HMJE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.48592
Lung adenocarcinoma_LUAD_TCGA-MP-A4T6-01A-32R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70R-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-7752-01A-11R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF791	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37426
inner SZ in dorsomedial parietal cortex (area 7m)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.32686
CRCGN015_HEPG2_48H:M07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.60679
PMC10290283-biol-2022-0622-sm3.pdf-408-FOXJ2_FOXJ2	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-SNMC-0008-SM-4DM5A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.06861
GTEX-WHWD-0005-SM-3LK7D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.18932
Skin Cutaneous Melanoma_SKCM_TCGA-FR-A729-06A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X8HC-0006-SM-46MV6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.33291
TTC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35869
medial group of nuclei, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.956866
CRCGN008_HEPG2_24H:O18	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.10332
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A299-01A-21R-A18U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PRPF39	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.08049
496100326_TCx_no dementia_TBI_81_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.5022
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RM-A68T-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MBTPS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.32166
Pancreatic adenocarcinoma_PAAD_TCGA-FB-A78T-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TICRR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06981
MSX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.1781
BCS1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.00528
STXBP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05746
GTEX-W5X1-2826-SM-3GILM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.3039
CRCGN015_MCF10A_48H:P13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.38053
hsa-miR-4799-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A51R-06A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OOBK-1626-SM-2HMKG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.53773
brain	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
HD-MY-Z	GDSC Cell Line Gene Expression Profiles	-1.0	-1.88402
kidney	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
NKX6-1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	14.9951
GTEX-NPJ7-0006-SM-3GACR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.03175
testis_7f	HPA Tissue Sample Gene Expression Profiles	1.0	0.838179
CTR9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8444
GTEX-WZTO-3026-SM-3NMA2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48701
496100322_FWM_possible Alzheimer's disease_no TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.93586
PTK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.38169
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A1ZC-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN008_HEPG2_24H:F17	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.41415
vermiform appendix	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Lung squamous cell carcinoma_LUSC_TCGA-21-1081-01A-01R-0692-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X15G-0005-SM-3NMDA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.90128
CRCGN015_MCF10A.WT.HP_24H:H19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.03521
preoptic region, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.48597
SP in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.893753
GTEX-TKQ2-0008-SM-4DM5L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08509
ESX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.7619
GTEX-SNOS-1526-SM-32PLW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.922669
GTEX-T2IS-0526-SM-32QP9	GTEx Tissue Sample Gene Expression Profiles	1.0	0.844142
GTEX-OHPM-0426-SM-3TW8V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.53883
GTEX-U3ZM-1226-SM-3DB9G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.19521
NCIH322	CCLE Cell Line Gene CNV Profiles	-1.0	-1.71133
GTEX-UPJH-0126-SM-4IHLL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.52198
Leukemia, Chronic T-Cell_T lymphocyte_GSE5788	GEO Signatures of Differentially Expressed Genes for Diseases	1.0	1.63576
TMEM102	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51026
GTEX-SN8G-1526-SM-4DM79	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20052
DCHS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.23772
GTEX-X4XY-0626-SM-4E3IN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.980605
GTEX-XMD1-0006-SM-4AT4Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.39672
GTEX-XPT6-2026-SM-4B64V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.927628
GTEX-QVUS-0626-SM-447CC	GTEx Tissue Sample Gene Expression Profiles	1.0	0.870854
Prostate adenocarcinoma_PRAD_TCGA-CH-5761-01A-11R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OOBJ-0926-SM-48TDO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24502
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5010-01A-02R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-Q2AG-0011-R11A-SM-2HMKZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.549
PMC8481886-Table_2.xlsx-A_subsets-AF_MSC_UdRPC_HSC_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
medial vestibular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.17647
HNF1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.9756
GTEX-R45C-0006-SM-3GAD6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.45143
GSE213588_10_v_0_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-V1D1-2126-SM-4JBH4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.42376
SLC27A6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.06429
GTEX-OOBK-0005-SM-2YUMG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.64285
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A6V1-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-A8P1-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OXRK-0826-SM-2HMK7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.97105
Prostate adenocarcinoma_PRAD_TCGA-V1-A8WV-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R53T-0008-SM-48FEW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.974614
CRCGN014_HEPG2_24H:K05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.46119
GSE213410_2_v_3_calcitriol_human	RummaGEO Drug Perturbation Signatures	1.0	null
activation of GTPase activity	GO Biological Process Annotations 2023	1.0	null
ELK1::HOXB13	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.4304
GSE202434,GSE202438_13_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NCI-H1915	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10067
GTEX-PVOW-2726-SM-48TCA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.63926
OLIG1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.0984
inner SZ in lateral temporal-occipital cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.10153
GTEX-O5YV-2026-SM-2D7VS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.988462
GTEX-X88G-0006-SM-47JX5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.884981
C3A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.17791
GTEX-S3XE-0426-SM-3K2AC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16512
Lung adenocarcinoma_LUAD_TCGA-55-8615-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7879-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OHPM-0326-SM-33HCA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.21989
VIIB, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.2949
NCI-H929	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20062
Bladder Urothelial Carcinoma_BLCA_TCGA-KQ-A41O-01A-12R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cellular_component	LOCATE Predicted Protein Localization Annotations	1.0	null
496100665_PCx_probable Alzheimer's disease_TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.2406
GTEX-XQ3S-1726-SM-4BOOD	GTEx Tissue Sample Gene Expression Profiles	1.0	0.998168
CRCGN013_HEPG2_24H:K04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.34605
Brain Lower Grade Glioma_LGG_TCGA-RY-A83X-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
USF1	ENCODE Transcription Factor Targets	1.0	null
GSE202434,GSE202438_6_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-CF-A47V-01A-11R-A23W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
K562_Celecoxib_10µM_24h	Sci-Plex Drug Perturbation Signatures	1.0	0.0162121
GTEX-UTHO-2926-SM-3P5Z9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.57999
hsa-miR-509-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
GTEX-VUSG-1726-SM-4KKZL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40511
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A2GL-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
binding	GO Molecular Function Annotations 2015	1.0	null
GTEX-TKQ2-0826-SM-33HB6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.10999
SNU-398	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.4697
BICR 78	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.827939
oculomotor nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.92401
GSE173394_1_v_0_nfatc2_human	RummaGEO Gene Perturbation Signatures	1.0	null
transition metal ion binding	GO Molecular Function Annotations 2015	1.0	null
GTEX-R55D-0126-SM-48FEL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45094
CL40	CCLE Cell Line Gene CNV Profiles	-1.0	-1.44936
K562	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	0.906082
AGS	CCLE Cell Line Gene CNV Profiles	-1.0	-1.39829
Kidney renal papillary cell carcinoma_KIRP_TCGA-SX-A7SR-01A-12R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A63U-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Crus II, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.07511
GTEX-XXEK-2426-SM-4BRUS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.85904
VI, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.36047
outer CP in inferolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.84778
GSE213588_10_v_13_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
TLX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.6136
CRCGN009_HEPG2_24H:O05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.05291
CRCGN013_HEPG2_24H:K03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.75017
PMC10149505-41392_2023_1393_MOESM2_ESM.xlsx-CPCMR-Hugo_Symbol_MEIS2	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-N7MT-1026-SM-3TW8T	GTEx Tissue Sample Gene Expression Profiles	1.0	1.22949
Rectum adenocarcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.105
cuneus, right, peristriate	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.847738
Lung adenocarcinoma_LUAD_TCGA-NJ-A4YF-01A-12R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-P3-A6T6-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN015_MCF10A_48H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.49269
GTEX-OXRO-0006-SM-2I5EM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.47246
Liver hepatocellular carcinoma_LIHC_TCGA-UB-A7MA-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4875-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NPJ8-1626-SM-2HMIY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.973805
GTEX-T6MN-0011-R11A-SM-32QOX	GTEx Tissue Sample Gene Expression Profiles	1.0	0.83252
EVX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.1313
CRCGN015_HEPG2_48H:O10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.87415
GTEX-QLQW-0005-SM-2S1RA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.35255
Rectum adenocarcinoma_READ_TCGA-BM-6198-01A-11R-1736-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-IR-A3LF-01A-21R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
u937	HPA Cell Line Gene Expression Profiles	1.0	1.19236
Brain Lower Grade Glioma_LGG_TCGA-DU-A5TW-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CR-6467-01A-11R-1873-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
nucleoside-triphosphatase regulator activity	GO Molecular Function Annotations 2015	1.0	null
496100319_HIP_no dementia_TBI_81_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.20421
CRCGN013_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.73461
raphe obscurus nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.97638
Sarcoma_SARC_TCGA-WP-A9GB-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
tretinoin_homo sapiens_gpl6244_gds4180	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
SPI1_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-S95S-0005-SM-2XCEC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.28822
GTEX-XAJ8-0626-SM-47JY4	GTEx Tissue Sample Gene Expression Profiles	1.0	0.844315
TOV-112D	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.980274
POU2F2	ENCODE Transcription Factor Targets	1.0	null
esophagus_5b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.00669
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5085-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TAL1	ENCODE Transcription Factor Targets	1.0	null
testis	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
CRCGN012_HEPG2_24H:O03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.93959
SELENOK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.08444
GTEX-RVPV-0006-SM-2TF6Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.949259
GTEX-UPK5-2026-SM-4JBIM	GTEx Tissue Sample Gene Expression Profiles	1.0	0.838016
TBXT	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.807
Lung adenocarcinoma_LUAD_TCGA-75-5147-01A-01R-1628-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SN8G-0006-SM-32PLD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.50959
GTEX-R55G-0006-SM-2TC6O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-3.4175
GSX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.4791
GTEX-X5EB-2326-SM-46MW5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.48168
Mean corpuscular hemoglobin	GWAS Catalog SNP-Phenotype Associations 2025	1.0	1.13979
HCC515	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.84287
ATF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.0148
CRCGN017_MCF10A.WT.HP_24H:E13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.03967
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A3AG-06A-31R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NPJ8-1426-SM-3MJHR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18045
CBP-21632823-H3396-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
CD-05-PU90_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.280325
NCBP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.03567
GTEX-T5JC-0005-SM-4DM7B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.09276
COLO 741	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.828852
Adipose tissue	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.985
GTEX-R55G-2426-SM-2TC5I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08482
imatinib_homo sapiens_gpl96_gds3043	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
ZNF558	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	83.8305
positive regulation of molecular function	GO Biological Process Annotations 2015	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-IB-AAUM-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-93-A4JN-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN015_HEPG2_48H:G06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.31974
GTEX-S3XE-0006-SM-3K2AA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.927528
GTEX-NFK9-0006-SM-3GACS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08077
hsa-miR-548k	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
ets_00000000_2008_ovarian_cancer_cells_gof_human_gpl6244_gse21129	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.271402
MYBPC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33102
HOXD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57092
SG in inferolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.901223
CRCGN012_HEPG2_24H:C22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.57814
HSC3	CCLE Cell Line Gene CNV Profiles	1.0	1.35819
CC-04-WK34_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.231206
HBL-100	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19084
GTEX-T5JW-0005-SM-3GADE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.833655
Prostate adenocarcinoma_PRAD_TCGA-VN-A88Q-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EMX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.8358
hsa-miR-4699-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
GTEX-OOBJ-2026-SM-3NB1R	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12137
Liver hepatocellular carcinoma_LIHC_TCGA-5C-A9VG-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LMX1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3545
VIIB, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.06574
GTEX-RTLS-2426-SM-46MUO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12818
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EA-A411-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HEPG2	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	0.999232
SMAD2/3-21741376-EPCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
inner portion of medial ganglionic eminence	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.862089
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JC-01A-21R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U3ZH-0526-SM-3DB75	GTEx Tissue Sample Gene Expression Profiles	1.0	0.99715
GTEX-T2YK-2226-SM-32QPT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02056
Lung squamous cell carcinoma_LUSC_TCGA-98-A53B-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
UBE2N	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.74772
intestine	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Brain Lower Grade Glioma_LGG_TCGA-P5-A5F0-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NFK9-0726-SM-2HMJW	GTEx Tissue Sample Gene Expression Profiles	1.0	0.888068
medial geniculate complex, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.964617
ion binding	GO Molecular Function Annotations 2015	1.0	null
Sarcoma_SARC_TCGA-QQ-A8VB-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Esophageal atresia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.511
GTEX-WHWD-0426-SM-3LK83	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.22515
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5092-01A-01R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
motor nucleus of trigeminal nerve, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.56022
CAPAN-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0021
Mesothelioma_MESO_TCGA-LK-A4NY-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
alimentary canal	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
CRCGN015_MCF10A.TP53.M_24H:L20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.51622
GTEX-T6MN-0011-R9A-SM-32QOZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.50981
GTEX-PVOW-0006-SM-3NMB8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.20679
GTEX-XBEC-0126-SM-4GIDT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.52663
Lung adenocarcinoma_LUAD_TCGA-53-A4EZ-01A-12R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN013_HEPG2_24H:K05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.96124
NEUROG1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.9141
Lung adenocarcinoma_LUAD_TCGA-86-A4P8-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8569982-41065_2021_205_MOESM1_ESM.xlsx-mono_THP1_a2b_tpm1-gene_GLI2	Rummagene Transcription Factor Associations 2026	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-GS-A9TX-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8185471-mmc4.xlsx-D4-DEGs_between_SOX15_KO_DPs_and_WT_DPs_cells_at_day_4_padj_0_05_Log2FoldChange_0_5_SOX15_KO_WT_or_Log2FoldChange_-0_5_SOX15_KO_WT_SOX15	Rummagene Transcription Factor Associations 2026	1.0	null
Sarcoma_SARC_TCGA-HS-A5N9-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN017_MCF10A.WT.HP_24H:P08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.63028
Pancreatic adenocarcinoma_PAAD_TCGA-Q3-AA2A-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
central part of CEl	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.20102
GTEX-W5WG-0006-SM-3GIJT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.25228
gastrointestinal tract	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GSE168918_1_v_0_tmprss4_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-P4QS-0926-SM-48TBS	GTEx Tissue Sample Gene Expression Profiles	1.0	0.839189
GTEX-OXRN-0005-SM-2I5EU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.88945
PMC5895607-41388_2017_42_MOESM4_ESM.xls-geneNames-Extended_Data_3_Gene_list_of_SRC-1_targets_which_contain_STAT1_binding_motifs_from_LY2_cell_RNAseq_data_STAT1	Rummagene Transcription Factor Associations 2026	1.0	null
male reproductive gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-S7SE-0226-SM-2XCD4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.0534
reproductive system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Lung adenocarcinoma_LUAD_TCGA-62-A470-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XLM4-3026-SM-4AT6L	GTEx Tissue Sample Gene Expression Profiles	1.0	0.892679
skin	HPA Tissue Gene Expression Profiles	1.0	1.7413
496100338_HIP_probable Alzheimer's disease_no TBI_79_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16404
GPR50	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.07934
CREB1	JASPAR Predicted Transcription Factor Targets	1.0	null
outer CP in primary visual cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.18608
GTEX-QESD-0006-SM-2I5G6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.953349
GTEX-XXEK-0426-SM-4BRVW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.895054
GTEX-OOBK-2126-SM-3LK5T	GTEx Tissue Sample Gene Expression Profiles	1.0	1.47382
GTEX-XAJ8-1326-SM-47JYT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.22971
GTEX-WFON-0126-SM-4LVM9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35449
chr10_45813257_G_A_b38	GTEx eQTL 2025	1.0	3.36231
GTEX-R3RS-0726-SM-3GIJR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.33268
prostate	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
GTEX-XOTO-0011-R11B-SM-4B64O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.854297
CAND1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.70586
GTEX-XQ3S-2726-SM-4BOP2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23513
GSE233679_5_v_3_nicotinamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A2RN-01A-12R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
enzyme activator activity	GO Molecular Function Annotations 2015	1.0	null
VI, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.889805
GTEX-T5JW-0126-SM-4DM6K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02209
GTEX-QMR6-1326-SM-32PLB	GTEx Tissue Sample Gene Expression Profiles	1.0	2.1216
Head and Neck squamous cell carcinoma_HNSC_TCGA-F7-8298-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CEBPA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.6544
NFYA-21822215-K562-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
DMS 454	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.828852
GTEX-X3Y1-2426-SM-3P5Z7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.826611
SK-MEL-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.10939
GSE113734_1_v_0_qprt_human	RummaGEO Gene Perturbation Signatures	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-2Z-A9J3-01A-12R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JD-44-KF86_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.217001
GTEX-WVLH-0011-R11A-SM-3MJFO	GTEx Tissue Sample Gene Expression Profiles	1.0	0.988114
NCI-H1781	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.980274
GTEX-XMD3-2326-SM-4AT5H	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01675
CB-31-UO16_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.590097
TBCD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.15795
SUP-T1	GDSC Cell Line Gene Expression Profiles	1.0	1.60743
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A5GT-01A-12R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9RC-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S4Q7-1026-SM-4AD75	GTEx Tissue Sample Gene Expression Profiles	1.0	0.989756
SREBF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.002
GABPA	ENCODE Transcription Factor Targets	1.0	null
PMC12585103-pbio.3003444.s013.xlsx-List_of_genes_for_GO_analysis-List_of_genes_undergoing_significant_MXE_upon_PRMT5_KD_under_hypoxia_AR	Rummagene Transcription Factor Associations 2026	1.0	null
ABCA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.09314
KASUMI1	CCLE Cell Line Gene CNV Profiles	1.0	1.5551
HCC1937	CCLE Cell Line Gene CNV Profiles	1.0	1.33377
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4847-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WYJK-1726-SM-3NM9U	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.88484
CRCGN014_HEPG2_24H:P23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.03642
PMC11462941-CAS-115-2947-s001.pdf-100-MBD2_MBD2	Rummagene Transcription Factor Associations 2026	1.0	null
PMC11447041-41598_2024_74391_MOESM2_ESM.xlsx-D_ATF4-def_vs_HCT116_Tg2-Unnamed_2_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-A4C7-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VIIAf	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.0042
brain_a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.72079
GTEX-XMK1-0126-SM-4B65F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04436
PMC3253802-pone.0029922.s001.pdf-107-FKHL18_FOXS1	Rummagene Transcription Factor Associations 2026	1.0	null
GSE256181_2_v_3_etv2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Bladder	GTEx Tissue Gene Expression Profiles 2023	1.0	3.30991
GTEX-U3ZH-1526-SM-4DXV1	GTEx Tissue Sample Gene Expression Profiles	1.0	0.850266
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EX-A8YF-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE213588_10_v_5_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-RN64-1626-SM-48FD7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09476
fulvestrant_homo sapiens_gpl570_gse22533	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
MZ in orbital frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.24058
Kidney renal papillary cell carcinoma_KIRP_TCGA-G7-A8LB-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5VV-06A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-NF-A4WU-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BATF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.25172
GTEX-SUCS-0006-SM-4DM59	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.69499
Multiple endocrine neoplasia type 4	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.251
chr10_45819730_A_G_b38	GTEx eQTL 2025	1.0	5.60488
PMC11447041-41598_2024_74391_MOESM2_ESM.xlsx-D_ATF4-def_vs_HCT116_Tg2-Supplementary_Table_2D_Contrast_ATF4-def_Tg_2h_vs_HCT116Tg_2h_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A4P0-01A-41R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
testis_7d	HPA Tissue Sample Gene Expression Profiles	1.0	0.994764
INTS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.66669
GSE178907_5_v_3_fkrp_human	RummaGEO Gene Perturbation Signatures	-1.0	null
VI, right, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.08852
central nuclear group	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	3.2497
USF1_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-56-7730-01A-11R-2125-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ESR1-20056654-MCF-7-HUMAN-BREASTCANCER	ChEA Transcription Factor Targets 2022	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7CL-01A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BHLHE23	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.2014
Head and Neck squamous cell carcinoma_HNSC_TCGA-MT-A7BN-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-WA-A7H4-01A-21R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-4078-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
liver_a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.51665
RKO-E6	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.49314
GTEX-S7SE-0926-SM-2XCD6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.38873
EPCAM_OE_GDS4887_343_human_IL-28B	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
GTEX-XXEK-1726-SM-4BRVB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.36492
Lung squamous cell carcinoma_LUSC_TCGA-66-2785-01A-01R-0851-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SRY	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.6071
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5001-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2840-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IB-90-MD82_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.26139
GTEX-UTHO-0006-SM-3NMCC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.884039
KASUMI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.56772
regulation of catalytic activity	GO Biological Process Annotations 2015	1.0	null
Rectum adenocarcinoma_READ_TCGA-DY-A1DD-01A-21R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-G3-AAV6-01A-21R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NOTO	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.8097
KNS-42	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-OIZH-2026-SM-3NB1M	GTEx Tissue Sample Gene Expression Profiles	1.0	0.947645
hsa-miR-507	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
central medullary reticular group, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.0585
Bladder Urothelial Carcinoma_BLCA_TCGA-E5-A4U1-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
intracellular membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
IC-28-HS37_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.579278
GTEX-WHSE-0926-SM-3NMBS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.18778
CEBPD	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.1533
GTPase activity	GO Molecular Function Annotations 2025	1.0	null
GTEX-V1D1-2026-SM-3GAF4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10575
GSE89154_1_v_0_proscillaridin_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMC8709578-elife-69843-supp2.xlsx-MIX_E2_1h-Nearest_Ensembl_MIXL1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-U412-0006-SM-3DB8J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.14451
Brain Lower Grade Glioma_LGG_TCGA-HT-7692-01A-12R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NFK9-1326-SM-3LK5I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.827446
Lung squamous cell carcinoma_LUSC_TCGA-L3-A4E7-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
bronchus	HPA Tissue Protein Expression Profiles	1.0	0.925208
GOLGA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69522
C32	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.00326
CRCGN017_MCF10A.WT.HP_24H:C24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.67702
Prostate adenocarcinoma_PRAD_TCGA-2A-A8VL-01A-21R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PGLS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32546
SOX8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.153
Lung squamous cell carcinoma_LUSC_TCGA-58-8388-01A-11R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H847	COSMIC Cell Line Gene CNV Profiles	-1.0	-3.24687
Rectum adenocarcinoma_READ_TCGA-DY-A0XA-01A-11R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-86-8054-01A-11R-2241-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
XIAP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30849
GSE134029_3_v_0_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-XGQ4-1526-SM-4AT6H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00268
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YV-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC7592539-12885_2020_7456_MOESM4_ESM.xlsx-Sup_TableS3_LMS_del_genes_conf-10q22_1_TP63	Rummagene Transcription Factor Associations 2026	1.0	null
Lung adenocarcinoma_LUAD_TCGA-78-7166-01A-12R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
AD-51-SS86_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.293736
RNF7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.40732
GTEX-OHPL-1626-SM-2HMIR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.61591
GTEX-P4QT-1626-SM-2S1NP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.16339
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-A45Y-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Crus II, right, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.28238
GTEX-OHPL-0326-SM-33HC8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.46804
Lung adenocarcinoma_LUAD_TCGA-62-A471-01A-12R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Sarcoma_SARC_TCGA-DX-AB2J-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Penis_Foreskin_Melanocyte_Primary_Cells_skin01	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.74786
Lung adenocarcinoma_LUAD_TCGA-55-8514-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BD-11-DV28_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.302006
lateral nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.78859
ZNF208	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.10311
parathyroid gland	HPA Tissue Protein Expression Profiles	1.0	0.925208
EM-2	GDSC Cell Line Gene Expression Profiles	1.0	2.02397
Uterine Carcinosarcoma_UCS_TCGA-N6-A4VG-01A-31R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TP53	JASPAR Predicted Transcription Factor Targets	1.0	null
TAL1_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung adenocarcinoma_LUAD_TCGA-NJ-A55R-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr10_45959619_A_ATTCAGGG_b38	GTEx eQTL 2025	1.0	6.60116
CRCGN011_HEPG2_24H:O06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.1821
PTP4A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.30698
Prostate adenocarcinoma_PRAD_TCGA-KK-A8II-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN008_HEPG2_24H:O02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.82645
GSE105169,GSE105175_0_v_1_dhx36_human	RummaGEO Gene Perturbation Signatures	-1.0	null
vagina	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7HF-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-UP-A6WW-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
lmo4_17452977_mcf7_lof_human_gpl570_gds2789	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.015232
CRCGN008_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.85825
Brain Lower Grade Glioma_LGG_TCGA-HT-A74J-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC6604319-13072_2019_278_MOESM3_ESM.xlsx-CEM_ect_TET2_DEGs_DMRs_hDMRs-CCRF-CEM_EV_vs_ectopic_TET2_TET2	Rummagene Transcription Factor Associations 2026	1.0	null
PTDSS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.14819
MFSD13A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60795
CRCGN009_HEPG2_24H:O02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.25884
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4697-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC3371315-NIHMS350140-supplement-13.xls-MCF7-T47D-SK-453_Up_Common_xls-Supplementary_Table_6_Luminal_Signature_Genes_increased_in_all_four_cell_lines_MCF7_T47D_MB-453_SKBR3_with_knockdown_of_FOXA1_FOXA1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-PWOO-2426-SM-2S1OV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02078
GSE174498,GSE174500_2_v_1_asparaginase_human	RummaGEO Drug Perturbation Signatures	1.0	null
NB10	GDSC Cell Line Gene Expression Profiles	1.0	2.02667
GTEX-SJXC-0326-SM-2XCFI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02779
PMC10602967-18_2023_4927_MOESM3_ESM.xlsx-MBNL1_2_KD_HeLa-Unnamed_1_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-TSE9-0011-R11A-SM-3DB7N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02584
GBA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.53862
Lung squamous cell carcinoma_LUSC_TCGA-85-A4PA-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100468_PCx_no dementia_TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.25257
gtpase activator activity	GO Molecular Function Annotations 2015	1.0	null
GTEX-OOBJ-2126-SM-3NB1N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.56557
Lung adenocarcinoma_LUAD_TCGA-97-A4M1-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-5359-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Endocytosis	KEGG Pathways 2026	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KK-A7AZ-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WEY5-0006-SM-3GIKG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.71526
SACM1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.12767
hindbrain	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
AE-42-HT01_0.1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.212496
Prostate adenocarcinoma_PRAD_TCGA-YL-A8SO-01B-31R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R3RS-0005-SM-3GAEH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.836408
inner SZ in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.04677
SP in posterior parahippocampal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.18489
GTEX-XAJ8-1126-SM-47JYA	GTEx Tissue Sample Gene Expression Profiles	1.0	0.888833
FD-91-OK66_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.269552
GTEX-XUJ4-0626-SM-4BOOO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.97401
Skin carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.055
RPL23	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.64262
MRPL51	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0828
GTEX-NL4W-0006-SM-2I3GH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.82802
GTEX-XPVG-0006-SM-4B65Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.66654
CRCGN009_HEPG2_24H:F20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.65435
CRCGN012_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.84664
CRCGN015_MCF10A.WT.HP_24H:M07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.37303
Head and Neck squamous cell carcinoma_HNSC_TCGA-P3-A5QA-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NL4W-0008-SM-4E3I2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.979312
Crus I, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.1687
GTEX-OHPM-0006-SM-2HMKU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.91241
POU2F2_GM12878_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
regulation of gtpase activity	GO Biological Process Annotations 2015	1.0	null
Crus I, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.00499
HCC366	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.897166
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4355-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70O-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4714-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXB2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	14.2251
GTEX-Q2AH-0005-SM-33HBR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.77737
GTEX-WFG7-2326-SM-3GIKV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.889883
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A51H-06A-12R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55G-0326-SM-48FDM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.833453
CEBPB_K562_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Obesity_Muscle - Striated (Skeletal) (MMHCC)_GSE5109	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.69981
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5885-01A-11R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GABPA_HeLa-S3_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
inner CP in superolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.32565
GTEX-XV7Q-0126-SM-4BRVK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.925304
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4822-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-R8-A73M-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RVPU-0011-R1A-SM-2XCAI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08226
Kidney renal papillary cell carcinoma_KIRP_TCGA-HE-A5NL-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ISX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.1659
DU4475	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.14712
G122	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.943633
TUBA1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-6.15339
GTEX-N7MT-0726-SM-3TW8S	GTEx Tissue Sample Gene Expression Profiles	1.0	0.983899
rostral division of VL	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.25511
Pancreatic adenocarcinoma_PAAD_TCGA-OE-A75W-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KNS-81-FD	GDSC Cell Line Gene Expression Profiles	-1.0	-1.5311
abducens nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.837616
Brain Lower Grade Glioma_LGG_TCGA-VW-A8FI-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SW 620	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.49113
GTEX-REY6-0826-SM-2TF4S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.27846
GTEX-NPJ8-2426-SM-3MJHL	GTEx Tissue Sample Gene Expression Profiles	1.0	0.834153
LHX5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.0559
nucleus subceruleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.849396
V, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.07179
VAX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.4062
GTEX-XXEK-1126-SM-4BRUX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.75289
GTEX-XXEK-0008-SM-4BRW7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.84665
tissues, cell types and enzyme sources	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
pancreas_6a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.05429
skeletalmuscle_e	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.16031
KLF13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59657
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4960-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC5989213-41467_2018_4462_MOESM8_ESM.xlsx-3-Supplementary_Data_3_List_of_2687_genes_differentially_expressed_between_SETBP1-G870S_and_Empty_293_FLP-In_lines_SETBP1	Rummagene Transcription Factor Associations 2026	1.0	null
SNX21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.16474
VIIB	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.04578
SK-MEL-31	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38713
Kidney renal papillary cell carcinoma_KIRP_TCGA-MH-A856-01A-11R-A355-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S341-0326-SM-2XCAU	GTEx Tissue Sample Gene Expression Profiles	1.0	0.832048
SP in midinferior temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.65278
inner CP in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.02078
GTEX-PW2O-1726-SM-2S1OO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.940348
HOXA5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.597
GTEX-WHSB-0005-SM-3LK7C	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08887
GTEX-OOBJ-2626-SM-2I3F6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08387
GSE119978,GSE180930_6_v_8_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3322-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE213588_8_v_1_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
MCAS	CCLE Cell Line Gene CNV Profiles	1.0	1.78482
CA-68-KG29_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.306033
RNPC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33674
GTEX-O5YT-1626-SM-32PK6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.12617
GTEX-PSDG-0426-SM-2S1OF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.917835
EFM-192B	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02066
Skin Cutaneous Melanoma_SKCM_TCGA-FW-A3I3-06A-11R-A21D-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Rectum adenocarcinoma_READ_TCGA-F5-6863-01A-11R-1928-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XXEK-1226-SM-4BRUY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.864212
C2BBE1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.896847
Kidney Chromophobe_KICH_TCGA-KL-8327-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GH3 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.741
DLX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.5005
MEOX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.265
frontal pole, right, inferior aspect	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-3.18391
Lung squamous cell carcinoma_LUSC_TCGA-43-7656-01A-11R-2125-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
T47D	CCLE Cell Line Gene CNV Profiles	1.0	1.72163
Lung squamous cell carcinoma_LUSC_TCGA-77-A5GB-01B-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MED25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31093
GTEX-QLQ7-1726-SM-2S1QQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.36418
GTEX-T2IS-3126-SM-32QPK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.52055
SU.86.86	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02162
HOXB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.0915
USP28	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04263
cation binding	GO Molecular Function Annotations 2015	1.0	null
telencephalon	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-NL4W-0011-R11A-SM-2I3DW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.70631
HOXA1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.5981
GTEX-PW2O-0006-SM-2I3DV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.90749
GTEX-XQ3S-2526-SM-4BOOG	GTEx Tissue Sample Gene Expression Profiles	1.0	0.826673
GTEX-SE5C-0006-SM-4BRW5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02121
cecum	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
EA-18-FP00_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.330945
496100612_HIP_no dementia_no TBI_95-99_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.43302
GTEX-PWOO-0006-SM-2I3E3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.46834
Prostate adenocarcinoma_PRAD_TCGA-EJ-A46G-01A-31R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55F-0005-SM-2TF4W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.74464
GSE202434,GSE202438_15_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
VI, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.16727
MIXL1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.977
Ankyrin repeat-containing domain	InterPro Predicted Protein Domain Annotations	1.0	null
GTEx Skin 20-29 vs 70-79	GTEx Tissue-Specific Aging Signatures	1.0	7.7546
POP5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.3759
HOXB5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.7673
GTEX-U8T8-1426-SM-3DB9H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.26404
GTEX-XAJ8-0526-SM-47JYK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.832853
CRCGN015_HEPG2_48H:J22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.018
positive regulation of hydrolase activity	GO Biological Process Annotations 2015	1.0	null
HOXA4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.0623
GTEX-X8HC-0526-SM-4E3JA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00811
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-4224-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CAKI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19235
GSE213588_8_v_13_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
IX, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.21793
OCI-LY-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13945
skin_5f	HPA Tissue Sample Gene Expression Profiles	1.0	2.03894
positive regulation of GTPase activity	GO Biological Process Annotations 2023	1.0	null
HOXB7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.0668
GTEX-QDT8-0126-SM-48TZ1	GTEx Tissue Sample Gene Expression Profiles	1.0	0.914037
YAPC	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.08583
POLR2A_GM12878_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-VP-A87B-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PAX6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.1163
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-A54D-01A-21R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4971-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QDVN-0006-SM-48U1R	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.79729
Sarcoma_SARC_TCGA-DX-A6YT-01A-21R-A355-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
lateral hypothalamic area, anterior region, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.02683
GTEX-QVUS-0011-R10A-SM-3GIK3	GTEx Tissue Sample Gene Expression Profiles	1.0	0.998623
GTEX-S95S-1026-SM-4B64M	GTEx Tissue Sample Gene Expression Profiles	1.0	0.901121
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4341-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
lymphnode_5c	HPA Tissue Sample Gene Expression Profiles	1.0	1.31121
soft tissue	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4340-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WM-115	GDSC Cell Line Gene Expression Profiles	-1.0	-2.07689
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5UM-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4026482-pone.0097702.s010.xlsx-LPS_1_8FC_12hour-Symbol_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
GSX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.0803
AD-16-HL96_0.1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.312401
GTEX-SNMC-0126-SM-2XCFO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04127
SOCS4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33413
KYSE-270	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.55639
GTEX-T6MN-0526-SM-32PMS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.45454
membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CX-A4AQ-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55G-0008-SM-48FEX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.13316
RBM39	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.12852
HCC38	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0021
MZ in rostral entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.86151
nucleus	LOCATE Predicted Protein Localization Annotations	1.0	null
Lung adenocarcinoma_LUAD_TCGA-05-4422-01A-01R-1206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A7IF-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-T6MN-0008-SM-4DM7H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.979038
GTEX-QEG5-0426-SM-2I5GJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.31394
GSE120612_4_v_2_etoposide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ALX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.0793
GTEX-PWOO-0526-SM-2S1Q3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.993798
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A3MA-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-MN-A4N4-01A-12R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S341-0006-SM-3NM8D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.08725
anterior hypothalamic area, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.25089
17616640-TableS3	GeneSigDB Published Gene Signatures	1.0	null
GTEX-WOFL-0006-SM-3TW8K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.8477
GTEX-WH7G-1926-SM-4LVMM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49182
NUTM2G	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.93348
GATA2_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC11447041-41598_2024_74391_MOESM4_ESM.xlsx-B_ATF4-def_Tg_2_vs_DMSO_2-Supplementary_Table_4B_DEGs_in_ATF4-def_cells_comparing_Tg_2h_to_its_DMSO_control_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8XH-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
female reproductive system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GSE213588_8_v_12_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
FAM170A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34477
Bladder Urothelial Carcinoma_BLCA_TCGA-CF-A3MF-01A-12R-A21D-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
gtpase regulator activity	GO Molecular Function Annotations 2015	1.0	null
GTEX-NPJ8-0326-SM-2D7VV	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19324
PHOX2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.4877
U-2 OS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.3981
HOXB7-26014856-BT474-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
molecular layer of rostral subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.8689
NF2	MSigDB Cancer Gene Co-expression Modules	1.0	null
GTEX-U3ZN-0126-SM-4DXUM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06086
Skin Cutaneous Melanoma_SKCM_TCGA-GN-A4U9-06A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCRT2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.3335
NEU3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.47338
animal	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
Liver hepatocellular carcinoma_LIHC_TCGA-MR-A8JO-01A-12R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
midbrain reticular formation, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.00344
CRCGN011_HEPG2_24H:O03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.10695
Brain Lower Grade Glioma_LGG_TCGA-HT-7884-01B-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-TM-A84H-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4909989-ncomms11840-s2.xlsx-down-regulate-TEAD4-FL_YAP_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-XQ3S-0426-SM-4BOOA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.857195
ZNF35	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.6646
CRCGN015_HEPG2_48H:O11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.47609
hsa-miR-4418	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
supraoptic nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.80446
Acute Myeloid Leukemia_LAML_TCGA-AB-2990-03B-01T-0748-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-97-A4M5-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOSB::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	50.1369
Prostate adenocarcinoma_PRAD_TCGA-CH-5788-01A-11R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
facial motor nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.45771
HOXD9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.4833
GTEX-OHPM-0726-SM-3LK7A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.20761
VAX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.9122
Brain Lower Grade Glioma_LGG_TCGA-HT-7873-01B-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE186471_1_v_2_carnosol_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-MT-A67A-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RUSQ-2126-SM-47JXK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48407
CRCGN008_HEPG2_24H:L13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.35455
GTEX-QMR6-1926-SM-32PL9	GTEx Tissue Sample Gene Expression Profiles	1.0	0.957693
GTEX-Q2AG-0626-SM-2S1PV	GTEx Tissue Sample Gene Expression Profiles	1.0	0.936264
17616640-TableS1	GeneSigDB Published Gene Signatures	1.0	null
SYCE1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.32348
prostate	GTEx Tissue Gene Expression Profiles	1.0	0.882281
GTEX-OHPL-0008-SM-4E3I9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.22805
GTPase regulator activity	GO Molecular Function Annotations 2025	1.0	null
NCIH1915	CCLE Cell Line Gene CNV Profiles	1.0	1.55387
V	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.15691
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4813-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X5EB-0006-SM-46MV5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.773
GTEX-RNOR-2426-SM-48FDY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.4084
regulation of biological process	GO Biological Process Annotations 2015	1.0	null
GTEX-V1D1-2226-SM-3NMAX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.00301
POU5F1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.9992
GTEX-WHSB-1826-SM-3TW8M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.940256
CRCGN010_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.25255
layer I of piriform cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.33233
CP66-MEL	GDSC Cell Line Gene Expression Profiles	-1.0	-1.49873
cell part	LOCATE Predicted Protein Localization Annotations	1.0	null
GTEX-WL46-0626-SM-3LK7R	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.19781
SP in caudal midinferior temporal cortex (area TF)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.22166
TCOF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.00113
PMC11447041-41598_2024_74391_MOESM4_ESM.xlsx-B_ATF4-def_Tg_2_vs_DMSO_2-Unnamed_2_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
regulation of molecular function	GO Biological Process Annotations 2015	1.0	null
GTEX-SIU8-0626-SM-2XCDN	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48001
GTEX-QDT8-0011-R7A-SM-32PKF	GTEx Tissue Sample Gene Expression Profiles	1.0	0.986987
CC-17-JL38_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.590002
CRCGN008_HEPG2_24H:O06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.69677
GRPEL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.22874
BCL2L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.11503
MZ in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.853763
GSE160765_2_v_1_twist1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
JD-44-KF86_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.329176
cervix, uterine	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9RL-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE68925_1_v_0_fasudil_human	RummaGEO Drug Perturbation Signatures	1.0	null
CRCGN009_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.28225
GSE102467_1_v_2_pazopanib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-PWO3-1026-SM-2I5F2	GTEx Tissue Sample Gene Expression Profiles	1.0	2.34248
GTEX-P4QR-0006-SM-2I5GN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.55848
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-FA-A4BB-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CFPAC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.08583
FB-66-UU47_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.221949
RVH-421	GDSC Cell Line Gene Expression Profiles	-1.0	-2.19627
colonrectum_b	HPA Tissue Sample Gene Expression Profiles	-1.0	-0.954416
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-5374-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QEG4-0008-SM-48TYZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.15505
GSE139455_7_v_6_stat3_human	RummaGEO Gene Perturbation Signatures	1.0	null
area postrema	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.67225
CDX2-21074721-CACO-2-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
H2BC8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33217
CRCGN013_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.96239
CRCGN010_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.657
MCAS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.66887
chr10_46010070_G_A_b38	GTEx eQTL 2025	1.0	3.69658
496100656_HIP_no dementia_no TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.00489
GTEX-RUSQ-0126-SM-47JWV	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06161
POU2F1::SOX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.3248
stratum radiatum of caudal CA1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.44289
hsa-miR-4680-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
blood	GTEx Tissue Gene Expression Profiles	-1.0	-1.06944
GTEX-PWCY-2226-SM-2S1OP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.92299
GSE250089_0_v_3_epcam_human	RummaGEO Gene Perturbation Signatures	1.0	null
GMPR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36557
GTEX-NPJ7-0011-R11A-SM-2I3E8	GTEx Tissue Sample Gene Expression Profiles	1.0	2.25305
GTEX-OHPK-0006-SM-2HMKH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52073
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A4F9-06A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-KU-A66S-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-REY6-1726-SM-48FDL	GTEx Tissue Sample Gene Expression Profiles	1.0	0.884576
CRCGN012_HEPG2_24H:O02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.20498
OSR2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.6749
GATA2	JASPAR Predicted Transcription Factor Targets	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-S9-A6TY-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC6604319-13072_2019_278_MOESM3_ESM.xlsx-CEM_ect_TET2_DEGs_DMRs_hDMRs-Unnamed_4_TET2	Rummagene Transcription Factor Associations 2026	1.0	null
rostral division of OFCi (area 11)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.17946
SRF	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.3686
AHR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.70917
Pancreas	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.10625
nasopharynx	HPA Tissue Protein Expression Profiles	1.0	0.925208
Lung squamous cell carcinoma_LUSC_TCGA-58-A46L-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ATF3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.8695
GTEX-Q2AG-2826-SM-2HMJQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.74862
Head and Neck squamous cell carcinoma_HNSC_TCGA-H7-A76A-01A-51R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-WQ-A9G7-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-T2IS-2926-SM-32QPO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.86739
TOV21G	CCLE Cell Line Gene CNV Profiles	1.0	1.86698
FOSL2::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.4443
inner CP in posteroinferior (ventral) parietal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.03597
GTEX-VUSH-0005-SM-3NB2H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.860412
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4881-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-N7MS-0126-SM-3TW8O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.86127
Uterine Carcinosarcoma_UCS_TCGA-N5-A59E-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC10311050-mmc2.pdf-43-PHOX2B_PHOX2B	Rummagene Transcription Factor Associations 2026	1.0	null
MSX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.9034
excretory gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Pancreatic adenocarcinoma_PAAD_TCGA-H6-A45N-11A-12R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OHPN-0011-R11A-SM-2I5FM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.85889
GTEX-X261-3226-SM-3NMC3	GTEx Tissue Sample Gene Expression Profiles	1.0	0.917505
Liver Carcinoma	DisGeNET Gene-Disease Associations	1.0	null
GTEX-WFG7-2226-SM-3GIKP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.35217
Liver hepatocellular carcinoma_LIHC_TCGA-DD-AA3A-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Familial combined hyperlipidaemia_lymphoblast_GSE1010	GEO Signatures of Differentially Expressed Genes for Diseases	1.0	1.87843
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4819-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-ER-A42H-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-YL-A9WH-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4QS-1626-SM-2S1NH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.25767
PE/CA-PJ15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.831879
ribonucleoside triphosphate phosphatase activity	GO Molecular Function Annotations 2023	1.0	null
GTEX-XXEK-0005-SM-4BRWJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.51277
GTEX-XXEK-0326-SM-4BRVV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.9105
liver_d	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.53734
G121	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38713
GSE202434,GSE202438_7_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-QCQG-0006-SM-2S1OW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.93047
internal male genital organ	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
MAGEE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.76396
TEAD4	ENCODE Transcription Factor Targets	1.0	null
GTEX-S3XE-2026-SM-3K2B5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.26456
MEIS3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.9476
VIIIA, right, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.44381
HOXA3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.3928
GTEX-N7MS-2526-SM-2D7W3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.36466
Kidney Chromophobe_KICH_TCGA-KL-8324-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
biological_process	GO Biological Process Annotations 2015	1.0	null
PMC4026482-pone.0097702.s010.xlsx-LPS_1_8FC_1hour-Symbol_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-XLM4-1526-SM-4AT6D	GTEx Tissue Sample Gene Expression Profiles	1.0	1.54104
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A3MR-06A-11R-A21D-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-MP-A4T7-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QVUS-2826-SM-3GADB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39877
lateral ventricle	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
SNU-C1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.27036
RAX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.7933
GTEX-XGQ4-0326-SM-4GIEE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.24007
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-8098-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4638-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GATA5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.2076
GTEX-VJYA-0005-SM-3P5ZD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08245
ZNF516	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.01946
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A3GM-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11933697-41467_2025_58216_MOESM8_ESM.xlsx-SD6_ATF3_EV_NS1-SYMBOL_ATF3	Rummagene Transcription Factor Associations 2026	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-YL-A9WI-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN012_HEPG2_24H:O05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.41469
H9	GDSC Cell Line Gene Expression Profiles	1.0	2.15256
NCI-H2452	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.918901
GTEX-XAJ8-0006-SM-46MVM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.66841
GTEX-RVPU-2426-SM-2XCAR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.835474
PMC6683136-41598_2019_47363_MOESM2_ESM.xlsx-GENE_SET-Positive_correlation_of_ZEB1-AS1_and_other_genes_ZEB1	Rummagene Transcription Factor Associations 2026	1.0	null
Pleckstrin homology-like domain	InterPro Predicted Protein Domain Annotations	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8XJ-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZBTB33	ENCODE Transcription Factor Targets	1.0	null
GTEX-WHWD-0326-SM-3LK6L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.830237
D-566MG	GDSC Cell Line Gene Expression Profiles	-1.0	-2.06069
ZBTB26	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.7308
GTEX-N7MS-0008-SM-4E3JI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.905982
ZNF157	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	65.3657
GTEX-WFON-0005-SM-3NMC9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.54539
K562_Curcumin_100nM_24h	Sci-Plex Drug Perturbation Signatures	1.0	0.0171386
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A2RA-01A-11R-A18M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HLF	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.0292
GTEX-XBEC-0006-SM-4AT5T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04954
GTEX-Q2AG-0326-SM-48U1O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.929277
GTEX-WY7C-0006-SM-3NB3L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.99081
GTEX-QDT8-2926-SM-32PKC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01999
GTEX-QMR6-0011-R6A-SM-32PKP	GTEx Tissue Sample Gene Expression Profiles	1.0	0.827496
GTEX-UTHO-0011-R11A-SM-3GIJE	GTEx Tissue Sample Gene Expression Profiles	1.0	2.01007
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-4223-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55G-2326-SM-2TC61	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.50891
CRCGN008_HEPG2_24H:I12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.14628
OVCAR433	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
BARX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.8964
PROX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.5947
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4989-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
POLR2AphosphoS5_GM12878_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTPase activator activity	GO Molecular Function Annotations 2023	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CR-7374-01A-11R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HUT102	CCLE Cell Line Gene CNV Profiles	-1.0	-1.3333
Kidney renal papillary cell carcinoma_KIRP_TCGA-Y8-A895-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2803-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE113734_3_v_0_qprt_human	RummaGEO Gene Perturbation Signatures	1.0	null
CRCGN015_HEPG2_48H:C22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.88246
EMX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.4281
outer CP in midlateral extrastriate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.930779
CRCGN013_HEPG2_24H:C23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.24186
abducens nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.44031
GSE178907_0_v_3_fkrp_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-X62O-0126-SM-4E3JN	GTEx Tissue Sample Gene Expression Profiles	1.0	0.880754
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A4F8-06A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WVLH-0006-SM-3MJF7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.37979
Lung adenocarcinoma_LUAD_TCGA-55-7727-01A-11R-2170-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VD-88-MW70_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.234862
endocrine gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-O5YT-0007-SM-32PK7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.954725
Lung squamous cell carcinoma_LUSC_TCGA-90-A4ED-01A-31R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN013_HEPG2_24H:I15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.09747
GTEX-XXEK-0826-SM-4BRWG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.866938
Lung squamous cell carcinoma_LUSC_TCGA-56-8307-01A-11R-2296-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE200839,GSE233826_5_v_4_tnrc18_human	RummaGEO Gene Perturbation Signatures	1.0	null
Sarcoma_SARC_TCGA-Z4-A9VC-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XMD1-0011-R11A-SM-4AT5J	GTEx Tissue Sample Gene Expression Profiles	1.0	0.885451
GTEX-SUCS-1326-SM-4DM5T	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12904
DRGX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.4199
KE39	CCLE Cell Line Gene CNV Profiles	-1.0	-1.51303
BT549	CCLE Cell Line Gene CNV Profiles	-1.0	-1.63266
XC-81-LR46_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.219189
GTEX-T5JC-2326-SM-32PMR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.72644
LA-42-ER00_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.325721
TGBC24TKB	GDSC Cell Line Gene Expression Profiles	1.0	1.72492
Prostate adenocarcinoma_PRAD_TCGA-KK-A7B4-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MDAMB468	CCLE Cell Line Gene CNV Profiles	1.0	2.59928
GTEX-QVJO-1325-SM-2S1QX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.64902
GTEX-XUYS-0008-SM-47JYZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.939992
Lung adenocarcinoma_LUAD_TCGA-95-A4VP-01A-21R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-T5JW-0426-SM-4DM7M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.03516
gh1	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.755
NCI-H2198	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.27036
chr10_45968301_A_T_b38	GTEx eQTL 2025	1.0	8.68299
Brain Lower Grade Glioma_LGG_TCGA-R8-A6YH-01A-21R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WDR5-24793694-LNCAP-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
salivary gland	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
SMAD3-21741376-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-QK-A6VC-01A-23R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
midbrain raphe nuclei	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.06478
zinc ion binding	GO Molecular Function Annotations 2015	1.0	null
POU3F4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.0502
subgranular zone of rostral dentate gyrus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.98032
chr10_45814391_T_C_b38	GTEx eQTL 2025	1.0	4.06792
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7CG-01A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-VUSG-1526-SM-4KKZH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.897498
pontine reticular formation, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.867682
NR2C2AP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.00668
CRCGN015_MCF10A.TP53.M_24H:J24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.07008
S100A13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.10477
USF1_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung adenocarcinoma_LUAD_TCGA-97-A4M0-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PX3G-1626-SM-2S1PT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.40322
methotrexate_homo sapiens_gpl570_gds4272	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
ribonucleoside triphosphate phosphatase activity	GO Molecular Function Annotations 2025	1.0	null
GTEX-XLM4-2926-SM-4AT59	GTEx Tissue Sample Gene Expression Profiles	1.0	2.07796
RUNX1-27514584-CHIP-SEQ-MCF-7-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-ER-A2ND-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-WA-A7GZ-11A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PWOO-2326-SM-2S1PQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.43032
GATA4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.0702
SJSA1	CCLE Cell Line Gene CNV Profiles	-1.0	-2.02402
GBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.9667
KE37	CCLE Cell Line Gene CNV Profiles	1.0	1.45192
CRCGN017_MCF10A.TP53.M_24H:K24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.40418
SNU-475	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.516
Kidney renal papillary cell carcinoma_KIRP_TCGA-B1-A47N-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PKNOX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.6735
Lung adenocarcinoma_LUAD_TCGA-44-7660-01A-11R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CDX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.5552
GTEX-R55G-1026-SM-48FDI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.924423
SK-MEL-24	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.67826
Liver hepatocellular carcinoma_LIHC_TCGA-RC-A6M3-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A40J-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WYBS-1226-SM-3NM9N	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.889848
GTEX-S7SF-0526-SM-3K2BC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.863091
outer SZ in lateral temporal-occipital cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.834138
GTEX-T2IS-0926-SM-4DM5B	GTEx Tissue Sample Gene Expression Profiles	1.0	1.03404
Kidney renal papillary cell carcinoma_KIRP_TCGA-HE-A5NI-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NKX6-2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.4488
GTEX-T2IS-0011-R11A-SM-32QPC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.94552
MYCN	ChEA Transcription Factor Targets	1.0	null
GBX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.1058
PMC8986528-41586_2022_4598_MOESM6_ESM.xlsx-Fig_4f-NOL9_KD_downreg_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-OIZH-0005-SM-2HMJN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.44469
testis_7a	HPA Tissue Sample Gene Expression Profiles	1.0	0.909645
VIIIA, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.46013
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4811-01A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11216188-peerj-12-17616-s013.pdf-201-ZNF25_ZNF25	Rummagene Transcription Factor Associations 2026	1.0	null
superficial layers of olfactory entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.27264
Head and Neck squamous cell carcinoma_HNSC_TCGA-P3-A6SW-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Corpus callosum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	2.124
RAX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.0673
GSE159893_2_v_0_genistein_human	RummaGEO Drug Perturbation Signatures	1.0	null
CRCGN014_HEPG2_24H:D07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.66465
SG in midinferior temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.07292
estradiol_homo sapiens_gpl570_gds3283	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
hsa-miR-3164	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
MZ in retrosplenial cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.06761
EPLC-272H	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19235
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A3Z4-01A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P78B-0005-SM-2I5GM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.841359
DD-65-SA37_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.389183
PL21	CCLE Cell Line Gene CNV Profiles	-1.0	-2.24729
duodenum	HPA Tissue Protein Expression Profiles	1.0	0.925208
GTEX-NPJ8-1526-SM-2D7VU	GTEx Tissue Sample Gene Expression Profiles	1.0	0.883184
IX, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.21332
GTEX-WZTO-0006-SM-3NM9T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.907048
inferior olive, medial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.27854
MANBA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25901
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-6024-01A-11R-1686-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X5EB-2026-SM-4E3KA	GTEx Tissue Sample Gene Expression Profiles	1.0	0.910527
FA-88-II68_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.379441
IZ in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.2539
Lung squamous cell carcinoma_LUSC_TCGA-21-1083-01A-01R-0692-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-33-4533-01A-01R-1201-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U3ZH-0226-SM-3DB7B	GTEx Tissue Sample Gene Expression Profiles	1.0	0.952505
PPP2R5B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.21632
GTEX-S7PM-0526-SM-3NM92	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16086
Lung adenocarcinoma_LUAD_TCGA-50-5946-01A-11R-1755-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3426-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4707-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Connective tissue	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.985
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HF-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-FG-A4MX-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Arf GTPase activating protein	InterPro Predicted Protein Domain Annotations	1.0	null
CRCGN015_HEPG2_48H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.97192
outer CP in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.875863
PUS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.17308
Lung squamous cell carcinoma_LUSC_TCGA-77-A5G7-01B-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr10_46016302_T_C_b38	GTEx eQTL 2025	1.0	6.37516
NB6	GDSC Cell Line Gene Expression Profiles	1.0	2.4837
Head and Neck squamous cell carcinoma_HNSC_TCGA-P3-A6T4-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Chiasma	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.82
inner CP in (rostral) midinferior temporal cortex (area 36)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.843863
GTEX-W5X1-0426-SM-3GILB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14146
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A2IP-01A-11R-A180-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN011_HEPG2_24H:L03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.4797
SW 948	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
GATA2	ENCODE Transcription Factor Targets	1.0	null
RUNX2	ChEA Transcription Factor Targets	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-FF-A7CX-01A-12R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE169356_0_v_4_ivermectin_human	RummaGEO Drug Perturbation Signatures	1.0	null
CDX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.3506
HNFA-21074721-CACO-2-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
HCC1569	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.2904
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4821-01A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE174498,GSE174500_5_v_1_asparaginase_human	RummaGEO Drug Perturbation Signatures	1.0	null
MASTL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.43213
GTEX-WFON-2326-SM-3LK7M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.874095
GTEX-T6MN-0005-SM-32PLJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.67117
MC116	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.16748
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A3HE-01A-21R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-60-2726-01A-01R-0851-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S4Q7-1226-SM-4AD5I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41729
OVK18	CCLE Cell Line Gene CNV Profiles	1.0	1.59848
intermediate portion of DFC (area 9/46)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.29957
HCC2218	CCLE Cell Line Gene CNV Profiles	1.0	1.34769
GTEX-S32W-1326-SM-4AD5Q	GTEx Tissue Sample Gene Expression Profiles	1.0	0.928795
prostate_4b	HPA Tissue Sample Gene Expression Profiles	1.0	0.97888
LBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.9931
VIIAt	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.983026
496100615_HIP_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16471
Sarcoma_SARC_TCGA-DX-A2IZ-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-96-A4JL-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GABRA5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.34731
IV	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.03125
BGC823	CCLE Cell Line Gene CNV Profiles	1.0	1.6891
C32	GDSC Cell Line Gene Expression Profiles	-1.0	-2.7712
JL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.05703
GTEX-WL46-0526-SM-3LK7W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.857078
Mesothelioma_MESO_TCGA-LK-A4O6-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5UL-06A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
C32TG	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20988
Prostate adenocarcinoma_PRAD_TCGA-HC-8260-01A-11R-2263-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VIIIB, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.53092
Basal cell carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.163
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A907-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE202434,GSE202438_9_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
emboliform nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.62948
SMOX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04193
Lung squamous cell carcinoma_LUSC_TCGA-85-A511-01A-21R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WHSE-3026-SM-3P5ZH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.10225
hsa-miR-3671	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
GTEX-X5EB-0626-SM-46MVQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.831849
caco2	HPA Cell Line Gene Expression Profiles	1.0	0.832555
GTEX-OIZH-0926-SM-48TBR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08593
Acute Myeloid Leukemia_LAML_TCGA-AB-2841-03B-01T-0760-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
wm115	HPA Cell Line Gene Expression Profiles	-1.0	-1.44095
GTEX-QDT8-2526-SM-48TYX	GTEx Tissue Sample Gene Expression Profiles	1.0	0.834344
Pancreatic adenocarcinoma_PAAD_TCGA-3A-A9I9-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
intracellular organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9R7-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IZ in midlateral extrastriate cortex (area 19)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.844358
GTEX-X4XX-0005-SM-3NMCS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.06232
GTEX-XXEK-0004-SM-4BRWO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.37594
ZNF418	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.7861
GTEX-XUZC-0005-SM-4BOQ8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.55995
Sarcoma_SARC_TCGA-DX-A3UD-01A-11R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-J2-A4AE-01A-21R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-A54I-01A-21R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXC9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.03779
CRCGN015_MCF10A_48H:L21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.05048
GTEX-Y8E5-0006-SM-47JWQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16282
GTEX-R55G-0526-SM-2TC5O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.897062
GTEX-XGQ4-0005-SM-4AT5U	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.60465
CRCGN010_HEPG2_24H:D11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.12085
locus ceruleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.860816
NCI-H1648	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.67209
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A51N-06A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KA-81-AG66_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.208632
Acute Myeloid Leukemia_LAML_TCGA-AB-2994-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HS 683	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.00326
CRCGN015_HEPG2_48H:G15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.62127
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4335-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MITF	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.0014
Lung adenocarcinoma_LUAD_TCGA-86-7713-01A-11R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXB4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.1968
VZ in caudal subicular cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.39611
LU-65	GDSC Cell Line Gene Expression Profiles	1.0	1.43377
Head and Neck squamous cell carcinoma_HNSC_TCGA-TN-A7HI-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-DH-A7UT-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55E-0006-SM-2TC5G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02087
GTEX-S95S-1126-SM-4B64E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.15603
GTEX-S4Z8-0006-SM-3K2AQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.844841
hsa-miR-129-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
IZ in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.01343
CRCGN015_HEPG2_48H:P19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.64277
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70N-01A-12R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EDA2R	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37213
Lung adenocarcinoma_LUAD_TCGA-55-7910-01A-11R-2170-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-UTHO-3026-SM-3GAFB	GTEx Tissue Sample Gene Expression Profiles	1.0	0.930816
Kidney renal papillary cell carcinoma_KIRP_TCGA-SX-A7SS-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EJM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
Liver hepatocellular carcinoma_LIHC_TCGA-RC-A7SH-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-73-7498-01A-12R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WHPG-2226-SM-3NMBO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.15815
Lung adenocarcinoma_LUAD_TCGA-49-4510-01A-01R-1206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2897-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WFG7-0826-SM-3GIKU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.961011
PMC8185471-mmc4.xlsx-D2-DEGs_between_SOX15_KO_DPs_and_WT_DPs_cells_at_day_2_padj_0_05_Log2FoldChange_0_5_SOX15_KO_WT_or_Log2FoldChange_-0_5_SOX15_KO_WT_SOX15	Rummagene Transcription Factor Associations 2026	1.0	null
Lung adenocarcinoma_LUAD_TCGA-44-2659-01A-01R-0946-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WY7C-0526-SM-3NB3D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.31182
intracellular part	LOCATE Predicted Protein Localization Annotations	1.0	null
cochlear nuclei, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-2.33501
GSE242083,GSE242098_2_v_1_med1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70T-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DHX58	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.28044
GTEX-P44H-0011-R11A-SM-2XCER	GTEx Tissue Sample Gene Expression Profiles	1.0	2.2875
BCPAP	GDSC Cell Line Gene Expression Profiles	-1.0	-1.59256
Head and Neck squamous cell carcinoma_HNSC_TCGA-IQ-A61I-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
head	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
20460542-SuppTable1	GeneSigDB Published Gene Signatures	1.0	null
organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
FF-28-ES17_1uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.245913
nucleus accumbens, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.11465
Acute Myeloid Leukemia_LAML_TCGA-AB-2999-03B-01T-0748-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OXRP-2326-SM-2S1NL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.54867
PMC3371315-NIHMS350140-supplement-9.xls-MCF7-T47D-SK-453_Up_MCF7-T47D_x-Supplementary_Table_2_ER-positive_FOXA1_signature_Genes_increased_only_in_MCF7_and_T47D_cells_with_knockdown_of_FOXA1_FOXA1	Rummagene Transcription Factor Associations 2026	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4352-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MS-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4969-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4QS-2126-SM-3NMCF	GTEx Tissue Sample Gene Expression Profiles	1.0	0.841442
TAB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.2168
GTEX-R55E-0526-SM-2TC6B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.26631
GTEX-S7PM-0626-SM-4AD4Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14734
FOXC1	JASPAR Predicted Transcription Factor Targets	1.0	null
CA9-22	COSMIC Cell Line Gene CNV Profiles	1.0	2.15316
CD4_Naive_Primary_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.71406
GTEX-U3ZM-1626-SM-4DXSK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.61507
regulation of metabolic process	GO Biological Process Annotations 2015	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KK-A7B1-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XBEW-0126-SM-4AT66	GTEx Tissue Sample Gene Expression Profiles	1.0	0.984915
P53-22127205-FIBROBLAST-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-SP-A6QK-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
facial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.2545
HLF	CCLE Cell Line Gene CNV Profiles	-1.0	-2.45388
GTEX-T2IS-2026-SM-4DM6W	GTEx Tissue Sample Gene Expression Profiles	1.0	1.57935
GTEX-QLQ7-0005-SM-2S1QP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.950203
Prostate adenocarcinoma_PRAD_TCGA-KK-A7B3-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
lymph node	HPA Tissue Gene Expression Profiles	1.0	0.949935
CRCGN008_HEPG2_24H:O13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.0977
Kidney renal papillary cell carcinoma_KIRP_TCGA-B9-4116-01A-02R-1351-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Occipital lobe	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.692
BBX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.26626
GTEX-WY7C-1126-SM-3NB3A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.896851
central gray of the pons, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.29255
TE1	CCLE Cell Line Gene CNV Profiles	1.0	1.99426
positive regulation of gtpase activity	GO Biological Process Annotations 2015	1.0	null
GTEX-WFG8-0006-SM-3GIKS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.968059
GTEX-WHSE-0011-R2A-SM-3P5ZL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.06157
GTEX-R53T-1826-SM-3GIJX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.908321
ovary	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
Parotid acinar cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.132
hsa-miR-607	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
GSE202434,GSE202438_9_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HS 69ST	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.4
Kidney renal clear cell carcinoma_KIRC_TCGA-MM-A84U-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QDVN-0326-SM-2I3FS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.887383
MAPKAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.24235
GTEX-Q2AH-0226-SM-48U1I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23161
MHHES1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.46228
POLR2A	ENCODE Transcription Factor Targets	1.0	null
GTEX-QDT8-0011-R11A-SM-32PKD	GTEx Tissue Sample Gene Expression Profiles	1.0	2.65815
pancreas_6b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.57342
SOX13	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.6555
PMC7403583-41598_2020_69884_MOESM2_ESM.xlsx-Sheet1-Supplementary_Table_1_Differentially_Expressed_Genes_FDR_q_0_05_in_U2932_ROCK2_KD_vs_Scrambled_shRNA_Constrols_AR	Rummagene Transcription Factor Associations 2026	1.0	null
U2AF1L4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33181
GTEX-OIZH-2126-SM-3NB1P	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11213
IV, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.03223
HS 695T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.31164
GSE112365_0_v_1_sirt1_human	RummaGEO Gene Perturbation Signatures	1.0	null
smooth muscle	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
GSE135030_11_v_0_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
X, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.52075
SUPM2	CCLE Cell Line Gene CNV Profiles	-1.0	-2.1616
Brain Lower Grade Glioma_LGG_TCGA-DH-A7UV-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-22-5481-01A-31R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S7SE-2526-SM-2XCDL	GTEx Tissue Sample Gene Expression Profiles	1.0	3.13135
hypoglossal nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.833636
DB-54-GQ68_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.20826
Crus II, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.00168
hsa-miR-4682	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
BT474	CCLE Cell Line Gene CNV Profiles	-1.0	-1.43219
GTEX-R55E-0008-SM-48FCG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.39017
GSE220097_4_v_1_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-EP-A2KB-01A-11R-A180-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KLF4-19829295-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
NFIL3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.7951
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A2LS-01A-22R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XXEK-1826-SM-4BRVC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01801
GTEX-NPJ8-0007-SM-2D7VX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.08015
496100635_HIP_dementia_TBI_77_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.33305
GTEX-RU72-3126-SM-46MUB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.1672
COLO 857	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.60346
liver	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
KMS-34	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.831879
CRCGN016_MCF10A.TP53.M_24H:I12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.48805
NCI-H522	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04931
hypoglossal nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.01168
Bladder Urothelial Carcinoma_BLCA_TCGA-KQ-A41R-01A-21R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NL3H-0006-SM-2I3FW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.22001
GNA11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32486
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4817-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-55-6971-11A-01R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RVPU-0008-SM-3NM8B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01609
JMSU1	CCLE Cell Line Gene CNV Profiles	1.0	1.84549
ZBTB33_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NFKB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34831
bmi1_17452456_medulloblastoma_lof_human_gpl570_gds2724	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.33572
GSE202434,GSE202438_15_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
EVX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3172
GTPase activity	GO Molecular Function Annotations 2023	1.0	null
PMC10602967-18_2023_4927_MOESM3_ESM.xlsx-MBNL1_2_KD_HeLa-Unnamed_2_AR	Rummagene Transcription Factor Associations 2026	1.0	null
biological regulation	GO Biological Process Annotations 2015	1.0	null
GSE240468_3_v_2_nfyc_human	RummaGEO Gene Perturbation Signatures	1.0	null
ventral tegmental area	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.03915
positive regulation of metabolic process	GO Biological Process Annotations 2015	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-AL-3472-01A-01R-1193-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-A5R9-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OCI-M2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.35241
Pituitary blastoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.146
GTEX-RN64-0008-SM-48FEZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.9284
BD-04-NG34_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.260969
HOXA2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.2244
GTEX-S4Q7-1526-SM-3K2AG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.3928
Lung squamous cell carcinoma_LUSC_TCGA-43-A56V-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
urogenital system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
HSF4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.1732
Mean corpuscular volume	GWAS Catalog SNP-Phenotype Associations 2025	1.0	1.05229
VIIB, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.34915
CRCGN017_MCF10A.TP53.M_24H:F01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.77957
Lung adenocarcinoma_LUAD_TCGA-55-7728-01A-11R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
doxorubicin_homo sapiens_gpl570_gse46493	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GTEX-NFK9-0626-SM-2HMIV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.12378
SREBF2	JASPAR Predicted Transcription Factor Targets	1.0	null
GTEX-WYVS-1726-SM-3NMAY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.28558
GTEX-XPT6-1626-SM-4B655	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08577
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-7861-01A-11R-2232-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WFJO-0926-SM-4LVM2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18813
GTEX-S95S-1526-SM-2XCDH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.877029
GTEX-XGQ4-0008-SM-4AT3Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.84362
GTEX-R45C-1226-SM-48FEE	GTEx Tissue Sample Gene Expression Profiles	1.0	0.852249
GTEX-XQ8I-1726-SM-4BOQB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.86644
metencephalon	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
muscle	GTEx Tissue Gene Expression Profiles	-1.0	-1.6254
GTEX-XGQ4-2426-SM-4AT55	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.847903
GSE217541,GSE217543_0_v_2_tet1_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-Q734-0226-SM-48U1A	GTEx Tissue Sample Gene Expression Profiles	1.0	0.885159
Head and Neck squamous cell carcinoma_HNSC_TCGA-MZ-A5BI-01A-31R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN011_HEPG2_24H:O01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.78745
positive regulation of catalytic activity	GO Biological Process Annotations 2015	1.0	null
CRCGN013_HEPG2_24H:O05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.36874
GTEX-OIZI-0626-SM-2XCEH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.18531
Frontal lobe	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.916
IX	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.07819
GTEX-RN64-0626-SM-2TC5V	GTEx Tissue Sample Gene Expression Profiles	1.0	0.861516
Acute Myeloid Leukemia_LAML_TCGA-AB-2859-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-A4CH-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC10282096-41467_2023_39038_MOESM4_ESM.xlsx-All_genes_Upregulated-ENSG00000177426_TGIF1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-P4PQ-0008-SM-48TDX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.11832
GSE188570,GSE188571_3_v_4_decitabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-QV31-0126-SM-447BP	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01385
Lung adenocarcinoma_LUAD_TCGA-93-A4JO-01A-21R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CPSF6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.39563
CRCGN012_HEPG2_24H:O06	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.11878
COV504	CCLE Cell Line Gene CNV Profiles	-1.0	-1.95243
Kidney renal papillary cell carcinoma_KIRP_TCGA-F9-A7Q0-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DHX37	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.17373
GTEX-OHPL-3026-SM-3MJGS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.937152
DETROIT 562	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
posterior hypothalamic area, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.24988
hsa-miR-557	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
GTEX-RU72-0011-R11A-SM-2TF6J	GTEx Tissue Sample Gene Expression Profiles	1.0	1.58603
Prostate adenocarcinoma_PRAD_TCGA-XJ-A83F-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
viscus	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-WVLH-2926-SM-3MJG5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.179
MXRA8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32388
SNU478	CCLE Cell Line Gene CNV Profiles	-1.0	-1.51928
Lung adenocarcinoma_LUAD_TCGA-86-A4D0-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SK-MES-1	GDSC Cell Line Gene Expression Profiles	1.0	2.06527
hel	HPA Cell Line Gene Expression Profiles	-1.0	-2.27372
GTEX-SJXC-0726-SM-2XCFJ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.977315
GTEX-XGQ4-1026-SM-4AT4L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.826196
GTEX-NPJ8-2626-SM-2D7W2	GTEx Tissue Sample Gene Expression Profiles	1.0	3.0089
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-5443-01A-01R-1514-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEx Heart 20-29 vs 70-79	GTEx Tissue-Specific Aging Signatures	1.0	7.44804
GTEX-XXEK-1426-SM-4BRW1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.26319
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HL-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-C9-A480-01A-12R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4904359-12915_2016_267_MOESM12_ESM.xlsx-LEUTX_DOWN-All_significantly_up_regulated_genes_determined_by_DESeq2_fold_change_greater_than_1_25_going_down_from_an_FPKM_of_at_least_2_LEUTX	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-R55C-1426-SM-48FED	GTEx Tissue Sample Gene Expression Profiles	1.0	1.46394
GTEX-TKQ2-1726-SM-4DXUP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.69467
SKNAS	CCLE Cell Line Gene CNV Profiles	-1.0	-1.6707
GTEX-U4B1-1526-SM-4DXSL	GTEx Tissue Sample Gene Expression Profiles	1.0	0.911082
PMC11447041-41598_2024_74391_MOESM4_ESM.xlsx-B_ATF4-def_Tg_2_vs_DMSO_2-Unnamed_1_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
WM-115	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.00326
CRCGN013_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.19385
small intestine	HPA Tissue Protein Expression Profiles	1.0	0.925208
NIH:OVCAR-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.831879
GTEX-UPK5-1626-SM-4JBHI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20184
Acute Myeloid Leukemia_LAML_TCGA-AB-2983-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN016_MCF10A.WT.HP_24H:A21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.17923
CEBPB_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-S7SE-0326-SM-4AT5Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18136
nb4	HPA Cell Line Gene Expression Profiles	1.0	2.4288
GTEX-U412-2026-SM-4DXSI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48831
Adrenocortical carcinoma_ACC_TCGA-OR-A5LJ-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-BT-A20J-01A-11R-A14Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prenatal Injuries	CTD Gene-Disease Associations	1.0	1.11501
GTEX-Q2AG-3026-SM-48U1L	GTEx Tissue Sample Gene Expression Profiles	1.0	2.23608
Peritoneal exudate	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.533
DD-36-YH76_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.266942
CRCGN008_HEPG2_24H:L15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.29382
DBP	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.8051
GTEX-QVUS-2926-SM-3GIJB	GTEx Tissue Sample Gene Expression Profiles	1.0	2.98788
Brain Lower Grade Glioma_LGG_TCGA-TQ-A7RU-01A-21R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
female reproductive gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
RPL21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.73186
chr10_45821414_C_T_b38	GTEx eQTL 2025	1.0	12.5473
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A4F0-06A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SRP19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.20222
CRCGN009_HEPG2_24H:O01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.54679
GTEX-U3ZN-2326-SM-3DB7W	GTEx Tissue Sample Gene Expression Profiles	1.0	1.29482
Brain Lower Grade Glioma_LGG_TCGA-DU-A6S8-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4PP-0326-SM-33HC4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.992736
Rectum adenocarcinoma_READ_TCGA-DY-A1H8-01A-21R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr10_45818713_T_C_b38	GTEx eQTL 2025	1.0	9.59405
GTEX-T5JC-0011-R11A-SM-32PMB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.65798
GTEX-QDVN-0526-SM-48TZ4	GTEx Tissue Sample Gene Expression Profiles	1.0	0.859318
plicamycin_homo sapiens_gpl570_gse25127	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GTEX-UTHO-2726-SM-4JBH9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19822
spleen	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
GSE196117_1_v_7_clarithromycin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
POU6F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.8619
GTEX-OOBJ-1626-SM-2I3F7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.18367
ZNF793	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.06571
GSE216273,GSE216292_14_v_6_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
POTEE	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19958
Lung adenocarcinoma_LUAD_TCGA-L4-A4E5-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WFON-1626-SM-4LVMV	GTEx Tissue Sample Gene Expression Profiles	1.0	0.985681
Sarcoma_SARC_TCGA-WK-A8XT-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pleckstrin homology domain	InterPro Predicted Protein Domain Annotations	1.0	null
CRCGN008_HEPG2_24H:D09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.6686
VIIIB, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.824302
GSE174498,GSE174500_0_v_1_asparaginase_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMC8481886-Table_1.xlsx-A_subsets-UC_MSC_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-RWSA-0005-SM-2XCAO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.936175
ZNF354A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	72.2702
Sarcoma_SARC_TCGA-DX-A48O-01A-11R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KNS-62	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.897166
FOS::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.6516
ML-2	GDSC Cell Line Gene Expression Profiles	1.0	1.59931
GTEX-XQ8I-0626-SM-4BOPT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.871239
SU-DHL-16	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.84753
forebrain	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-T8EM-1326-SM-3DB7G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08422
GTEX-S4UY-0526-SM-3K2AN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.1718
Acute Myeloid Leukemia_LAML_TCGA-AB-3011-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ileocecum	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
HAND2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.6685
CRCGN011_HEPG2_24H:O04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.37262
placenta	HPA Tissue Protein Expression Profiles	-1.0	-0.799784
COPI-coated vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.002
Kidney renal papillary cell carcinoma_KIRP_TCGA-HE-A5NJ-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A685-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-BC-A3KG-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ASPC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.980274
NCI-H1930	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02162
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A8HV-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
a2	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.758
SZ in posterior parahippocampal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.00823
GTEX-XXEK-0926-SM-4BRWH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.36318
Prostate adenocarcinoma_PRAD_TCGA-KC-A7F5-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XXEK-0626-SM-4BRWE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.00411
CRCGN017_MCF10A.WT.HP_24H:G12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.47937
Acute Myeloid Leukemia_LAML_TCGA-AB-3001-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X4EP-0005-SM-3P5ZE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.27445
SSBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.02859
enzyme regulator activity	GO Molecular Function Annotations 2015	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-E7-A3Y1-01A-11R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8709578-elife-69843-supp2.xlsx-HSF1_KO_2_E2_1h-Nearest_Ensembl_HSF1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-QV44-2026-SM-2S1RD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.49726
GTEX-WHSE-0006-SM-3NMBW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.02093
XBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25098
inner SZ in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.05107
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8YQ-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RM2N-1126-SM-48FCY	GTEx Tissue Sample Gene Expression Profiles	1.0	0.872998
CRCGN011_HEPG2_24H:O02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.78772
GTEX-PLZ4-0006-SM-2S1NY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.973988
Ankyrin repeat	InterPro Predicted Protein Domain Annotations	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5J5-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-E7-A97Q-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC2263127-pone.0001816.s001.xls-E2F3_down_Bild-Symbol_E2F3	Rummagene Transcription Factor Associations 2026	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-DB-A75K-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-62-A46S-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LTF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4024
RNF25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05345
GTEX-R55C-0005-SM-3GAE9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16421
hsa-miR-377	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
Acute Myeloid Leukemia_LAML_TCGA-AB-2982-03B-01T-0748-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QVJO-0006-SM-2S1RC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.27887
CLDN10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.13194
CEBPB	ENCODE Transcription Factor Targets	1.0	null
MEF2D	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.7933
Lung adenocarcinoma_LUAD_TCGA-78-7143-01A-11R-2039-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-91-A4BC-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IV, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.879467
ZNF729	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.0071
GTEX-RWSA-2026-SM-47JX8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.47872
GTEX-S33H-0005-SM-2XCAL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.13024
GTEX-T8EM-0006-SM-3DB71	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05888
GTEX-S7SE-0011-R1A-SM-2XCDE	GTEx Tissue Sample Gene Expression Profiles	1.0	0.915048
VZ in caudal entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.34138
DHX33	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04194
GTEX-XUZC-2126-SM-4BRW8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.995488
GATA6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.0662
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-4143-01A-01R-1188-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H446	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.2089
Kidney renal clear cell carcinoma_KIRC_TCGA-G6-A8L7-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE202744_1_v_3_toyocamycin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-S7SF-2026-SM-3K2AS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01115
GTEX-QVUS-0011-R8A-SM-3GAD7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.943885
YD-49-HM53_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.353187
GTEX-R55C-0008-SM-48FCF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.829046
TGFBR3L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.92412
outer SZ in orbital frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.956065
GTEX-RTLS-2326-SM-46MUH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.847711
TEF	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.3728
TEAD4_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PGBD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2574
GTEX-QEL4-0726-SM-3GIJ5	GTEx Tissue Sample Gene Expression Profiles	1.0	0.935559
VIIIA	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.910966
chr10_45862374_A_C_b38	GTEx eQTL 2025	1.0	4.02621
Skin Cutaneous Melanoma_SKCM_TCGA-GN-A4U4-06A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE169356_0_v_1_ivermectin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-WFG7-0726-SM-3GIKO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.859562
stomach	HPA Tissue Protein Expression Profiles	1.0	1.79955
GTEX-XYKS-0005-SM-4BRUD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00114
GTEX-TSE9-0005-SM-4DXUF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-2.18256
GSE242290_3_v_11_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
SG in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.64261
inner CP in dorsomedial extrastriate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.954965
valproic acid_homo sapiens_gpl96_gds1050	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
CRCGN015_HEPG2_48H:J16	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-4.00635
HD-51-KD29_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.251094
RUNX2	JASPAR Predicted Transcription Factor Targets	1.0	null
EF-74-KW12_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.318663
GTEX-OHPL-0426-SM-3TW8X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.942906
OCI-M1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10156
GSE173232_2_v_0_sf3b1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
OVCAR4	CCLE Cell Line Gene CNV Profiles	1.0	1.45667
GTEX-OXRK-0006-SM-2HML1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.57509
layer VI of caudal entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.18808
DLX6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.9456
GSE125219,GSE125221_4_v_8_arid1a_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Sarcoma_SARC_TCGA-DX-A7EI-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LIG4	Pathway Commons Protein-Protein Interactions	1.0	null
Gastric	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.85241
AFDN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.40137
NCI-H661	GDSC Cell Line Gene Expression Profiles	1.0	1.64312
Brain Lower Grade Glioma_LGG_TCGA-S9-A7QZ-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WY7C-2526-SM-3NB2N	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05018
GTEX-P44H-2426-SM-2XCEJ	GTEx Tissue Sample Gene Expression Profiles	1.0	2.06665
GTEX-UJMC-1926-SM-3GADS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.27995
Lung adenocarcinoma_LUAD_TCGA-MP-A4TF-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12623973-41467_2025_64981_MOESM3_ESM.xlsx-downregulated-c0_ACKR4_SCS_ceiling_LEC_TWIST1	Rummagene Transcription Factor Associations 2026	1.0	null
DC-47-KV62_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	-1.0	-0.351537
NCI-H820	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.962072
GTEX-OHPL-0006-SM-3MJHB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07242
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4351-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Mesothelioma_MESO_TCGA-SC-A6LN-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
urinary tract	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
imatinib_homo sapiens_gpl96_gds3045	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
whole body	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-R53T-0326-SM-48FEC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07825
GTEX-S4Z8-0226-SM-4AD5K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.0216
CRCGN015_HEPG2_48H:G01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-5.3901
SNU449	CCLE Cell Line Gene CNV Profiles	1.0	1.8478
urinary system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
superficial layers of caudal presubiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.847807
K-562	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.2904
III, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.30738
GTEX-XLM4-3126-SM-4AT6M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09758
Lung adenocarcinoma_LUAD_TCGA-L4-A4E6-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X261-0011-R11A-SM-4E3JY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.80122
Liver hepatocellular carcinoma_LIHC_TCGA-FV-A4ZQ-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-NK-A5CT-01A-31R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-E7-A4XJ-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-85-A510-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-DW-5560-01A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
C2BBE1	CCLE Cell Line Gene CNV Profiles	1.0	1.54612
TGFB1I1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.02538
GTEX-WH7G-1626-SM-4LVMY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45492
Crus II, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.33145
GMS10	CCLE Cell Line Gene CNV Profiles	-1.0	-3.21049
PRRX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.0327
CRCGN013_HEPG2_24H:L20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.66213
KCNK17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.54746
PFKM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05005
SNU-387	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.37388
Lung adenocarcinoma_LUAD_TCGA-MP-A5C7-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SP in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.981479
Bladder Urothelial Carcinoma_BLCA_TCGA-S5-AA26-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-55-7995-01A-11R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-75-7025-01A-12R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
motor nucleus of trigeminal nerve, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.13552
molecular function regulator	GO Molecular Function Annotations 2015	1.0	null
CRCGN013_HEPG2_24H:O01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.16598
CRYGD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.1826
gemcitabine_homo sapiens_gpl96_gse6914	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
KYSE-140	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.69292
Kidney renal papillary cell carcinoma_KIRP_TCGA-SX-A7SU-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-DD-A4NH-01A-11R-A27V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-EJ-A7NJ-01A-22R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXC8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	12.9176
male reproductive system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
GTEX-X4XX-0926-SM-46MV7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.871138
Lung adenocarcinoma_LUAD_TCGA-86-8585-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XXEK-0726-SM-4BRWF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.15629
CRCGN015_HEPG2_48H:P22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.64548
Brain Lower Grade Glioma_LGG_TCGA-QH-A6X4-01A-51R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SOX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.5501
Skin Cutaneous Melanoma_SKCM_TCGA-FW-A3R5-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5175-01A-01R-1426-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
polymorphic layer of caudal subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.02118
GTEX-S7SE-0011-R11A-SM-2XCDD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.87583
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5107-01A-01R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE202434,GSE202438_10_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-TSE9-2926-SM-3DB77	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20915
GTEX-PWCY-0526-SM-2I3ER	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.957183
USF1_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-SNOS-1126-SM-4DM67	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18082
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A8HS-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WWYW-3026-SM-3NB36	GTEx Tissue Sample Gene Expression Profiles	1.0	1.87227
Sarcoma_SARC_TCGA-DX-A3UB-01A-11R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
gland	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
14760100-Table1	GeneSigDB Published Gene Signatures	1.0	null
GSE202434,GSE202438_10_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
testis_7b	HPA Tissue Sample Gene Expression Profiles	1.0	0.907108
Skin Cutaneous Melanoma_SKCM_TCGA-FR-A726-01A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LA-42-ER00_10uM	NIBR DRUG-seq U2OS MoA Box Gene Expression Profiles	1.0	0.232157
OXCT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33769
NR1D2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.3045
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4833-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-55-6972-01A-11R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4992-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOSL2::JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	38.6909
GTEX-WH7G-0005-SM-3NMBX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.20401
OCT1-27270436-CHIP-SEQ-PROSTATE-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
corpus callosum	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
IZ in caudal midinferior temporal cortex (area TF)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.00606
Corticotropic cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.199
LHX9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.2033
mammillary body, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.993978
496100418_TCx_no dementia_TBI_85_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.46079
GTPase regulator activity	GO Molecular Function Annotations 2023	1.0	null
NCIH1755	CCLE Cell Line Gene CNV Profiles	1.0	1.52561
GTEX-NPJ7-2926-SM-3MJGQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48074
Annular pancreas	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.257
SSC4D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05976
GTEX-OIZF-1526-SM-3MJGY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.37237
olfactory bulb	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.62741
SNU-449	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.980274
CACO2	CCLE Cell Line Gene CNV Profiles	1.0	1.46398
GTEX-R55G-0826-SM-2TC5U	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.42241
GTEX-RNOR-2226-SM-2TF5O	GTEx Tissue Sample Gene Expression Profiles	1.0	1.38073
NCI-H1092	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.885854
ZNF24	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.712
GTEX-OHPM-0008-SM-4E3IP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.50559
GSE116492,GSE116495_3_v_2_stag2_human	RummaGEO Gene Perturbation Signatures	1.0	null
PRRX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.1705
GTEX-QXCU-1726-SM-2TC6L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.833816
Sarcoma_SARC_TCGA-IS-A3K6-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-O5YU-0008-SM-4E3I7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.992968
VIIIB	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.16603
ribavirin_homo sapiens_gpl570_gds4391	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
NCI-H2595	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20988
GTEX-VJYA-2026-SM-4KL1K	GTEx Tissue Sample Gene Expression Profiles	1.0	0.827365
u2197	HPA Cell Line Gene Expression Profiles	-1.0	-0.944242
GSE174498,GSE174500_3_v_1_asparaginase_human	RummaGEO Drug Perturbation Signatures	1.0	null
TCF12/HEB-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GSE77108_8_v_1_saha_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TP73	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.342
FOSL1::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.5289
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-6871-01A-11R-1873-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
brain stem	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
layer IIIu of area 35r	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.879214
GTEX-WRHU-0826-SM-3MJFN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.03813
Lung adenocarcinoma_LUAD_TCGA-86-A456-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RWS6-0008-SM-47JYV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.829818