association	dataset	threshold value	standardized value
ORAI2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.14238
FOXH1-21741376-EPCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
C99	DepMap CRISPR Gene Dependency	1.0	2.28153
TELO2	Pathway Commons Protein-Protein Interactions	1.0	null
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	Reactome Pathways 2024	1.0	null
homology	GeneRIF Biological Term Annotations	1.0	null
Perturb_3990_KD_Zeb1_ERP109420	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	20.0
ZFP42	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.742
CRCGN012_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.21305
H3K27me3_cardiac mesoderm_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN015_HEPG2_48H:O12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.17894
TPCN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.07665
FADU	CCLE Cell Line Gene CNV Profiles	1.0	2.00614
abnormality of bone marrow cell morphology	GWASdb SNP-Phenotype Associations	1.0	0.212843
C32TG	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19992
HCT-15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
periventricular nucleus, preoptic portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.22607
Eating disorder	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.034
RHOG	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_3H:J22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.27112
RAP1GDS1	Pathway Commons Protein-Protein Interactions	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-O2-A52W-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OC-314	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Zic2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	32.1462
LMO2-26923725-CHIP-SEQ-HEMOGENIC-ENDOTHELIUM-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Chondroblastoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.122
POLR2A_testis_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
rhogap	GeneRIF Biological Term Annotations	1.0	null
CYB561A3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38461
cytoplasmic part	LOCATE Predicted Protein Localization Annotations	1.0	null
Disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.273
HCC-15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.972569
viscus	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.050478
SNU-216 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.156
H3K27me3_cardiac mesoderm_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
AP1S1	Pathway Commons Protein-Protein Interactions	1.0	null
PLEKHG3	Pathway Commons Protein-Protein Interactions	1.0	null
TPX2	Pathway Commons Protein-Protein Interactions	1.0	null
TRAK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.03775
SCAMP1	Pathway Commons Protein-Protein Interactions	1.0	null
primary visual cortex (striate cortex, area V1/17)_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.05861
RGPD5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.00741
CHEMBL383736	DeepCoverMOA Drug Mechanisms of Action	1.0	0.23
H3K4me3_SK-N-SH_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
ANXA2	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN012_HEPG2_24H:G13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.16132
CRCGN009_HEPG2_24H:C20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.8407
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4699-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-77-7139-01A-11R-2045-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WT1-20215353-NEPHRON PROGENITOR-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
DUSP3	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN008_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.63242
SIN3A	ENCODE Transcription Factor Targets	1.0	null
rostral subdivision of medial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.82775
SOX2-18692474-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
APPL2	Pathway Commons Protein-Protein Interactions	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-EJ-A65D-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
intracellular organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
Signal Transduction	Reactome Pathways 2024	1.0	null
KLF14	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	138.302
positive regulation of molecular function	GO Biological Process Annotations 2015	1.0	null
HSPA1B	Pathway Commons Protein-Protein Interactions	1.0	null
urogenital system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
bipolar disorder	GWASdb SNP-Disease Associations	1.0	0.564921
spleen	GTEx Tissue Gene Expression Profiles	1.0	1.01169
A-VN-1203-2004(H5N1)_Day1-10^3pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.65742
Brain Lower Grade Glioma_LGG_TCGA-DB-A64V-01A-11R-A29R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SNX4	Pathway Commons Protein-Protein Interactions	1.0	null
TCF3	ChEA Transcription Factor Targets	1.0	null
RAB33B	Pathway Commons Protein-Protein Interactions	1.0	null
FOXD2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	56.6805
HS 69ST	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.92795
growth abnormality	GWASdb SNP-Phenotype Associations	1.0	0.2599
central nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Shu complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.524
16912175-SuppTable3a	GeneSigDB Published Gene Signatures	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-A4CD-01A-21R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BE-13	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K4me3_HEK293_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
NUGC-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
increased body weight	GWASdb SNP-Phenotype Associations	1.0	0.594972
Lung adenocarcinoma_LUAD_TCGA-78-8662-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-HQ-A2OE-01A-11R-A206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STX5	Pathway Commons Protein-Protein Interactions	1.0	null
BNIP1	Pathway Commons Protein-Protein Interactions	1.0	null
rheumatoid arthritis	GWASdb SNP-Phenotype Associations	1.0	0.490716
GSE131649_6_v_9_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CRCGN009_HEPG2_24H:F20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	6.83055
GSE133087_1_v_0_metformin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
SNX1	Pathway Commons Protein-Protein Interactions	1.0	null
WLS	Pathway Commons Protein-Protein Interactions	1.0	null
Prdm5	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	33.9014
blood cancer cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.065585
Lung squamous cell carcinoma_LUSC_TCGA-33-6738-01A-11R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC1395_BREAST	CCLE Cell Line Proteomics	1.0	2.98562
dorsolateral prefrontal cortex_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.32058
KARPAS-45	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HSDL2	Pathway Commons Protein-Protein Interactions	1.0	null
CHD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.08045
ATP6V1D	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of phosphorus metabolic process	GO Biological Process Annotations 2015	1.0	null
CRCGN014_HEPG2_3H:N09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.31521
Lung squamous cell carcinoma_LUSC_TCGA-39-5019-01A-01R-1820-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
periaqueductal gray substance, ventral portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.42489
Lung squamous cell carcinoma_LUSC_TCGA-56-7580-01A-11R-2045-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STAM	Pathway Commons Protein-Protein Interactions	1.0	null
chr22_44756088_TGAAGGCCAAGGCCAAACAG_T_b38	GTEx eQTL 2025	1.0	1.81596
VPS29	Pathway Commons Protein-Protein Interactions	1.0	null
EIF2B4	Pathway Commons Protein-Protein Interactions	1.0	null
CEBPB	JASPAR Predicted Transcription Factor Targets	1.0	null
ZC3H15	Pathway Commons Protein-Protein Interactions	1.0	null
ChIP_POU5F1_16518401	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
CPT1A	Pathway Commons Protein-Protein Interactions	1.0	null
SEL1L	Pathway Commons Protein-Protein Interactions	1.0	null
CTCF_choroid plexus epithelial cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
IMR-5	COSMIC Cell Line Gene Mutation Profiles	1.0	null
MS751	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.01401
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_HA-GENE_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
MAZ_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
female reproductive system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.061278
XPO7	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of blood and blood-forming tissues	GWASdb SNP-Phenotype Associations	1.0	0.05346
VTI1A	Pathway Commons Protein-Protein Interactions	1.0	null
PTPN1	Pathway Commons Protein-Protein Interactions	1.0	null
MAX_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RAB1A	Pathway Commons Protein-Protein Interactions	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-VP-A87B-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SRRM1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19517
PRPF19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	5.46008
male reproductive system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
DNAJC2-21179169-NT2-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
H3K9ac_heart_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
STEAP3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE235550_2_v_0_hspa9_human	RummaGEO Gene Perturbation Signatures	-1.0	null
regulation of molecular function	GO Biological Process Annotations 2015	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-7871-01A-11R-2232-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CSE1L	Pathway Commons Protein-Protein Interactions	1.0	null
SH2D3A	Pathway Commons Protein-Protein Interactions	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-HNF1B_HNF1B	Rummagene Transcription Factor Associations 2026	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-FD-A43N-01A-11R-A23W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
promotes	GeneRIF Biological Term Annotations	1.0	null
COLO 679	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.12701
TBPL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.88747
AKT1S1	Pathway Commons Protein-Protein Interactions	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-21-1077-01A-01R-0692-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
UCK2	Pathway Commons Protein-Protein Interactions	1.0	null
LDHA	Pathway Commons Protein-Protein Interactions	1.0	null
coupling	GeneRIF Biological Term Annotations	1.0	null
EZH2_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBP	ENCODE Transcription Factor Targets	1.0	null
Lung adenocarcinoma_LUAD_TCGA-49-4490-01A-21R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCCPDH	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-KU-A66S-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
colorectal	GeneRIF Biological Term Annotations	1.0	null
HCC1143	CCLE Cell Line Gene CNV Profiles	1.0	1.35829
Kidney renal clear cell carcinoma_KIRC_TCGA-B2-3923-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
female reproductive system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
CRCGN016_MCF10A.TP53.M_24H:L18	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.02452
mediodorsal nucleus of thalamus_8 yrs_M_12841	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.13739
CRCGN010_HEPG2_24H:K09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.65129
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5117-01A-01R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HAUS3	Pathway Commons Protein-Protein Interactions	1.0	null
SCAMP4	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_K562_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
VASP	Pathway Commons Protein-Protein Interactions	1.0	null
ECC4	DepMap CRISPR Gene Dependency	1.0	3.23087
CRCGN013_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.72882
cell part	LOCATE Curated Protein Localization Annotations	1.0	null
NCI-H1651	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-7862-01A-21R-2232-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
bone disease	GWASdb SNP-Disease Associations	1.0	0.114315
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
H3K9me3_A549_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of the genital system	GWASdb SNP-Phenotype Associations	1.0	0.10157
OSBPL10	Pathway Commons Protein-Protein Interactions	1.0	null
DTYMK	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN013_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.31082
abnormal internal genitalia	GWASdb SNP-Phenotype Associations	1.0	0.163765
Pancreatic adenocarcinoma_PAAD_TCGA-3E-AAAZ-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PICK1	Pathway Commons Protein-Protein Interactions	1.0	null
ovary	HPA Tissue Gene Expression Profiles	-1.0	-0.875858
H4K5ac_H1	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
H3K4me1_heart_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
CALR	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-A45W-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE114284_1_v_5_irf1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ARCN1	Pathway Commons Protein-Protein Interactions	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A29M-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5706-11A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN012_HEPG2_24H:G07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.80921
gap	GeneRIF Biological Term Annotations	1.0	null
RAB8A	Pathway Commons Protein-Protein Interactions	1.0	null
primary motor cortex (area M1, area 4)_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.01396
LOXIMVI	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K4me1_CH12.LX_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
A-431	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.864707
oral cleft	GWASdb SNP-Phenotype Associations	1.0	1.00059
CRCGN016_MCF10A.WT.HP_24H:P14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.5496
21205295-TableS1	GeneSigDB Published Gene Signatures	1.0	null
RHOBTB2	Pathway Commons Protein-Protein Interactions	1.0	null
FGD3	Pathway Commons Protein-Protein Interactions	1.0	null
USP9X	Pathway Commons Protein-Protein Interactions	1.0	null
FNBP1L	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:H05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.63666
PFKL	Pathway Commons Protein-Protein Interactions	1.0	null
hippocampus (hippocampal formation)_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.824073
CRCGN015_HEPG2_48H:J23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.14207
ChIP_SOX2_18692474	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
PMC3879300-pone.0084292.s002.xlsx-SPD_dataset-Gene_symbol_HOXD13	Rummagene Transcription Factor Associations 2026	1.0	null
CPLX1	Pathway Commons Protein-Protein Interactions	1.0	null
binding	GO Molecular Function Annotations 2015	1.0	null
CRCGN014_HEPG2_24H:J15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.37845
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-E2F4_E2F4	Rummagene Transcription Factor Associations 2026	1.0	null
TBC1D4	Pathway Commons Protein-Protein Interactions	1.0	null
Body Mass Index	DisGeNET Gene-Phenotype Associations	1.0	null
TRIM28	Pathway Commons Protein-Protein Interactions	1.0	null
ALDH1B1	Pathway Commons Protein-Protein Interactions	1.0	null
TSG101	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of ERK1 and ERK2 cascade	GO Biological Process Annotations 2023	1.0	null
OCI-LY-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.30486
PA1	DepMap CRISPR Gene Dependency	1.0	3.88939
intestine	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
IST1	Pathway Commons Protein-Protein Interactions	1.0	null
CUL3	Pathway Commons Protein-Protein Interactions	1.0	null
bpgap1	GeneRIF Biological Term Annotations	1.0	null
FASN	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A_48H:C20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.38147
CRCGN015_MCF10A.TP53.M_24H:O23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.03977
AP-4	MotifMap Predicted Transcription Factor Targets	1.0	null
CRCGN012_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.78733
Carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.202
NACA	Pathway Commons Protein-Protein Interactions	1.0	null
IGROV-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
abnormality of carbohydrate metabolism/homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.195687
IRF9	Pathway Commons Protein-Protein Interactions	1.0	null
Golgi-associated vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.163
Brain Lower Grade Glioma_LGG_TCGA-WY-A858-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN011_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.4271
DNAJB12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.13295
PLEKHA7	Pathway Commons Protein-Protein Interactions	1.0	null
SP4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	181.84
LRBA	Pathway Commons Protein-Protein Interactions	1.0	null
TTC39B	Pathway Commons Protein-Protein Interactions	1.0	null
PAX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.3987
H3K4me1_olfactory bulb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
NR1D2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.573
oocyte	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.05194
Lung adenocarcinoma_LUAD_TCGA-55-8514-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bhlha15	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	23.381
ANXA4	Pathway Commons Protein-Protein Interactions	1.0	null
RCCFG2	DepMap CRISPR Gene Dependency	1.0	2.97113
CTNND1	Pathway Commons Protein-Protein Interactions	1.0	null
EZH2_endothelial cell of umbilical vein_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
small GTPase mediated signal transduction	GO Biological Process Annotations 2023	1.0	null
CRCGN015_HEPG2_48H:L19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.44631
mania	GWASdb SNP-Phenotype Associations	1.0	0.481287
SCAMP2	Pathway Commons Protein-Protein Interactions	1.0	null
Right_Ventricle	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.03604
regulation of ERK1 and ERK2 cascade	GO Biological Process Annotations 2025	1.0	null
POLR2AphosphoS2_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ATP6V0D1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE242083,GSE242098_3_v_4_med1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-56-8083-01A-11R-2247-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF417	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.6436
reveal	GeneRIF Biological Term Annotations	1.0	null
HCC2935	CCLE Cell Line Gene CNV Profiles	1.0	1.35032
KLC1	Pathway Commons Protein-Protein Interactions	1.0	null
Bipolar Disorder	DisGeNET Gene-Disease Associations	1.0	null
GSE245418_0_v_2_cd109_human	RummaGEO Gene Perturbation Signatures	-1.0	null
BNIP2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE169617_1_v_2_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K4me1_megakaryocyte_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
PMC4909989-ncomms11840-s2.xlsx-down-regulate-TEAD4-S_YAP_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
KNTC1	Pathway Commons Protein-Protein Interactions	1.0	null
HEL	DepMap CRISPR Gene Dependency	1.0	2.20948
Lung squamous cell carcinoma_LUSC_TCGA-J1-A4AH-01A-31R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055593
RNF112	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.44296
H2AFZ_myotube_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
amyotrophic lateral sclerosis	GWASdb SNP-Phenotype Associations	1.0	0.510092
medial portion of STH	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.46715
COLO 320DM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
alimentary canal	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.051559
TMED1	Pathway Commons Protein-Protein Interactions	1.0	null
DBF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.11854
TAGLN2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE219195_1_v_3_rbm12_human	RummaGEO Gene Perturbation Signatures	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.36741
496100579_HIP_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.5508
FOXL1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.5504
GSE131649_2_v_0_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC9974104-jci-133-159940-s017.xlsx-GT3-INCP-GATA3_Co-down-Gene_ID_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
CRCGN015_HEPG2_48H:L02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.22261
POLR2A_small intestine_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
cellular_component	GO Cellular Component Annotations 2015	1.0	null
GSE133927_1_v_3_meox1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
HCC12	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.62616
PLEC	Pathway Commons Protein-Protein Interactions	1.0	null
HTT	Pathway Commons Protein-Protein Interactions	1.0	null
Endosomal scaffold complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.472
ETS2	MotifMap Predicted Transcription Factor Targets	1.0	null
COMMD3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205163,GSE205164_1_v_4_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
trunk	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.068597
Malignant Neoplasm	DisGeNET Gene-Disease Associations	1.0	null
SMC1A	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me1_brain_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
HCC1395	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.86044
FIG4	Pathway Commons Protein-Protein Interactions	1.0	null
SELENBP1	Pathway Commons Protein-Protein Interactions	1.0	null
RI1	DepMap CRISPR Gene Dependency	1.0	2.90948
Perturb_6583_KO_Setd1b_SRP308727	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	3.15682
CRCGN015_HEPG2_48H:J10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.38903
CRCGN016_MCF10A.TP53.M_24H:O10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.19318
GBF1	Pathway Commons Protein-Protein Interactions	1.0	null
COV644	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
HCT-116	Sanger Dependency Map Cancer Cell Line Proteomics	-1.0	-2.01282
PATZ1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	320.687
acute lymphoblastic leukemia cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.273346
POLR2A_MCF-7_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PHB	Pathway Commons Protein-Protein Interactions	1.0	null
GSE202434,GSE202438_12_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
ChIP_NANOG_18347094	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
SAR1A	Pathway Commons Protein-Protein Interactions	1.0	null
RSF1	Pathway Commons Protein-Protein Interactions	1.0	null
Hypertension	CTD Gene-Disease Associations	1.0	1.11396
RAB7A	Pathway Commons Protein-Protein Interactions	1.0	null
ACP1	Pathway Commons Protein-Protein Interactions	1.0	null
LY411575	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.53
GSE230744,GSE237803_5_v_3_hira_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE174701_4_v_0_maml3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
UHRF1	Pathway Commons Protein-Protein Interactions	1.0	null
MAPKAPK2	Pathway Commons Protein-Protein Interactions	1.0	null
Gastrointestinal system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.198
PAX5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.3654
orbital frontal cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.60113
SEC61G	Pathway Commons Protein-Protein Interactions	1.0	null
DGKQ	Pathway Commons Protein-Protein Interactions	1.0	null
JUND_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
cytoplasm	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
GSE131649_2_v_11_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
positive regulation of metabolic process	GO Biological Process Annotations 2015	1.0	null
LEMD3	Pathway Commons Protein-Protein Interactions	1.0	null
laterodorsal subdivision of area 8	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.10083
USO1	Pathway Commons Protein-Protein Interactions	1.0	null
496100521_HIP_no dementia_no TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.65211
Brain Lower Grade Glioma_LGG_TCGA-DU-A5TT-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE211215_1_v_0_pemetrexed_human	RummaGEO Drug Perturbation Signatures	1.0	null
VPS18	Pathway Commons Protein-Protein Interactions	1.0	null
ATP6V1H	Pathway Commons Protein-Protein Interactions	1.0	null
ELMO3	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me1_ES-E14_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
NUDT4	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-A6D8-01A-31R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-4430	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
Major Depressive Disorder	DisGeNET Gene-Disease Associations	1.0	null
TBC1D17	Pathway Commons Protein-Protein Interactions	1.0	null
GSE182770,GSE182784_0_v_1_chd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Clopidogrel_C-33 A	Tahoe Therapeutics Tahoe 100M Perturbation Atlas	-1.0	-0.00959626
PMC7818749-12931_2021_1617_MOESM1_ESM.xlsx-TBX4-SYMBOL_TBX4	Rummagene Transcription Factor Associations 2026	1.0	null
arterial stenosis	GWASdb SNP-Phenotype Associations	1.0	0.200988
AP3M1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K9me3_T-cell acute lymphoblastic leukemia_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
cytosol	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
SOX9-25088423-EMBRYONIC GONADS-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
domains	GeneRIF Biological Term Annotations	1.0	null
CRCGN017_MCF10A.TP53.M_24H:E08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.44708
STAT5B	Pathway Commons Protein-Protein Interactions	1.0	null
RIN1	Pathway Commons Protein-Protein Interactions	1.0	null
GTPBP1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE138633_2_v_0_bag3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE102467_1_v_2_pazopanib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Perturb_16531_KO_Cdk8/Cdk19_SRP351257	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-4.78499
H3K4me3_liver_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
hsa-miR-3689c	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
496100639_TCx_no dementia_no TBI_95-99_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.10866
UPMD1	DepMap CRISPR Gene Dependency	1.0	2.96855
PMC10082046-41467_2023_37049_MOESM6_ESM.xlsx-Sheet1-Supplementary_Data_3_Genes_downregulated_in_ASPS-KY_cells_by_ASPSCR1-TFE3_knockdown_TFE3	Rummagene Transcription Factor Associations 2026	1.0	null
KAP1-27257070-CHIP-SEQ-ESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
GSE98898_8_v_1_hoxa1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CRCGN014_HEPG2_24H:A16	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.61847
GSE216043_10_v_0_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
SCFD2	Pathway Commons Protein-Protein Interactions	1.0	null
HCC1263	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.972569
P63-20808887-KERATINOCYTES-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
KIF20B	Pathway Commons Protein-Protein Interactions	1.0	null
female reproductive gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.06894
CNTROB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.10714
connective tissue disease	GWASdb SNP-Disease Associations	1.0	0.088093
PMC10274745-media-4.xlsx-S3B-Table_S3_Reanalysis_of_publicly_available_data_to_identify_AR_and_ER_direct_target_genes_related_to_Figure_1_AR	Rummagene Transcription Factor Associations 2026	1.0	null
KIF18A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.55518
CYFIP1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me2_astrocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Lung adenocarcinoma_LUAD_TCGA-MN-A4N1-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MDA-MB-453	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04396
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7UC-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ctnnb1_19652203_myeloma_lof_human_gpl570_gds3578	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.324693
HSD17B4	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_6209_KO_Zcchc8_SRP187429	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	4.48516
RANBP1	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7248-01A-11R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Trunk	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
NEK9	Pathway Commons Protein-Protein Interactions	1.0	null
GSE195559_2_v_4_notch1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE188570,GSE188571_5_v_2_decitabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GNAI1	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-7056-01A-11R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KIF5B	Pathway Commons Protein-Protein Interactions	1.0	null
GSE238005_0_v_3_c9orf72_human	RummaGEO Gene Perturbation Signatures	1.0	null
CYTH2	Pathway Commons Protein-Protein Interactions	1.0	null
enzyme regulator activity	GO Molecular Function Annotations 2015	1.0	null
H4K20me1_H1-hESC_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE107956,GSE107957_0_v_1_ythdf2_human	RummaGEO Gene Perturbation Signatures	1.0	null
SNX14	Pathway Commons Protein-Protein Interactions	1.0	null
EIF2B5	Pathway Commons Protein-Protein Interactions	1.0	null
FRMPD3	Pathway Commons Protein-Protein Interactions	1.0	null
D502MG	DepMap CRISPR Gene Dependency	1.0	3.08291
MOLP-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.30486
PIK3C2B	Pathway Commons Protein-Protein Interactions	1.0	null
GSE99687_0_v_1_smad5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
abnormality of nervous system physiology	GWASdb SNP-Phenotype Associations	1.0	0.152446
Body mass index	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.604576
TCF4-23295773-U87-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
GAPVD1	Pathway Commons Protein-Protein Interactions	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-7211-11A-01R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pancreas	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.44393
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A719-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cell	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.183328
H3K4me1_CD4+ CD25- Th Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-85-8352-01A-31R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
E2F1-18555785-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
SNPH	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-G7-A8LB-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ARRDC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.00488
Perturb_11972_KO_Soat1_SRP235547	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-12.0885
positive regulation of MAPK cascade	GO Biological Process Annotations 2023	1.0	null
GSE206729_2_v_0_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE202933_1_v_0_ugt2b28_human	RummaGEO Gene Perturbation Signatures	-1.0	null
SMEK1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE193258,GSE193259_9_v_4_osimertinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
INSM1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	49.0
fertilizedegg	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	0.85671
H3K27me3_Adipose Derived Mesenchymal Stem Cell Cultured Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
TP53-23651856-MEFS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
small gtpase mediated signal transduction	GO Biological Process Annotations 2015	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-85-7950-01A-11R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Epithelial cell_Lung_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
CRCGN014_HEPG2_24H:D03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.36636
trunk	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ANXA11	Pathway Commons Protein-Protein Interactions	1.0	null
ZNF320	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	283.554
PMC4387713-supp_gad.255984.114_Table_S5.xlsx-S5F-Up_H3K27me3_DPY30_KD-Unnamed_12_AR	Rummagene Transcription Factor Associations 2026	1.0	null
H3K27ac_kidney_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
SPECC1L	Pathway Commons Protein-Protein Interactions	1.0	null
GNAQ	Pathway Commons Protein-Protein Interactions	1.0	null
VPS28	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN010_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.14884
CUX1	Pathway Commons Protein-Protein Interactions	1.0	null
DYNC1LI2	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_HEPG2_48H:F01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.29635
VWA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.54751
SPC25	Pathway Commons Protein-Protein Interactions	1.0	null
TBC1D1	Pathway Commons Protein-Protein Interactions	1.0	null
MAX_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCI-H2172	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-A6DL-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE206729_5_v_0_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CRCGN012_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.34829
Perturb_13213_KO_Yap1_SRP059253	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-4.96042
Lek	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.512
E2F6	ENCODE Transcription Factor Targets	1.0	null
H3K9me3_Mobilized CD34 Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
GSE242083,GSE242098_3_v_1_med1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC10011543-41419_2023_5707_MOESM4_ESM.xlsx-1434_proliferation_genes-ZNF766_ZNF766	Rummagene Transcription Factor Associations 2026	1.0	null
Signaling by Rho GTPases	Reactome Pathways 2014	1.0	null
HLA-B	Pathway Commons Protein-Protein Interactions	1.0	null
GSE223908,GSE223909_4_v_8_serpinb3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
NCAPG	Pathway Commons Protein-Protein Interactions	1.0	null
HCC2185	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.930419
RBBP5	ENCODE Transcription Factor Targets	1.0	null
SCARB2	Pathway Commons Protein-Protein Interactions	1.0	null
RHOT2	Pathway Commons Protein-Protein Interactions	1.0	null
adrenal gland	GTEx Tissue Gene Expression Profiles	-1.0	-0.835683
HCC2885	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.06869
BET1	Pathway Commons Protein-Protein Interactions	1.0	null
ILK	Pathway Commons Protein-Protein Interactions	1.0	null
SOX9-25088423-EMBRYONIC-GONADS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
ZFPL1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of the vasculature	GWASdb SNP-Phenotype Associations	1.0	0.076079
mood disorder	GWASdb SNP-Disease Associations	1.0	0.290227
ZWILCH	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_279_KD_MBNL2_SRP077885	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-4.18289
Prostate adenocarcinoma_PRAD_TCGA-KK-A7AZ-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-56-7730-01A-11R-2125-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100622_HIP_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.06764
H3K4me3_K562_hg19_4	ENCODE Histone Modification Site Profiles	1.0	null
GOLIM4	Pathway Commons Protein-Protein Interactions	1.0	null
TNK1	Pathway Commons Protein-Protein Interactions	1.0	null
19843711-TableS1	GeneSigDB Published Gene Signatures	1.0	null
TRAPPC5	Pathway Commons Protein-Protein Interactions	1.0	null
Sarcoma_SARC_TCGA-DX-AB2J-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NB1	DepMap CRISPR Gene Dependency	1.0	2.47201
ventral medial nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.23595
H3K27me3_megakaryocyte_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H2AFZ_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE114284_2_v_0_irf1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
VPS36	Pathway Commons Protein-Protein Interactions	1.0	null
20081105-ST-1	GeneSigDB Published Gene Signatures	1.0	null
GSE200839,GSE233826_3_v_4_tnrc18_human	RummaGEO Gene Perturbation Signatures	1.0	null
cognitive disorder	GWASdb SNP-Disease Associations	1.0	0.204581
Bladder Urothelial Carcinoma_BLCA_TCGA-2F-A9KW-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JD-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-6992-01A-11R-1915-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RBBP5_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-58-8392-01A-11R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN012_HEPG2_24H:D08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.67689
Perturb_17681_KO_Kdm4a_SRP101992	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.82081
Breast disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.064
RPS6KA4	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN017_MCF10A.TP53.M_24H:H24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.66375
H3K4me3_testis_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
NUP50	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_HEPG2_48H:M08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.69349
GAPDH	Pathway Commons Protein-Protein Interactions	1.0	null
GSE226408_1_v_0_inpp4b_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Perturb_13434_KD_Zc3h13_SRP098937	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	6.10156
primary motor-sensory cortex (samples)_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.48205
NANOG-18347094-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IM-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WT1-20215353-NEPHRON-PROGENITOR-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
H3K4me2_CH12.LX_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
urinary system disease	GWASdb SNP-Disease Associations	1.0	0.233014
NFIC	ENCODE Transcription Factor Targets	1.0	null
Photoreceptor connecting cilium	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.844
H3K4me3_brown adipose tissue_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
HCC2279	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.17744
PLAG1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	161.889
PMC10201771-12864_2023_9385_MOESM1_ESM.xlsx-ST18-Unnamed_1_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
regulation of catalytic activity	GO Biological Process Annotations 2015	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-Q1-A73R-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CAPZB	Pathway Commons Protein-Protein Interactions	1.0	null
FAM20C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.19717
H3K4me3_A549_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
lymphoblast	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.106964
cellular_component	LOCATE Curated Protein Localization Annotations	1.0	null
intercalated nucleus of medulla	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.36421
NFIC	JASPAR Predicted Transcription Factor Targets	1.0	null
Colorectal cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.222
clathrin-coated vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.213
H3K4me3_HEK293_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
H3K27me3_astrocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
gonad	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
behavioral abnormality	GWASdb SNP-Phenotype Associations	1.0	0.171712
Female reproductive gland	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
20713713-TableS1a	GeneSigDB Published Gene Signatures	1.0	null
ERAP1	Pathway Commons Protein-Protein Interactions	1.0	null
MARK2	Pathway Commons Protein-Protein Interactions	1.0	null
colonic mucosa	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
EXOC1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_retinal pigment epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of metabolism/homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.049642
Rectum adenocarcinoma_READ_TCGA-AG-3732-01A-11R-1660-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STAT5-23275557-MAMMARY-EPITHELIUM-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
PMC10679662-mmc2.xlsx-NC-D5-ZEB2-siRNA-Upregulated-Gene_Symbol_ZEB2	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me3_K562_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
salivarygland_6a	HPA Tissue Sample Gene Expression Profiles	1.0	1.20669
bt-549 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	1.09208
OSBP	Pathway Commons Protein-Protein Interactions	1.0	null
intracellular part	GO Cellular Component Annotations 2015	1.0	null
PHGDH	Pathway Commons Protein-Protein Interactions	1.0	null
GSE223893_2_v_10_setd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
RAB25	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of skeletal morphology	GWASdb SNP-Phenotype Associations	1.0	0.053619
17312329-SuppTable4	GeneSigDB Published Gene Signatures	1.0	null
H3K27me3_fibroblast of lung_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GNAI2	Pathway Commons Protein-Protein Interactions	1.0	null
H2BW2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.29003
ARHGEF26	Pathway Commons Protein-Protein Interactions	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-E7-A4XJ-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE242083,GSE242098_3_v_5_med1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PAX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.5888
cytoplasm	LOCATE Curated Protein Localization Annotations	1.0	null
CRCGN015_MCF10A_48H:M24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.02432
positive regulation of cellular process	GO Biological Process Annotations 2015	1.0	null
PKN2	Pathway Commons Protein-Protein Interactions	1.0	null
SAP30_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
rostral division of OFCi (area 11)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.972225
CD9	Pathway Commons Protein-Protein Interactions	1.0	null
VZ in postamygdaloid region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.827825
cdx2_20696899_caco2_lof_human_gpl570_gse22572	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.533415
RPS6KA1	Pathway Commons Protein-Protein Interactions	1.0	null
protein complex	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
TLX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.07206
USP8	Pathway Commons Protein-Protein Interactions	1.0	null
TCF12	ENCODE Transcription Factor Targets	1.0	null
SQRDL	Pathway Commons Protein-Protein Interactions	1.0	null
Brain - Amygdala	GTEx Tissue Gene Expression Profiles 2023	1.0	2.57521
H3K27me3_GM12878_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
IGR-37	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.948136
NF2	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_2815_KD_LSD1_SRP310243	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
SUPHD1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.58339
GSE164874_5_v_14_prednisolone_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMF1	Pathway Commons Protein-Protein Interactions	1.0	null
primary auditory cortex (core)_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.0688
NR3C1-27076634-BEAS2B-HUMAN-LUNG-INFLAMMATION	ChEA Transcription Factor Targets 2022	1.0	null
MARCKSL1	Pathway Commons Protein-Protein Interactions	1.0	null
FLII	Pathway Commons Protein-Protein Interactions	1.0	null
Gastrointestinal system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.295
Perturb_11763_KO_Irgm1_ERP020504	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.47969
FDXR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0762
LAMP1	Pathway Commons Protein-Protein Interactions	1.0	null
BCAP31	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal neuron morphology	GWASdb SNP-Phenotype Associations	1.0	0.510092
skeletalmuscle_a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A6QY-01A-12R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SAP30	ENCODE Transcription Factor Targets	1.0	null
SRP54	Pathway Commons Protein-Protein Interactions	1.0	null
STXBP5	Pathway Commons Protein-Protein Interactions	1.0	null
DUSP23	Pathway Commons Protein-Protein Interactions	1.0	null
H3K9ac_fibroblast of dermis_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
ARF1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me2_B cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
PDCD6	Pathway Commons Protein-Protein Interactions	1.0	null
EPS8L2	Pathway Commons Protein-Protein Interactions	1.0	null
SNTB2	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-D6-A74Q-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SOX2	ChEA Transcription Factor Targets	1.0	null
PMC8766486-42003_2021_2990_MOESM3_ESM.xlsx-ST18-Supplementary_Data_18_Gene_burden_for_deletions_by_subtype_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
Nfe2l2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.1763
KMS28BM	CCLE Cell Line Gene CNV Profiles	-1.0	-1.37456
SLC16A7+ cell_Lung_Human	CellMarker Gene-Cell Type Associations	1.0	null
GSE216043_7_v_2_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K4me3_ES-Bruce4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
DGKK	Pathway Commons Protein-Protein Interactions	1.0	null
RUFY1	Pathway Commons Protein-Protein Interactions	1.0	null
SLC25A33	Pathway Commons Protein-Protein Interactions	1.0	null
MX1	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_1696_KO_Cyp26b1_ERP124966	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-2.02493
DIAPH1	Pathway Commons Protein-Protein Interactions	1.0	null
H4	CCLE Cell Line Gene CNV Profiles	1.0	2.15513
PHLDA3	Pathway Commons Protein-Protein Interactions	1.0	null
SEPT7	Pathway Commons Protein-Protein Interactions	1.0	null
EPHB2	Pathway Commons Protein-Protein Interactions	1.0	null
MTOR	Hub Proteins Protein-Protein Interactions	1.0	null
PLA2G4A	Pathway Commons Protein-Protein Interactions	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-P5-A736-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LAYN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46237
dentate (lateral) nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.862188
SPTBN1	Pathway Commons Protein-Protein Interactions	1.0	null
NFYA	JASPAR Predicted Transcription Factor Targets	1.0	null
HIP1	Pathway Commons Protein-Protein Interactions	1.0	null
flower	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.075892
RAD51C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.295
20081105-ST-2	GeneSigDB Published Gene Signatures	1.0	null
H3K4me1_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Vagina	GTEx Tissue Gene Expression Profiles 2023	1.0	2.0002
Tbx6	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	18.653
KASUMI-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
POLR2A	ENCODE Transcription Factor Targets	1.0	null
ZNF816	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	75.453
Cardiovascular Abnormalities	CTD Gene-Disease Associations	1.0	1.35502
hypoglossal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.15453
CRCGN013_HEPG2_24H:C22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.54709
GSE151412_2_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CADPS2	Pathway Commons Protein-Protein Interactions	1.0	null
TBX2-33478486-IMR90-HUMAN-LUNG	ChEA Transcription Factor Targets 2022	1.0	null
GSE174701_5_v_6_maml3_human	RummaGEO Gene Perturbation Signatures	1.0	null
WSU-NHL	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K9ac_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
MXI1_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
superficial layers of olfactory entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.827827
arteriosclerosis	GWASdb SNP-Phenotype Associations	1.0	0.224625
Perturb_5107_OE_Yy1_SRP281855	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
DMS273_LUNG	CCLE Cell Line Proteomics	1.0	3.65846
cytosolic part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.060055
PMC3371315-NIHMS350140-supplement-13.xls-MCF7-T47D-SK-453_Up_Common_xls-Supplementary_Table_6_Luminal_Signature_Genes_increased_in_all_four_cell_lines_MCF7_T47D_MB-453_SKBR3_with_knockdown_of_FOXA1_FOXA1	Rummagene Transcription Factor Associations 2026	1.0	null
JHH2	CCLE Cell Line Gene CNV Profiles	1.0	1.6649
RB1	Pathway Commons Protein-Protein Interactions	1.0	null
Cervix disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.231
GSE152441,GSE152442_0_v_4_folic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE228106_0_v_4_paclitaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ROCK1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE188382_2_v_0_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
EZH2_myotube_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SNX12	Pathway Commons Protein-Protein Interactions	1.0	null
ACAP2	Pathway Commons Protein-Protein Interactions	1.0	null
PRAF2	Pathway Commons Protein-Protein Interactions	1.0	null
large intestine	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ABI1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE147876,GSE147877_4_v_1_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HUP-T4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
medial subdivision of area 10	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.12575
inflorescence	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.072214
H3K4me1_skeletal muscle myoblast_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
SMC4-20622854-HELA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
CHEK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.83052
heart_5a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
SMC4	Pathway Commons Protein-Protein Interactions	1.0	null
RHOXF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.8133
SP1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	202.762
RBM23	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05053
H3K4me1_thymus_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
LINS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.20146
GSE157894_1_v_0_cystine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
abnormality of the respiratory system	GWASdb SNP-Phenotype Associations	1.0	0.136427
hippocampus (hippocampal formation)_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.16076
KLC4	Pathway Commons Protein-Protein Interactions	1.0	null
ABC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.88231
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_2_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
PRDM14-21183938-MESC-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
CRCGN008_HEPG2_24H:J03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.1421
ARHGAP35	Pathway Commons Protein-Protein Interactions	1.0	null
SEC31A	Pathway Commons Protein-Protein Interactions	1.0	null
Rectum adenocarcinoma_READ_TCGA-CI-6620-01A-11R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me3_heart_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
19621087-Table1a	GeneSigDB Published Gene Signatures	1.0	null
SUPT11	CCLE Cell Line Gene CNV Profiles	1.0	1.51008
RAB13	Pathway Commons Protein-Protein Interactions	1.0	null
VPS45	Pathway Commons Protein-Protein Interactions	1.0	null
SNX17	Pathway Commons Protein-Protein Interactions	1.0	null
PMC8635809-Table_2.xls-LPS-downregulated-Unnamed_4_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
PMC10170086-41598_2023_34519_MOESM6_ESM.xlsx-Shee2-The_differentially_expressed_genes_between_the_BARX2_high_and_BARX2_low_group_of_LIHC_patients_BARX2	Rummagene Transcription Factor Associations 2026	1.0	null
SHB	Pathway Commons Protein-Protein Interactions	1.0	null
GSE213588_8_v_7_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Cleavage furrow	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.798
RAF1_activemutant_219_GSE42964	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	1.0	1.75256
496100634_HIP_no dementia_TBI_84_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.05101
PITPNM1	Pathway Commons Protein-Protein Interactions	1.0	null
GOSR1	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of response to stimulus	GO Biological Process Annotations 2015	1.0	null
CRCGN014_HEPG2_3H:H05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.02211
H3K4me3_MCF-7_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
Glucosidase II complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.609
PIGS	Pathway Commons Protein-Protein Interactions	1.0	null
TFDP1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.0578
Brain Lower Grade Glioma_LGG_TCGA-HT-7684-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE178532_2_v_3_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE196259_1_v_3_gcm1_human	RummaGEO Gene Perturbation Signatures	1.0	null
MYO1E	Pathway Commons Protein-Protein Interactions	1.0	null
Cardiomyoblast	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.774
RPS19BP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.08688
SIGMAR1	Pathway Commons Protein-Protein Interactions	1.0	null
Reproductive organ cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.054
Rectum adenocarcinoma_READ_TCGA-DY-A1DG-01A-11R-A32Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me1_spleen_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE158834_0_v_9_palmitic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
AP1B1	Pathway Commons Protein-Protein Interactions	1.0	null
monocyte chemoattractant protein 1 (66-77)	GAD Gene-Disease Associations	1.0	null
teratocarcinoma cell	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
TAF1	ENCODE Transcription Factor Targets	1.0	null
intracellular	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.166405
IPCEF1	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of response to stimulus	GO Biological Process Annotations 2015	1.0	null
CHD3	Pathway Commons Protein-Protein Interactions	1.0	null
Proteinuria	CTD Gene-Disease Associations	1.0	1.26886
Liver hepatocellular carcinoma_LIHC_TCGA-ED-A97K-01A-21R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
regulation of cell communication	GO Biological Process Annotations 2015	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-56-8629-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
neurodegenerative disease	GWASdb SNP-Disease Associations	1.0	0.259108
ABC1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.70929
tsc1-tsc2 complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.309986
pyramidal cells of rostral CA4	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.04547
Chromatoid body	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.505
H3K4me1_A549_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IN-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
tor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	1.28836
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_ALL-GENE_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
olfactory part of entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.07502
RAB18	Pathway Commons Protein-Protein Interactions	1.0	null
MAX_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
16273092-TableS1b	GeneSigDB Published Gene Signatures	1.0	null
501A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.00999
Prostate adenocarcinoma_PRAD_TCGA-KK-A6E4-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
upper limb region of M1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.40194
Kidney Chromophobe_KICH_TCGA-KN-8428-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
lateral reticular nucleus (principal part)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.09349
CRCGN016_MCF10A.TP53.M_24H:D15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.36898
overnutrition	GWASdb SNP-Disease Associations	1.0	0.441954
A172	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.962675
RAB43	Pathway Commons Protein-Protein Interactions	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KC-A7F5-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EXOC7	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_Peripheral Blood Mononuclear Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
Perturb_5013_KO_Sall4_ERP122174	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
FGD4	Pathway Commons Protein-Protein Interactions	1.0	null
SFT2D2	Pathway Commons Protein-Protein Interactions	1.0	null
SIN3A_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
obesity	GWASdb SNP-Phenotype Associations	1.0	0.594972
heart muscle	HPA Tissue Gene Expression Profiles	-1.0	-1.06389
H3K4me3_Panc1_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN014_HEPG2_3H:L18	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.31825
FLOT1	Pathway Commons Protein-Protein Interactions	1.0	null
YY1_K562_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2904-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PCBP2_02_123	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.45943
CRCGN015_MCF10A.TP53.M_24H:P16	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.01235
T3M4	CCLE Cell Line Gene CNV Profiles	1.0	1.51257
blood	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.058874
TMK1	DepMap CRISPR Gene Dependency	1.0	3.13243
regulation of ERK1 and ERK2 cascade	GO Biological Process Annotations 2023	1.0	null
rostral ventral respiratory cell group	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.36238
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_39_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
organelle	LOCATE Curated Protein Localization Annotations	1.0	null
mRNA_SOX2_17515932	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
GSE158834_0_v_5_palmitic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-ED-A8O6-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MIF_DEPLETION_GDS3626_95_human_HEK293 kidney cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
cardiovascular system disease	GWASdb SNP-Disease Associations	1.0	0.048433
negative regulation of endocytic recycling	GO Biological Process Annotations 2023	1.0	null
DOHH2	CCLE Cell Line Gene CNV Profiles	1.0	2.12021
INSIG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.11454
reproductive system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.25259
CPNE1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC9296003-supp_gad.348982.121_Supplementary_Table_S1.xlsx-PeakCall_EPC1-PHF1_FLAG_K562-ENSEMBL_PHF1	Rummagene Transcription Factor Associations 2026	1.0	null
TCFAP2C-20176728-TROPHOBLAST STEM CELLS-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
bone inflammation disease	GWASdb SNP-Disease Associations	1.0	0.2192
GSE128730_7_v_2_neratinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
PIK3R1	Pathway Commons Protein-Protein Interactions	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2822-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MITF	ChEA Transcription Factor Targets	1.0	null
GSE169356_2_v_3_ivermectin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CDIPT	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EA-A43B-01A-81R-A32Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
positive regulation of phosphate metabolic process	GO Biological Process Annotations 2015	1.0	null
posteroventral (inferior) parietal cortex_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.01629
H3K9me3_CD14-positive monocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
MYC_MCF 10A_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Urogenital Abnormalities	CTD Gene-Disease Associations	1.0	1.03235
abnormality of the endocrine system	GWASdb SNP-Phenotype Associations	1.0	0.083171
Hyperplasia	CTD Gene-Disease Associations	1.0	1.17235
AGS_STOMACH	CCLE Cell Line Proteomics	1.0	3.58562
abnormal emotion/affect behavior	GWASdb SNP-Phenotype Associations	1.0	0.266234
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_2_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
lymphocytic leukemia cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.25259
primary motor cortex (area M1, area 4)_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.885895
intracellular non-membrane-bounded organelle	LOCATE Curated Protein Localization Annotations	1.0	null
E2F1_UP.V1	MSigDB Signatures of Differentially Expressed Genes for Cancer Gene Perturbations	1.0	null
primary motor cortex (area M1, area 4)_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.52288
PMC10769314-NIHMS1954782-supplement-9.xlsx-Table_S7A-Table_S7A_Hippocampal_relative_gene_expression_from_post-KD_and_pre-KD_recipient_mice_AR	Rummagene Transcription Factor Associations 2026	1.0	null
dorsorostral division of MFC (area 32)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.91648
GSE205163,GSE205164_3_v_0_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
GNB2L1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_Panc1_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
mammary gland cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.408212
disease of cellular proliferation	GWASdb SNP-Disease Associations	1.0	0.0413
Perturb_9379_KO_lincRNAEPS_SRP354143	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
EIF2B2	Pathway Commons Protein-Protein Interactions	1.0	null
Plagl1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	23.3536
estradiol_homo sapiens_gpl6947_gse27375	GEO Signatures of Differentially Expressed Genes for Small Molecules	-1.0	null
Lung adenocarcinoma_LUAD_TCGA-97-8547-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11743796-41420_2025_2295_MOESM5_ESM.xlsx-aged_LPS_BV-2_vs_human_upreg-mouse_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
CRCGN017_MCF10A.TP53.M_24H:H10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.0965
ETFBKMT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.52905
DOCK6	Pathway Commons Protein-Protein Interactions	1.0	null
NAGLU	Pathway Commons Protein-Protein Interactions	1.0	null
GSE245270_2_v_5_isoproterenol_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TCF3-18347094-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
breast cancer cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.12869
Ventral pallidus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.31976
HCT-116	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Pollen tube	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.525
CRCGN017_MCF10A.TP53.M_24H:G15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.89436
SMC3_CH12.LX_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
IM-95	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
ONECUT3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	64.9802
PMC2263127-pone.0001816.s002.xls-Terms_with_Genes_E2F3_up_Bild-Title_E2F3	Rummagene Transcription Factor Associations 2026	1.0	null
SLC25A3	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_7804_KO_Ythdc1_SRP065329	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
H3K4me1_myotube_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN015_HEPG2_48H:G02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.46335
H2AFZ	ENCODE Transcription Factor Targets	1.0	null
ATP1A1	Pathway Commons Protein-Protein Interactions	1.0	null
NCSTN	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:F22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.04245
daudi	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
Teratocarcinoma cell	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
mitochondrion	LOCATE Predicted Protein Localization Annotations	1.0	null
DNM2	Pathway Commons Protein-Protein Interactions	1.0	null
SEPT14	Pathway Commons Protein-Protein Interactions	1.0	null
intracellular part	LOCATE Curated Protein Localization Annotations	1.0	null
cellular_component	LOCATE Predicted Protein Localization Annotations	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_81_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
CDX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	34.5024
ARF4	Pathway Commons Protein-Protein Interactions	1.0	null
SK-MEL-28	COSMIC Cell Line Gene Mutation Profiles	1.0	null
KMS-21BM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
LCLC103H	CCLE Cell Line Gene CNV Profiles	-1.0	-1.85588
RPS6KA5	Pathway Commons Protein-Protein Interactions	1.0	null
Gli2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	26.7356
small GTPase-mediated signal transduction	GO Biological Process Annotations 2025	1.0	null
CAKI-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.966162
GSE173232_4_v_3_sf3b1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
MYH9	Pathway Commons Protein-Protein Interactions	1.0	null
Edema	HuGE Navigator Gene-Phenotype Associations	1.0	null
HCC364	CCLE Cell Line Gene CNV Profiles	-1.0	-2.17532
GSE164874_5_v_3_prednisolone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K27me3_Stomach Smooth Muscle	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
H3K27me3_H7_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GOSR2	Pathway Commons Protein-Protein Interactions	1.0	null
EP300_osteoblast_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MEF2D	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.5531
PMC4944136-srep28995-s2.xls-DPRX-gene_DPRX	Rummagene Transcription Factor Associations 2026	1.0	null
TFAP2C	ChEA Transcription Factor Targets	1.0	null
positive regulation of gtpase activity	GO Biological Process Annotations 2015	1.0	null
RIC8A	Pathway Commons Protein-Protein Interactions	1.0	null
enzyme activator activity	GO Molecular Function Annotations 2015	1.0	null
coordinately	GeneRIF Biological Term Annotations	1.0	null
tor complex	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.057922
HTC-C3	Sanger Dependency Map Cancer Cell Line Proteomics	-1.0	-2.6313
RHOC	Pathway Commons Protein-Protein Interactions	1.0	null
intracellular organelle	LOCATE Curated Protein Localization Annotations	1.0	null
RAB1B	Pathway Commons Protein-Protein Interactions	1.0	null
EJM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.55724
mRNA_PRDM14_20953172	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
integument	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055493
hsa-miR-3689a-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
embryoday8.5	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	0.959007
H3K4me3_Panc1_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
GSE218727_2_v_1_zkscan3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TMEM33	Pathway Commons Protein-Protein Interactions	1.0	null
COG3	Pathway Commons Protein-Protein Interactions	1.0	null
P300-27268052-CHIP-SEQ-BCELLS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
NCIH1299_LUNG	CCLE Cell Line Proteomics	1.0	3.312
Skin Diseases	CTD Gene-Disease Associations	1.0	1.20558
KIAA0368	Pathway Commons Protein-Protein Interactions	1.0	null
GSE48812_0_v_5_sulforaphane_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-ETV4_ETV4	Rummagene Transcription Factor Associations 2026	1.0	null
Esrrg	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	25.8418
intracellular part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
VPS4B	Pathway Commons Protein-Protein Interactions	1.0	null
MAPK3	Pathway Commons Protein-Protein Interactions	1.0	null
coronary artery disease	GWASdb SNP-Disease Associations	1.0	0.526798
UBE2N	Pathway Commons Protein-Protein Interactions	1.0	null
depression	GWASdb SNP-Phenotype Associations	1.0	0.358359
u87	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
MOSPD2	Pathway Commons Protein-Protein Interactions	1.0	null
VIPAS39	Pathway Commons Protein-Protein Interactions	1.0	null
primary motor cortex (area M1, area 4)_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.44676
interpositus (intermediate) nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.829967
GTPase activator activity	GO Molecular Function Annotations 2025	1.0	null
NLGN4X	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60792
POLR2A_A549_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
EGR1-20690147-ERYTHROLEUKEMIA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
LN18_CENTRAL_NERVOUS_SYSTEM	CCLE Cell Line Proteomics	1.0	2.90925
Reproductive system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
YY1_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me3_epithelial cell of esophagus_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
PMC7673140-41467_2020_19575_MOESM4_ESM.xlsx-Data_S1d-List_of_2302_of_genes_differentially_regulated_by_SOX2_FDR_0_1_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
H4K20me1_myotube_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
20521089-Table2	GeneSigDB Published Gene Signatures	1.0	null
H3K4me3_retinal pigment epithelial cell_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
H3K27me3_erythroblast_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
protein binding	GO Molecular Function Annotations 2015	1.0	null
CLTA	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_A549_hg19_4	ENCODE Histone Modification Site Profiles	1.0	null
H3K4me3_mammary epithelial cell_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
GAA	Pathway Commons Protein-Protein Interactions	1.0	null
physical disorder	GWASdb SNP-Disease Associations	1.0	0.605909
JUN	JASPAR Predicted Transcription Factor Targets	1.0	null
FOXE1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	61.3076
GSE238005_5_v_3_c9orf72_human	RummaGEO Gene Perturbation Signatures	1.0	null
orofacial cleft	GWASdb SNP-Disease Associations	1.0	1.14463
CRCGN014_HEPG2_24H:N09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.93228
VPS4A	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-J7-A8I2-01A-12R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZBTB7A	ENCODE Transcription Factor Targets	1.0	null
striatum_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.13602
PMC8554124-DataSheet4.XLSX-6-HOXB6_HOXB6	Rummagene Transcription Factor Associations 2026	1.0	null
GP5D	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-B1-A654-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11749115-loae020_suppl_Supplementary_Table_S2.xlsx-CHOP-high-gene_DDIT3	Rummagene Transcription Factor Associations 2026	1.0	null
ACADVL	Pathway Commons Protein-Protein Interactions	1.0	null
WT1	ChEA Transcription Factor Targets	1.0	null
Kidney Chromophobe_KICH_TCGA-KM-8443-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SNU869	CCLE Cell Line Gene CNV Profiles	-1.0	-3.21049
EP300	ENCODE Transcription Factor Targets	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MW-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CREB1-20920259-GC1-SPG-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
internal male genital organ	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.057483
MCF7_Fulvestrant_10µM_24h	Sci-Plex Drug Perturbation Signatures	1.0	0.00756727
LOX-IMVI	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850982
496100612_HIP_no dementia_no TBI_95-99_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.42193
Sarcoma_SARC_TCGA-IS-A3KA-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MZ in posterior parahippocampal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.48641
H3K9me3_Neurosphere Cultured Cells Cortex Derived	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
NCIH1869	CCLE Cell Line Gene CNV Profiles	1.0	1.43076
H3K4me3_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE131649_2_v_8_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Perturb_10681_KO_Gtf2ird1_SRP074330	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	20.0
TAF1_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
VZ in subcallosal region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.870952
NRBP1	Pathway Commons Protein-Protein Interactions	1.0	null
PDS5A	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-RC-A7SH-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SARS-BatSRBD_0Hour_23935999_GSE47960	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	2.68461
cerebellar cortex_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.14772
nervous system disease	GWASdb SNP-Disease Associations	1.0	0.049083
ChIP_PRDM14_21183938	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
TBX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.0611
GSK3B	Pathway Commons Protein-Protein Interactions	1.0	null
whole plant	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.059889
primary motor cortex (area M1, area 4)_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.09104
HNRNPA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.09299
colorectum	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.232599
GSE258991_5_v_2_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
regulating	GeneRIF Biological Term Annotations	1.0	null
LGALS3	Pathway Commons Protein-Protein Interactions	1.0	null
CPNE3	Pathway Commons Protein-Protein Interactions	1.0	null
SKMEL2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.35626
COLO 792	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.98696
NCIH2073	CCLE Cell Line Gene CNV Profiles	1.0	1.46759
posterior (caudal) superior temporal cortex (area 22c)_25 pcw_F_12948	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.868389
CRCGN014_HEPG2_24H:D07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.8355
laterorostral part of entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.52081
RHO GTPase cycle	Reactome Pathways 2024	1.0	null
HES2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.0745
STXBP2	Pathway Commons Protein-Protein Interactions	1.0	null
amygdaloid complex_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.825093
GM2A	Pathway Commons Protein-Protein Interactions	1.0	null
Intestinal cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.22
GSE210476_2_v_7_rutaecarpine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CDH1	Pathway Commons Protein-Protein Interactions	1.0	null
MAP2K3	Pathway Commons Protein-Protein Interactions	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-8106-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A4OY-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
whole body	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
TDOTT	DepMap CRISPR Gene Dependency	1.0	4.39258
SP in caudal hippocampal proper	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.23638
BCCIP	Pathway Commons Protein-Protein Interactions	1.0	null
GSE183041_1_v_0_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K27me3_cerebellum_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ATG7	Pathway Commons Protein-Protein Interactions	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-N9-A4Q3-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
abnormality of the mouth	GWASdb SNP-Phenotype Associations	1.0	0.187027
GCN1L1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal genital system morphology	GWASdb SNP-Phenotype Associations	1.0	0.116967
TMOD2	Pathway Commons Protein-Protein Interactions	1.0	null
SNX7	Pathway Commons Protein-Protein Interactions	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-FF-8041-01A-11R-2213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me3_mammary epithelial cell_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
IGR1	CCLE Cell Line Gene CNV Profiles	1.0	1.49151
GSE156923_0_v_3_rbmx_human	RummaGEO Gene Perturbation Signatures	-1.0	null
primary	GeneRIF Biological Term Annotations	1.0	null
SKP1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal motor neuron morphology	GWASdb SNP-Phenotype Associations	1.0	0.510092
posterior (caudal) superior temporal cortex (area 22c)_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.935143
H3K27ac_A549_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
H3K27me3_osteoblast_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me3_cardiac mesoderm_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
PHB2	Pathway Commons Protein-Protein Interactions	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A2J6-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BLZF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.401
ARAP1	Pathway Commons Protein-Protein Interactions	1.0	null
Insulin Resistance	CTD Gene-Disease Associations	1.0	1.06044
NR1D1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.1503
WASF2	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-MH-A857-01A-11R-A355-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K9ac_H1-hESC_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
regulation of gtpase activity	GO Biological Process Annotations 2015	1.0	null
pseudopodia	GeneRIF Biological Term Annotations	1.0	null
MAPK1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:I11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.48643
Brain Lower Grade Glioma_LGG_TCGA-HT-7691-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H2AFZ_B cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
PMC8519939-41525_2021_248_MOESM5_ESM.xlsx-NFE2L2_V2-Gene_name_NFE2L2	Rummagene Transcription Factor Associations 2026	1.0	null
coronary artery disease	GWASdb SNP-Phenotype Associations	1.0	0.449367
skeletal muscle	HPA Tissue Gene Expression Profiles	-1.0	-2.05844
H3K4me3_bronchial epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
TAOK3	Pathway Commons Protein-Protein Interactions	1.0	null
PMC9974104-jci-133-159940-s019.xlsx-GT3-INCP-GATA3_co-bound_genes-Gene_Symbol_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
SHP77_LUNG	CCLE Cell Line Proteomics	1.0	4.21115
BHLHE40_02_186	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	-1.0	-0.59767
SEPT10	Pathway Commons Protein-Protein Interactions	1.0	null
tcf12_21972416_linnegflt3poscd127posly6dneg_bone_marrow_lof_mouse_gpl1261_gse27402	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-1.07418
ARHGEF10L	Pathway Commons Protein-Protein Interactions	1.0	null
POLR2AphosphoS5_G1E_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
signal transduction	GO Biological Process Annotations 2015	1.0	null
CAL-148	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.51532
HLA-H	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_bone marrow macrophage_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
ADAM10	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205976,GSE205978_2_v_5_cep83_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE196259_2_v_0_gcm1_human	RummaGEO Gene Perturbation Signatures	1.0	null
L-428	COSMIC Cell Line Gene Mutation Profiles	1.0	null
C75	DepMap CRISPR Gene Dependency	1.0	2.94817
H3K27ac_Panc1_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
mucosa	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
POLR2A_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NANOG-18347094-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
COLO-792	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SIX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.7996
cerebellar cortex_26 pcw_F_12949	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.843181
GSE188721_2_v_4_mesp1_human	RummaGEO Gene Perturbation Signatures	1.0	null
VAV1	Pathway Commons Protein-Protein Interactions	1.0	null
CREB3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.1445
GSE230744,GSE237803_0_v_3_hira_human	RummaGEO Gene Perturbation Signatures	-1.0	null
IM-95M	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
GSE113734_1_v_0_qprt_human	RummaGEO Gene Perturbation Signatures	-1.0	null
magnocellular (medial) division of MD	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.932172
SRPK1	Pathway Commons Protein-Protein Interactions	1.0	null
lower respiratory tract disease	GWASdb SNP-Disease Associations	1.0	0.255057
CHK1_KD_GSE54268_666_human_MCF-10A	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4845-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cell type cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.178
CRCGN016_MCF10A.TP53.M_24H:O23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.24967
Kidney renal papillary cell carcinoma_KIRP_TCGA-AL-3472-01A-01R-1193-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SLC25A1	Pathway Commons Protein-Protein Interactions	1.0	null
medial vestibular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.980283
TBX5	ChEA Transcription Factor Targets	1.0	null
LBR	Pathway Commons Protein-Protein Interactions	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-GRHL2_GRHL2	Rummagene Transcription Factor Associations 2026	1.0	null
STX3	Pathway Commons Protein-Protein Interactions	1.0	null
COLO678	CCLE Cell Line Gene CNV Profiles	-1.0	-1.56268
regulation of small GTPase mediated signal transduction	GO Biological Process Annotations 2025	1.0	null
DUX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.3026
H3K4me3_keratinocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
heart	GTEx Tissue Gene Expression Profiles	-1.0	-1.02309
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EA-A4BA-01A-21R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-96-A4JK-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE114284_4_v_0_irf1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
RPL36A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.86801
STARD7	Pathway Commons Protein-Protein Interactions	1.0	null
placenta	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
LNCaP clone FGC	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.911
analyzed	GeneRIF Biological Term Annotations	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-SR-A6MU-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RABEP1	Pathway Commons Protein-Protein Interactions	1.0	null
NCI-H1693	Sanger Dependency Map Cancer Cell Line Proteomics	1.0	1.94587
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YN-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RASL11A	Pathway Commons Protein-Protein Interactions	1.0	null
EZH2_fibroblast of lung_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ChIP_TCF3_18347094	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
Edema	CTD Gene-Disease Associations	1.0	1.14954
DNMBP	Pathway Commons Protein-Protein Interactions	1.0	null
CHEK1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN009_HEPG2_24H:L09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.04237
TRMT61B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.13013
Kidney renal papillary cell carcinoma_KIRP_TCGA-P4-A5E6-01A-11R-A28H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE143743_0_v_2_c9orf72_human	RummaGEO Gene Perturbation Signatures	1.0	null
Gland	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
H3K27ac_GM12878_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE223893_2_v_9_setd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
16293578-SuppTable2	GeneSigDB Published Gene Signatures	1.0	null
Perturb_5500_KO_Gata6_SRP073383	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	4.63587
SMAD2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.3228
RINT1	Pathway Commons Protein-Protein Interactions	1.0	null
ZBTB7A_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DYNLL1	Pathway Commons Protein-Protein Interactions	1.0	null
PLLP	Pathway Commons Protein-Protein Interactions	1.0	null
ATP6V0C	Pathway Commons Protein-Protein Interactions	1.0	null
PMC7036277-peerj-08-8662-s005.xlsx-42_genes_were_downregulated_in-Supplemental_Table_S3_42_genes_were_downregulated_in_the_EN2-Eca109_cells_as_compared_with_the_NEO-Eca109_cells_Related_to_Figure_5A_EN2	Rummagene Transcription Factor Associations 2026	1.0	null
GSE147366_1_v_0_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
H3K27me3_CH12.LX_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PFKP	Pathway Commons Protein-Protein Interactions	1.0	null
migration	GeneRIF Biological Term Annotations	1.0	null
MFE-319	COSMIC Cell Line Gene Mutation Profiles	1.0	null
functionally	GeneRIF Biological Term Annotations	1.0	null
IRF2	JASPAR Predicted Transcription Factor Targets	1.0	null
ZBED1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.1399
MAPK13	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me1_megakaryocyte_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IL-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RHOJ	Pathway Commons Protein-Protein Interactions	1.0	null
H3K9me1_keratinocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Signal Transduction	Reactome Pathways 2014	1.0	null
dorsolateral prefrontal cortex_26 pcw_F_12949	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.99715
BDH1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37789
NCIH1993	DepMap CRISPR Gene Dependency	1.0	6.07433
VPS52	Pathway Commons Protein-Protein Interactions	1.0	null
GSE152441,GSE152442_6_v_4_folic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE213650_0_v_2_everolimus_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-FOXA2_FOXA2	Rummagene Transcription Factor Associations 2026	1.0	null
SP7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.34102
CRCGN016_MCF10A.TP53.M_24H:N04	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.01528
Coated vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.088
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3433-01A-02R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
biological_process	GO Biological Process Annotations 2015	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5457-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SLC7A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.1986
EZH2_astrocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NKX2-2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.591
tissues, cell types and enzyme sources	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.53602
GSE205687_1_v_0_mta1_human	RummaGEO Gene Perturbation Signatures	1.0	null
internal female genital organ	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
regulation of signaling	GO Biological Process Annotations 2015	1.0	null
NCIH2106	CCLE Cell Line Gene CNV Profiles	1.0	1.60462
RHOB	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN010_HEPG2_24H:O10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.11898
Lung adenocarcinoma_LUAD_TCGA-55-A4DG-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC9296003-supp_gad.348982.121_Supplementary_Table_S1.xlsx-PeakCall_EPC1-PHF1_FLAG_K562-SYMBOL_PHF1	Rummagene Transcription Factor Associations 2026	1.0	null
CRCGN014_HEPG2_3H:M21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.20985
AP2A2	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EA-A3Y4-01A-51R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
posteroventral (inferior) parietal cortex_12 pcw_F_13060	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.972162
TR146	DepMap CRISPR Gene Dependency	1.0	2.37257
PYCARD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.0973
SCC-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-NF-A4WU-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE158834_0_v_4_palm_human	RummaGEO Gene Perturbation Signatures	-1.0	null
SK-MEL-28	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04396
H2AFZ_mammary epithelial cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ECC10	COSMIC Cell Line Gene Mutation Profiles	1.0	null
COLO-320-HSR	COSMIC Cell Line Gene Mutation Profiles	1.0	null
RAB35	Pathway Commons Protein-Protein Interactions	1.0	null
DYNLRB1	Pathway Commons Protein-Protein Interactions	1.0	null
animal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
RHOD	Pathway Commons Protein-Protein Interactions	1.0	null
SARS-CoV_0Hour_23935999_GSE47960	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	1.34709
Thorax	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
EIF3I	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.28445
AKT1	Pathway Commons Protein-Protein Interactions	1.0	null
NOB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.18272
SP2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	154.345
KMS-12-PE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.17047
Perturb_4643_KO_Wwc2_SRP151543	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	4.47381
SEC61A1	Pathway Commons Protein-Protein Interactions	1.0	null
Stomach cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.012
Kidney renal papillary cell carcinoma_KIRP_TCGA-AL-A5DJ-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SYK	Pathway Commons Protein-Protein Interactions	1.0	null
majority	GeneRIF Biological Term Annotations	1.0	null
ASPSCR1	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of erk1 and erk2 cascade	GO Biological Process Annotations 2015	1.0	null
KYSE-510	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Bulimia	DisGeNET Gene-Disease Associations	1.0	null
Large intestine cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.222
Lung adenocarcinoma_LUAD_TCGA-78-7167-01A-11R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KK-A7B3-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ARHGEF2	Pathway Commons Protein-Protein Interactions	1.0	null
dynamics	GeneRIF Biological Term Annotations	1.0	null
Olig2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	16.8727
GSE242290_3_v_8_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TCC-PAN2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.827225
STS-0421	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ZNF143	ENCODE Transcription Factor Targets	1.0	null
arthritis	GWASdb SNP-Phenotype Associations	1.0	0.191901
BIN1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K9ac_K562_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
PPP2R1B	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_megakaryocyte_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
GSE48812_9_v_10_sulforaphane_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DRG1	Pathway Commons Protein-Protein Interactions	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-66-2785-01A-01R-0851-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cleft lip	GWASdb SNP-Disease Associations	1.0	1.02614
LANCL1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC9391581-mmc4.xlsx-KLF4_K409Q_vs_GFP-activated-gene_name_KLF4	Rummagene Transcription Factor Associations 2026	1.0	null
NCIN87	DepMap CRISPR Gene Dependency	1.0	2.02661
Weight	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.539794
ARFRP1	Pathway Commons Protein-Protein Interactions	1.0	null
DCTN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.48744
Lung adenocarcinoma_LUAD_TCGA-62-8397-01A-11R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE203181_0_v_1_phosphoramidon_human	RummaGEO Drug Perturbation Signatures	-1.0	null
mediodorsal nucleus of thalamus_21 pcw_M_12886	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.24016
Specific developmental disorder	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.034
NCI-H1869	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.44293
PMC8764619-mmc7.xlsx-supplementary_table_for_the_Ven-GSE131737_TFAP2B_target_genes_G_gallus_1347_TFAP2B	Rummagene Transcription Factor Associations 2026	1.0	null
Perturb_12094_KD_Cdkn2a_SRP169507	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
GSE217552_3_v_0_fisetin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
prepositus hypoglossal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.29771
arthritis	GWASdb SNP-Disease Associations	1.0	0.251196
CDK11A	Pathway Commons Protein-Protein Interactions	1.0	null
rostral subdivision of paraventricular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	3.24136
PMC7617064-EMS151900-supplement-Extended_Data_Figure_5_Source_Data.xlsx-CLC_D9_DEG-Logfold_change_threshold_1_0_CENPX	Rummagene Transcription Factor Associations 2026	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-HM-A6W2-01A-21R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_SBP_AA-GENE_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
gtpase activator activity	GO Molecular Function Annotations 2015	1.0	null
H3K4me3_B cell_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN016_MCF10A.TP53.M_24H:A19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.57189
BCL6-27268052-CHIP-SEQ-BCELLS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
DTNBP1	Pathway Commons Protein-Protein Interactions	1.0	null
EN	DepMap CRISPR Gene Dependency	1.0	2.45862
JHH-7	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.49214
GNAS	Pathway Commons Protein-Protein Interactions	1.0	null
GSE172016_2_v_1_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K9ac_ES-E14_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-HV-A7OP-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-759	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
occipital neocortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.830222
posterior (caudal) superior temporal cortex (area 22c)_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.920541
17297478-SuppTable5	GeneSigDB Published Gene Signatures	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3374-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CHP1	Pathway Commons Protein-Protein Interactions	1.0	null
macromolecular complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.292157
TCF12/HEB-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
OXSR1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE176008_7_v_2_azacitidine_human	RummaGEO Drug Perturbation Signatures	1.0	null
Angiogenesis	PANTHER Pathways	1.0	null
PRKAR2A	Pathway Commons Protein-Protein Interactions	1.0	null
NTPCR	Pathway Commons Protein-Protein Interactions	1.0	null
STK39	Pathway Commons Protein-Protein Interactions	1.0	null
PDS5B	Pathway Commons Protein-Protein Interactions	1.0	null
NU7441	DeepCoverMOA Drug Mechanisms of Action	-1.0	-1.18
H3K4me1_megakaryocyte_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN015_HEPG2_48H:P13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.1156
primary somatosensory cortex (area S1, areas 3,1,2)_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.7582
PMC8202205-NIHMS1706275-supplement-Table_S3.xlsx-Day_4_GATA6-dependent_genes-GATA6-dependent_mRNA_expression_Day_4_Definitive_Endoderm_FDR_0_05_GATA6	Rummagene Transcription Factor Associations 2026	1.0	null
MYH14	Pathway Commons Protein-Protein Interactions	1.0	null
MEL-HO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.30346
GSE158834_0_v_4_palmitic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
EXOC3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE176008_0_v_2_azacitidine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE227698_2_v_4_g0s2_human	RummaGEO Gene Perturbation Signatures	1.0	null
H3K4me1_liver_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CW-6087-11A-01R-1672-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SNX8	Pathway Commons Protein-Protein Interactions	1.0	null
CKAP5	Pathway Commons Protein-Protein Interactions	1.0	null
GSE135514_8_v_0_dasatinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
3T3-Swiss albino cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.891
TPD52L2	Pathway Commons Protein-Protein Interactions	1.0	null
organ system cancer	GWASdb SNP-Disease Associations	1.0	0.044028
CLASP2	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_NT2-D1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-56-7221-01A-11R-2045-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TAP1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC10824666-43018_2023_699_MOESM2_ESM.xls-Suppl_Table_S4-AM-1882_AUC_vs_Gene_Expression_PRISM_Breast_and_Ovarian_Cancer_Cell_lines_n_58_1_PRDM6	Rummagene Transcription Factor Associations 2026	1.0	null
intestine	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.053741
Perturb_9380_KO_lincRNAEPS_SRP354143	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
RAB17	Pathway Commons Protein-Protein Interactions	1.0	null
GSE133516_0_v_6_kat7_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PARD6A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.03144
H3K27me3_mononuclear cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Female reproductive system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
abnormality of central nervous system electrophysiology	GWASdb SNP-Phenotype Associations	1.0	0.969142
Perturb_2840_OE_GIT2_SRP357777	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
Mesothelioma_MESO_TCGA-TS-A7PB-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
internal male genital organ	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
STARD5	Pathway Commons Protein-Protein Interactions	1.0	null
MAX	ENCODE Transcription Factor Targets	1.0	null
KLF10	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	194.266
regulation of cellular process	GO Biological Process Annotations 2015	1.0	null
Edinger-Westphal nucleus (accessory oculomotor nucleus)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.99369
RPN2	Pathway Commons Protein-Protein Interactions	1.0	null
pharmacogenomic	GAD High Level Gene-Disease Associations	1.0	0.293278
hippocampus (hippocampal formation)_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.995975
SNAP29	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me2_myotube_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5KX-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K9ac_keratinocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CREB3L1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.0339
IZ in caudal perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.24713
SUZ12-20075857-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
JUND_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE205163,GSE205164_9_v_7_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
MYOF	Pathway Commons Protein-Protein Interactions	1.0	null
OVTOKO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.864707
layer II of rostral entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.01623
PTK2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE173232_1_v_0_sf3b1_human	RummaGEO Gene Perturbation Signatures	1.0	null
CRCGN014_HEPG2_24H:J10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.79323
salivary gland	HPA Tissue Gene Expression Profiles	1.0	0.919438
carcinoma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.261964
abnormalities of the peripheral arteries	GWASdb SNP-Phenotype Associations	1.0	0.200988
M14	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Mesothelioma_MESO_TCGA-MQ-A6BS-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ribonucleoprotein granule	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.318579
H3K4me3_small intestine_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
asthma	GWASdb SNP-Disease Associations	1.0	0.944108
KDM5B_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
XPO4	Pathway Commons Protein-Protein Interactions	1.0	null
precommissural nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.65143
ANKRD11	Pathway Commons Protein-Protein Interactions	1.0	null
caudal ganglionic eminence_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.878814
RAB5C	Pathway Commons Protein-Protein Interactions	1.0	null
bipolar affective disorder	GWASdb SNP-Phenotype Associations	1.0	0.481287
PCYOX1	Pathway Commons Protein-Protein Interactions	1.0	null
EXD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33534
GSE174701_5_v_2_maml3_human	RummaGEO Gene Perturbation Signatures	1.0	null
REC1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.34302
breast	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.104839
LRFN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35923
PLIN3	Pathway Commons Protein-Protein Interactions	1.0	null
Foxn1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	14.8201
ADD1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of cells of the monocyte/macrophage lineage	GWASdb SNP-Phenotype Associations	1.0	0.594972
G6PD	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A8HV-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Breast cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.068
plant	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.05985
GOPC	Pathway Commons Protein-Protein Interactions	1.0	null
COR-L279	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.946791
PLEKHF2	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4994-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EZH2_mammary epithelial cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
filament	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.257572
H3K27me3_CD4+ CD25- CD45RO+ Memory Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
inferolateral temporal cortex (area TEv, area 20)_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	2.09563
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5SF-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K9me3_Neurosphere Cultured Cells Ganglionic Eminence Derived	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
PSMD7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0554
NCI-H1155	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.43734
lymphoblastoid cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.112414
H3K9ac_liver_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
KOPN8	CCLE Cell Line Gene CNV Profiles	1.0	2.44939
SNX15	Pathway Commons Protein-Protein Interactions	1.0	null
PLEKHA2	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_keratinocyte_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_MAP_AA-GENE_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
Lung adenocarcinoma_LUAD_TCGA-97-8171-01A-11R-2287-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K27ac_HCT116_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
hsa-miR-4680-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
Pentoxifylline_KATO III	Tahoe Therapeutics Tahoe 100M Perturbation Atlas	1.0	0.0162562
TCF3-18347094-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
CRCGN015_MCF10A_48H:H24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.35542
ABR	Pathway Commons Protein-Protein Interactions	1.0	null
GSE158834_12_v_6_palmitic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TAF1_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Photoreceptor distal connecting cilium	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.871
VZ in thalamic region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.920578
cerebellar cortex_30 yrs_F_12290	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.37388
MEF2D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.25857
CLPB	Pathway Commons Protein-Protein Interactions	1.0	null
GRIPAP1	Pathway Commons Protein-Protein Interactions	1.0	null
ASAH1	Pathway Commons Protein-Protein Interactions	1.0	null
CTCF_CH12.LX_mm9_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-DS-A7WI-01A-12R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8423434-mmc7.xlsx-KLF4_HENSM-Genes_n_2172_KLF4	Rummagene Transcription Factor Associations 2026	1.0	null
asthma	GWASdb SNP-Phenotype Associations	1.0	0.831588
AIP	Pathway Commons Protein-Protein Interactions	1.0	null
GSE195559_2_v_7_notch1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE175787_11_v_6_rhoc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TCAP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.24125
een	GeneRIF Biological Term Annotations	1.0	null
GSE216043_11_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
NCI-H1666	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850982
CRCGN011_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.07303
HS 936.T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.39409
DYNLRB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.03557
TBC1D9B	Pathway Commons Protein-Protein Interactions	1.0	null
KIF2A	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_cardiac mesoderm_hg19_5	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ANXA5	Pathway Commons Protein-Protein Interactions	1.0	null
male reproductive system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055524
VTA1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of the prostate	GWASdb SNP-Phenotype Associations	1.0	0.66742
ANAPC7	Pathway Commons Protein-Protein Interactions	1.0	null
SLC25A24	Pathway Commons Protein-Protein Interactions	1.0	null
URGCP	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_cardiac mesoderm_hg19_4	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN009_HEPG2_24H:O19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	6.27495
SUZ12-20075857-MESC-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
RHOA GTPase cycle	Reactome Pathways 2024	1.0	null
ZNF257	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	52.3593
GRB2	Pathway Commons Protein-Protein Interactions	1.0	null
cytoplasmic part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.043384
PITPNB	Pathway Commons Protein-Protein Interactions	1.0	null
XPO1	Pathway Commons Protein-Protein Interactions	1.0	null
phycobiont	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.257572
U937	CCLE Cell Line Gene CNV Profiles	-1.0	-1.89635
HN	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.62813
CRCGN014_HEPG2_24H:H09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.79145
primary auditory cortex (core)_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.960339
B3GAT3	Pathway Commons Protein-Protein Interactions	1.0	null
CNPY3	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_HEPG2_48H:C24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.98445
20003503-SuppTable1	GeneSigDB Published Gene Signatures	1.0	null
JL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.59681
ARF5	Pathway Commons Protein-Protein Interactions	1.0	null
MEF2A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	41.4614
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_HA-SYMBOL_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
HCC2935	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04524
ZFX-18555785-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
RVH421	CCLE Cell Line Gene CNV Profiles	1.0	1.60421
GSE226584,GSE226589_2_v_0_ezh2_human	RummaGEO Gene Perturbation Signatures	1.0	null
H3K9me3_fibroblast of lung_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
obstructive lung disease	GWASdb SNP-Disease Associations	1.0	0.40845
Right_Atrium	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-0.907723
CRCGN017_MCF10A.WT.HP_24H:P17	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.67795
EIF2D	Pathway Commons Protein-Protein Interactions	1.0	null
NCIH446_LUNG	CCLE Cell Line Proteomics	1.0	3.312
DIDO1	Pathway Commons Protein-Protein Interactions	1.0	null
CLIC1	Pathway Commons Protein-Protein Interactions	1.0	null
membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
DNAJC2-21179169-NT2-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
SEPT8	Pathway Commons Protein-Protein Interactions	1.0	null
NAPG	Pathway Commons Protein-Protein Interactions	1.0	null
pin1	GeneRIF Biological Term Annotations	1.0	null
NDNL2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE102467_3_v_0_pazopanib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5K5-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE169356_2_v_4_ivermectin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
VPS33B	Pathway Commons Protein-Protein Interactions	1.0	null
BCL7B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49223
PMC9618568-41467_2022_34255_MOESM5_ESM.xlsx-TAL2-Unnamed_0_TAL2	Rummagene Transcription Factor Associations 2026	1.0	null
PMC7062471-elife-52504-supp6.xlsx-TEAD4_motif_in_OCR_around_DEGs-Gene_ID_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
gtpase regulator activity	GO Molecular Function Annotations 2015	1.0	null
regulation of phosphate metabolic process	GO Biological Process Annotations 2015	1.0	null
CNN2	Pathway Commons Protein-Protein Interactions	1.0	null
SNX5	Pathway Commons Protein-Protein Interactions	1.0	null
OVKATE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.49543
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9R9-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EHD1	Pathway Commons Protein-Protein Interactions	1.0	null
breast adenocarcinoma cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.103301
EGR1	ChEA Transcription Factor Targets	1.0	null
KNL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.822
ACTN4	Pathway Commons Protein-Protein Interactions	1.0	null
Sarcoma_SARC_TCGA-DX-A7EO-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE125219,GSE125221_3_v_0_arid1a_human	RummaGEO Gene Perturbation Signatures	1.0	null
inferior olive, principal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.02302
regulation of mapk cascade	GO Biological Process Annotations 2015	1.0	null
Breast Neoplasms	CTD Gene-Disease Associations	1.0	1.01099
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A3HZ-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RRAS2	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_liver_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HMV-II	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Perturb_11759_OE_Ddah1_SRP027595	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-2.93527
PPARG	JASPAR Predicted Transcription Factor Targets	1.0	null
CRAL-TRIO domain	InterPro Predicted Protein Domain Annotations	1.0	null
GSE144500_8_v_2_ventx_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Disease of cellular proliferation	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.351
VAV2	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_H7_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN014_HEPG2_24H:M14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.7303
FOXC1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	34.1529
H3K4me3_CD19 Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
TAOK1	Pathway Commons Protein-Protein Interactions	1.0	null
HCFC1	Pathway Commons Protein-Protein Interactions	1.0	null
UBC	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of phosphorus metabolic process	GO Biological Process Annotations 2015	1.0	null
COG5	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_megakaryocyte_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE218819_2_v_1_kdm5b_human	RummaGEO Gene Perturbation Signatures	1.0	null
posteroventral (inferior) parietal cortex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.96925
SKMEL28	CCLE Cell Line Gene CNV Profiles	1.0	1.53279
mRNA_MSC_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
skeletalmuscle_c	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
LRP10	Pathway Commons Protein-Protein Interactions	1.0	null
ACSF2	Pathway Commons Protein-Protein Interactions	1.0	null
MYO6	Pathway Commons Protein-Protein Interactions	1.0	null
XBP1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.0328
Gli1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	34.1007
estradiol_mus musculus_gpl4134_gse23241	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
LGE-VZ border region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.27741
STK38	Pathway Commons Protein-Protein Interactions	1.0	null
RV16_0Hour-B2B_None_GSE28904	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.75376
Organ system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.339
CRCGN014_HEPG2_3H:H09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.55762
ARHGAP17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.68369
VPS39	Pathway Commons Protein-Protein Interactions	1.0	null
EZH2_B cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
mRNA_KLF4_18264089	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
STARD10	Pathway Commons Protein-Protein Interactions	1.0	null
WASL	Pathway Commons Protein-Protein Interactions	1.0	null
ITPK1	Pathway Commons Protein-Protein Interactions	1.0	null
MAFK	ENCODE Transcription Factor Targets	1.0	null
PMC9288051-13046_2022_2428_MOESM12_ESM.xlsx-HL-60-genes_bound_by_LYL1_at_its_promoter_regions_in_AML_cell_line_HL-60_LYL1	Rummagene Transcription Factor Associations 2026	1.0	null
TE10	CCLE Cell Line Gene CNV Profiles	-1.0	-2.59433
CRCGN008_HEPG2_24H:C20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.8567
intracellular part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.184853
positive regulation of phosphorylation	GO Biological Process Annotations 2015	1.0	null
dorsolateral prefrontal cortex_30 yrs_F_12290	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.19357
GSE98898_7_v_2_hoxa1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
lymphocyte	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.077918
ARAF	Pathway Commons Protein-Protein Interactions	1.0	null
VAMP8	Pathway Commons Protein-Protein Interactions	1.0	null
PMC6451636-NIHMS79910-supplement-Supplementary_table_1.xlsx-MAF_1_not_in_control_exomes-Gene_MAF	Rummagene Transcription Factor Associations 2026	1.0	null
abnormality of nervous system morphology	GWASdb SNP-Phenotype Associations	1.0	0.067369
SEC61B	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of cellular metabolic process	GO Biological Process Annotations 2015	1.0	null
whole body	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.052729
HCC1599	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.626217
BLOC1S4	Pathway Commons Protein-Protein Interactions	1.0	null
Brain - Cortex	GTEx Tissue Gene Expression Profiles 2023	1.0	2.7327
Endocrine gland	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GSE178532_1_v_0_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CCDC50	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal glucose homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.212843
hsa-miR-3664-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
CRCGN013_HEPG2_24H:B07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.24568
immune	GAD High Level Gene-Disease Associations	1.0	0.293278
DCLRE1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38031
motor neuron disease	GWASdb SNP-Disease Associations	1.0	0.600463
TEF-1	MotifMap Predicted Transcription Factor Targets	1.0	null
PDCD6IP	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me1_Panc1_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
SMRT-27268052-CHIP-SEQ-BCELLS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GSE224547_1_v_0_cftr_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CRCGN009_HEPG2_24H:K02	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.3239
SMC2	Pathway Commons Protein-Protein Interactions	1.0	null
LBP-1	MotifMap Predicted Transcription Factor Targets	1.0	null
U266B1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.57631
SHD	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205163,GSE205164_3_v_6_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
RAB23	Pathway Commons Protein-Protein Interactions	1.0	null
EJM	CCLE Cell Line Gene CNV Profiles	-1.0	-2.03254
19843711-TableS2	GeneSigDB Published Gene Signatures	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-US-A779-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me3_MCF-7_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
DST	Pathway Commons Protein-Protein Interactions	1.0	null
GSE216043_7_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
paraventricular nucleus of hypothalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.54222
PITX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.4331
STX4	Pathway Commons Protein-Protein Interactions	1.0	null
GSE193258,GSE193259_2_v_4_osimertinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC3817717__F2	PFOCR Pathway Figure Associations 2023	1.0	null
cell part	LOCATE Predicted Protein Localization Annotations	1.0	null
Skin - Sun Exposed (Lower leg)	GTEx Tissue Gene Expression Profiles 2023	1.0	4.44951
GSE205163,GSE205164_2_v_0_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TAF1D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.01746
ROMO1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33814
GSE206729_3_v_1_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
dorsalstriatum	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-1.18603
Carcinoma, Hepatocellular	CTD Gene-Disease Associations	1.0	1.02114
POU5F1-16518401-CHIP-PET-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
TCF12_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF449	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.602
LGALS4	Pathway Commons Protein-Protein Interactions	1.0	null
SNX6	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205163,GSE205164_3_v_4_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
CRCGN017_MCF10A.TP53.M_24H:E09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.35226
COR-L88	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02728
Cytoskeletal regulation by Rho GTPase	PANTHER Pathways	1.0	null
ZDHHC11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05903
PCMT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.14794
CRCGN017_MCF10A.WT.HP_24H:E14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.18073
ZNF263	ENCODE Transcription Factor Targets	1.0	null
MTOR	Pathway Commons Protein-Protein Interactions	1.0	null
CDC42BPG	Pathway Commons Protein-Protein Interactions	1.0	null
mRNA_GATA3_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IO-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Clathrin coat of trans-Golgi network vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.425
nucleoside-triphosphatase regulator activity	GO Molecular Function Annotations 2015	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A1MF-01A-11R-A13Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
urogenital system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.23362
abnormality of the face	GWASdb SNP-Phenotype Associations	1.0	0.145943
ZNF530	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	82.837
LMO7	Pathway Commons Protein-Protein Interactions	1.0	null
SP in caudal subicular cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.25015
NUDC	Pathway Commons Protein-Protein Interactions	1.0	null
NO10	DepMap CRISPR Gene Dependency	1.0	4.0019
monocyte chemoattractant protein 1 (66-77) [Supplementary Concept]	dbGAP Gene-Trait Associations	1.0	0.073939
JHH-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.837445
POLR2A_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
POLR2A_HGPS cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-JW-A5VH-01A-11R-A28H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RPN1	Pathway Commons Protein-Protein Interactions	1.0	null
organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.049034
CRCGN015_HEPG2_48H:O11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	6.04927
nb4	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
TTLL13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.40453
CLCN7	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN008_HEPG2_24H:H15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-3.29085
Lung adenocarcinoma_LUAD_TCGA-93-A4JO-01A-21R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PAX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.1207
POLR2A_A549_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Cardiovascular Diseases	HuGE Navigator Gene-Phenotype Associations	1.0	null
H3K4me3_limb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-4619-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CML-T1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-UY-A78M-01A-21R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SNU-C2B	COSMIC Cell Line Gene Mutation Profiles	1.0	null
VAPB	Pathway Commons Protein-Protein Interactions	1.0	null
Left_Ventricle	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.44702
ZW10	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4834-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
macromolecular complex	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
psychotic disorder	GWASdb SNP-Disease Associations	1.0	0.338117
GSE48812_8_v_10_sulforaphane_human	RummaGEO Drug Perturbation Signatures	-1.0	null
EZH2_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SNX9	Pathway Commons Protein-Protein Interactions	1.0	null
hematopoietic cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.059604
TCCPAN2_PANCREAS	CCLE Cell Line Proteomics	1.0	2.48135
PMC4909989-ncomms11840-s2.xlsx-down-regulate-TEAD4-FL_YAP_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
FERMT1	Pathway Commons Protein-Protein Interactions	1.0	null
inner CP in midlateral extrastriate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.03048
GALC	Pathway Commons Protein-Protein Interactions	1.0	null
AP2M1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE193258,GSE193259_5_v_1_osimertinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
BE2M17	DepMap CRISPR Gene Dependency	1.0	3.06903
RHOT1	Pathway Commons Protein-Protein Interactions	1.0	null
SOX9	ChEA Transcription Factor Targets	1.0	null
cellular_component	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
etoposide_mus musculus_gpl6887_gse33626	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GSE172016_2_v_0_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
head	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
16288205-GeneTable3	GeneSigDB Published Gene Signatures	1.0	null
CISD2	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal joint morphology	GWASdb SNP-Phenotype Associations	1.0	0.161514
SNX13	Pathway Commons Protein-Protein Interactions	1.0	null
GSE200839,GSE233826_2_v_6_tnrc18_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC9013128-NIHMS1795992-supplement-4.xlsx-501mel_ARID2_KO_Downregulated-Gene__name_ARID2	Rummagene Transcription Factor Associations 2026	1.0	null
NCI-H292	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.67136
ZFYVE1	Pathway Commons Protein-Protein Interactions	1.0	null
496100608_FWM_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.21141
ZNF263_HEK293_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN015_HEPG2_48H:M07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	6.14801
Drug-Induced Liver Injury	CTD Gene-Disease Associations	1.0	1.66813
KDM4A_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DCTN2	Pathway Commons Protein-Protein Interactions	1.0	null
reproductive system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.23362
RAD21	ENCODE Transcription Factor Targets	1.0	null
PMC7439574-13148_2020_914_MOESM2_ESM.xlsx-log2_fold_change_2-1769_genes_are_more_than_four-fold_upregulated_in_PRDM8-_-_compared_to_control_PRDM8	Rummagene Transcription Factor Associations 2026	1.0	null
LIN7C	Pathway Commons Protein-Protein Interactions	1.0	null
intracellular signaling cassette	GO Biological Process Annotations 2025	1.0	null
CRCGN010_HEPG2_24H:O19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.92648
STAT1	Pathway Commons Protein-Protein Interactions	1.0	null
DAUDI	CCLE Cell Line Gene CNV Profiles	1.0	2.44047
CRCGN017_MCF10A.TP53.M_24H:K11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.31496
TP53	ChEA Transcription Factor Targets	1.0	null
MTERF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.07279
GSE233647_2_v_0_docetaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE184892_7_v_2_trehalose_human	RummaGEO Drug Perturbation Signatures	1.0	null
RACGAP1	Pathway Commons Protein-Protein Interactions	1.0	null
lymphoblastic leukemia cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.094755
Golgi-associated vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.231
MDAMB231	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.82362
H3K27me3_endothelial cell of umbilical vein_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
orbital frontal cortex_36 yrs_M_12302	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.91284
FOXA1	JASPAR Predicted Transcription Factor Targets	1.0	null
GSE110268_1_v_3_foxd1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ERGIC1	Pathway Commons Protein-Protein Interactions	1.0	null
NCI-H2198	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.11403
NAPA	Pathway Commons Protein-Protein Interactions	1.0	null
ARF3	Pathway Commons Protein-Protein Interactions	1.0	null
Urogenital system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
intermediate portion of DFC (area 9/46)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.10803
intracellular signal transduction	GO Biological Process Annotations 2015	1.0	null
RAP1A	Pathway Commons Protein-Protein Interactions	1.0	null
AP-type membrane coat adaptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.206
RABL2A	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:L18	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.56993
H3K27ac_placenta_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Dendritic growth cone	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.821
musculoskeletal system disease	GWASdb SNP-Disease Associations	1.0	0.063396
mouse	GeneRIF Biological Term Annotations	1.0	null
leukemia cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.07669
FAR2	Pathway Commons Protein-Protein Interactions	1.0	null
Vdr	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.2539
Runx1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	34.828
DHCR24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.10376
CHD7	ENCODE Transcription Factor Targets	1.0	null
positive regulation of biological process	GO Biological Process Annotations 2015	1.0	null
regulation of signal transduction	GO Biological Process Annotations 2015	1.0	null
HS 766T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.847694
STAT5A	ChEA Transcription Factor Targets	1.0	null
C-33 A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
GP5D	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE114284_2_v_3_irf1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CAB39	Pathway Commons Protein-Protein Interactions	1.0	null
PMC2263127-pone.0001816.s001.xls-E2F3_up_Bild-Symbol_E2F3	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me1_osteoblast_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
SHSY5Y	DepMap CRISPR Gene Dependency	1.0	2.24552
intracellular	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
17177833-SuppTable1	GeneSigDB Published Gene Signatures	1.0	null
GSE158834_0_v_6_palmitic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC5497057-ncomms15921-s2.xlsx-AA_PCa_vs_EA_PCa-Unnamed_2_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
IFT46	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36788
ARFGEF2	Pathway Commons Protein-Protein Interactions	1.0	null
liver	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
H3K4me3_fibroblast of villous mesenchyme_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
GSE167224,GSE168147_3_v_5_hnrnpk_human	RummaGEO Gene Perturbation Signatures	1.0	null
Uterine cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.138
icSARS CoV_54Hour_23365422_GSE33267	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-3.21079
H3K4me3_cardiac mesoderm_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
ZFX-18555785-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
CD8 T cell_Stomach_Human	CellMarker Gene-Cell Type Associations	1.0	null
SYNE2	Pathway Commons Protein-Protein Interactions	1.0	null
CTTN	Pathway Commons Protein-Protein Interactions	1.0	null
POTEE	Pathway Commons Protein-Protein Interactions	1.0	null
CCND1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of the genitourinary system	GWASdb SNP-Phenotype Associations	1.0	0.119723
VRK1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_78_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
primary visual cortex (striate cortex, area V1/17)_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.71607
A4FUK	CCLE Cell Line Gene CNV Profiles	-1.0	-1.60189
H3K4me3_erythroblast_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
mRNA_SOX9_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
PMC9391581-mmc5.xlsx-KLF4_K409Q_vs_GFP-gene_name_KLF4	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me1_limb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
MDAMB415	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.580284
BAZ1B	Pathway Commons Protein-Protein Interactions	1.0	null
OUMS-23	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
chr22_44861935_G_C_b38	GTEx eQTL 2025	1.0	1.64383
PMC9618568-41467_2022_34255_MOESM6_ESM.xlsx-TAL1-Unnamed_0_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
abnormal respiratory system morphology	GWASdb SNP-Phenotype Associations	1.0	0.169511
PHLDA2	Pathway Commons Protein-Protein Interactions	1.0	null
t-lymphoblastic leukemia cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.312595
regulation of small GTPase mediated signal transduction	GO Biological Process Annotations 2023	1.0	null
MYC_K562_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTNNB1	Pathway Commons Protein-Protein Interactions	1.0	null
NCI-H2106	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.950627
H3K27me3_CD14-positive monocyte_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RALB	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me1_A549_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
VPS16	Pathway Commons Protein-Protein Interactions	1.0	null
SFXN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.14419
AP1M2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE152441,GSE152442_6_v_5_folic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
YY1_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
male reproductive gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.057899
FDFT1	Pathway Commons Protein-Protein Interactions	1.0	null
VAMP7	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_cardiac mesoderm_hg19_6	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SH3GLB1	Pathway Commons Protein-Protein Interactions	1.0	null
Primary T cells from cord blood	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-1.45871
ACOT11	Pathway Commons Protein-Protein Interactions	1.0	null
RANGAP1	Pathway Commons Protein-Protein Interactions	1.0	null
primary visual cortex (striate cortex, area V1/17)_30 yrs_F_12290	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-2.48061
ES8	DepMap CRISPR Gene Dependency	1.0	2.48277
CIB1	Pathway Commons Protein-Protein Interactions	1.0	null
SNX2	Pathway Commons Protein-Protein Interactions	1.0	null
EPS8L3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE118077_7_v_8_sprr5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CDK1	Pathway Commons Protein-Protein Interactions	1.0	null
primary motor-sensory cortex (samples)_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.953118
H3K27me3_GM12878_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
POLR2A_MCF 10A_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PDZD8	Pathway Commons Protein-Protein Interactions	1.0	null
prostate cancer cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.074311
mRNA_CDX2_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
PPP1R7	Pathway Commons Protein-Protein Interactions	1.0	null
ARL1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE231524,GSE231526_0_v_1_dusp6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
represents	GeneRIF Biological Term Annotations	1.0	null
GSE48812_2_v_6_sulforaphane_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE175787_13_v_9_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
GSE245270_1_v_4_isoproterenol_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PTGES2	Pathway Commons Protein-Protein Interactions	1.0	null
YWHAQ	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.76825
SW156	DepMap CRISPR Gene Dependency	1.0	3.25637
EXPH5	Pathway Commons Protein-Protein Interactions	1.0	null
mRNA_ATF3_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
COLO684	DepMap CRISPR Gene Dependency	1.0	2.24034
ChIP_TCF3_18467660	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
RAB14	Pathway Commons Protein-Protein Interactions	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A553-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EGFR	Pathway Commons Protein-Protein Interactions	1.0	null
EPAS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.1562
HAUS1	Pathway Commons Protein-Protein Interactions	1.0	null
female reproductive gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ERGIC3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE135244_0_v_1_trdmt1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A1QB-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
digestive gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
KELLY	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.06675
Lung squamous cell carcinoma_LUSC_TCGA-85-A512-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TCF3-18467660-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
PRDM9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	209.808
CDK5	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_A549_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN014_HEPG2_24H:N12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.27407
lateral intermediate part of entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.73539
SU-DHL-5	COSMIC Cell Line Gene Mutation Profiles	1.0	null
C32	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.14365
VPS33A	Pathway Commons Protein-Protein Interactions	1.0	null
CHMP6	Pathway Commons Protein-Protein Interactions	1.0	null
Thoracic cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.067
embryonic structure	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
FOXB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.738
active	GeneRIF Biological Term Annotations	1.0	null
NCIH196_LUNG	CCLE Cell Line Proteomics	1.0	2.38412
AGPS	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of erk1 and erk2 cascade	GO Biological Process Annotations 2015	1.0	null
RAP2B	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-WQ-A9G7-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LBH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.1778
COLO 829	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.62977
SNAPIN	Pathway Commons Protein-Protein Interactions	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-XBP1_XBP1	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me3_heart_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
male reproductive gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
NHLF	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-0.839083
RUVBL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49746
TSC1	Pathway Commons Protein-Protein Interactions	1.0	null
CBX8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55533
RAB10	Pathway Commons Protein-Protein Interactions	1.0	null
CDC23	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me2_K562_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
mRNA_SOX2_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
SUM1315MO2	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.989584
abnormality of head or neck	GWASdb SNP-Phenotype Associations	1.0	0.122979
region	GeneRIF Biological Term Annotations	1.0	null
RAB19	Pathway Commons Protein-Protein Interactions	1.0	null
CSTF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04197
vascular disease	GWASdb SNP-Disease Associations	1.0	0.064987
work	GeneRIF Biological Term Annotations	1.0	null
Hak	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.241
H3K27ac_ES-Bruce4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
VAMP3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE142210_2_v_0_panobinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K27me3_spleen_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CP in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.24046
CRCGN011_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.11908
CRCGN008_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.63685
SNAP23	Pathway Commons Protein-Protein Interactions	1.0	null
KIFC1	Pathway Commons Protein-Protein Interactions	1.0	null
urinary tract	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GSE217552_3_v_4_fisetin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DLD-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
CRCGN010_HEPG2_24H:N23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.01968
positive regulation of hydrolase activity	GO Biological Process Annotations 2015	1.0	null
NKX2-8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.0391
496100625_FWM_no dementia_no TBI_95-99_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.51742
Skin Cutaneous Melanoma_SKCM_TCGA-BF-A5ER-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_4 yrs_M_12298	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.05285
SNX27	Pathway Commons Protein-Protein Interactions	1.0	null
UTP23	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.11912
NCIH1915	CCLE Cell Line Gene CNV Profiles	-1.0	-1.41623
IZ in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.15272
PKM	Pathway Commons Protein-Protein Interactions	1.0	null
PMC9618568-41467_2022_34255_MOESM5_ESM.xlsx-TAL1-Unnamed_0_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
CCK-81	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A708-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE131649_2_v_9_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TPM3	Pathway Commons Protein-Protein Interactions	1.0	null
PITX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.6322
UCHL3	Pathway Commons Protein-Protein Interactions	1.0	null
Lung adenocarcinoma_LUAD_TCGA-49-4514-01A-21R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAC1	Pathway Commons Protein-Protein Interactions	1.0	null
cell	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
SW-948 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.624
CRCGN009_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.58933
EXOSC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19077
SCAMP3	Pathway Commons Protein-Protein Interactions	1.0	null
TBX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.98829
NCI-H64	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NEDD1	Pathway Commons Protein-Protein Interactions	1.0	null
cytoplasmic stress granule	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.489327
FLI1-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
regulation of intracellular signal transduction	GO Biological Process Annotations 2025	1.0	null
GSE150134_1_v_0_fluorouracil_human	RummaGEO Drug Perturbation Signatures	1.0	null
inferolateral temporal cortex (area TEv, area 20)_4 mos_M_12296	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.17323
H3K9ac_A549_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE205163,GSE205164_1_v_7_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
posterior cortical nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.85599
non-membrane-bounded organelle	LOCATE Curated Protein Localization Annotations	1.0	null
GSE239844_11_v_9_crizotinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
RALA	Pathway Commons Protein-Protein Interactions	1.0	null
GSE148262,GSE150691_3_v_2_hdlbp_human	RummaGEO Gene Perturbation Signatures	1.0	null
YMB-1-E	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02643
RAB3GAP2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE102870_11_v_0_nr1h4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
mammary gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
inferior colliculus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.979032
AP2B1	Pathway Commons Protein-Protein Interactions	1.0	null
H2AFZ_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HGS	Pathway Commons Protein-Protein Interactions	1.0	null
NCI-H2126	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.864707
RAMP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21296
H3K4me1_lung_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
H3K4me3_A549_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
KLF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	107.317
ILKAP	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_keratinocyte_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
TXLNA	Pathway Commons Protein-Protein Interactions	1.0	null
GSE229973_4_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
COLO792	CCLE Cell Line Gene CNV Profiles	1.0	1.84244
SNU410	CCLE Cell Line Gene CNV Profiles	1.0	1.57593
lhx8_18509161_newborn_ovary_lof_mouse_gpl1261_gds3254	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.365517
H3K4me3_K562_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
inner CP in (rostral) midinferior temporal cortex (area 36)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.01415
GSE233647_4_v_0_docetaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H1-6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.03249
KNS-62	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0113
hsa-miR-4797-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
15892885-tableS1a	GeneSigDB Published Gene Signatures	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_56_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
KIF4A	Pathway Commons Protein-Protein Interactions	1.0	null
MDAMB361	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.733233
ARL8B	Pathway Commons Protein-Protein Interactions	1.0	null
RHOBTB1	Pathway Commons Protein-Protein Interactions	1.0	null
KLF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	101.189
HCC2911	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.29933
torc2 complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	1.50735
GSE205976,GSE205978_3_v_0_cep83_human	RummaGEO Gene Perturbation Signatures	1.0	null
CRCGN009_HEPG2_24H:L07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	7.7686
abnormality of the nervous system	GWASdb SNP-Phenotype Associations	1.0	0.116515
TNFAIP8	Pathway Commons Protein-Protein Interactions	1.0	null
cell projection	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.049011
Fatty Liver	CTD Gene-Disease Associations	1.0	1.30238
Bach1::Mafk	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	23.4211
Lung squamous cell carcinoma_LUSC_TCGA-94-7943-01A-11R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12000322-41419_2025_7601_MOESM9_ESM.xlsx-H3122-AR_somatic_filtered_PASS-version_2_4_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GTPase regulator activity	GO Molecular Function Annotations 2023	1.0	null
H3K27me3_CD14-positive monocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PLA2G4B	Pathway Commons Protein-Protein Interactions	1.0	null
ACBD5	Pathway Commons Protein-Protein Interactions	1.0	null
BLOC1S1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_GM06990_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
496100362_FWM_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.10776
MYG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48001
GSE178714_5_v_7_smad2_human	RummaGEO Gene Perturbation Signatures	1.0	null
Pseudopodium	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.41
EPHA2	Pathway Commons Protein-Protein Interactions	1.0	null
GNB1	Pathway Commons Protein-Protein Interactions	1.0	null
ventrolateral prefrontal cortex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.95615
TTC19	Pathway Commons Protein-Protein Interactions	1.0	null
female reproductive system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
GSE174701_5_v_8_maml3_human	RummaGEO Gene Perturbation Signatures	1.0	null
ventrolateral prefrontal cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.9032
ARL8A	Pathway Commons Protein-Protein Interactions	1.0	null
NAA15	Pathway Commons Protein-Protein Interactions	1.0	null
SNF8	Pathway Commons Protein-Protein Interactions	1.0	null
SK-CO-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20302
Carcinogenesis	DisGeNET Gene-Phenotype Associations	1.0	null
hsa-miR-4452	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
HUG1N_STOMACH	CCLE Cell Line Proteomics	1.0	2.14285
SRP72	Pathway Commons Protein-Protein Interactions	1.0	null
lymphoid tissue	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.062008
substance-induced psychosis	GWASdb SNP-Disease Associations	1.0	0.481016
GSE147876,GSE147877_2_v_1_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE102870_3_v_0_nr1h4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GLYR1	Pathway Commons Protein-Protein Interactions	1.0	null
Zic1::Zic2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	28.4517
rho	GeneRIF Biological Term Annotations	1.0	null
ANXA3	Pathway Commons Protein-Protein Interactions	1.0	null
SMAD4	Pathway Commons Protein-Protein Interactions	1.0	null
ERBB3	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_HEPG2_48H:C23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.456
PMC6167382-41467_2018_6258_MOESM4_ESM.xlsx-TEAD-associated_GSC-Specific_UP-Nearest_Ensembl_GSC	Rummagene Transcription Factor Associations 2026	1.0	null
salivarygland_6b	HPA Tissue Sample Gene Expression Profiles	1.0	0.833338
mRNA_NANOG_16767105	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
EXOC8	Pathway Commons Protein-Protein Interactions	1.0	null
dorsolateral prefrontal cortex_12 pcw_F_12960	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.990117
H3K4me3_B cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE147366_3_v_0_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CRCGN015_MCF10A.TP53.M_24H:J08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.36482
MAZ	ENCODE Transcription Factor Targets	1.0	null
Clathrin adaptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.212
SW 780	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
KNS60	CCLE Cell Line Gene CNV Profiles	-1.0	-1.76726
lower limb region of M1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.06624
HCT-15	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PPP1CA	Pathway Commons Protein-Protein Interactions	1.0	null
cerebellar cortex_15 yrs_M_12299	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.10847
H3K4me3_G1E_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
HFI-142	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.29
RAB2A	Pathway Commons Protein-Protein Interactions	1.0	null
YIF1A	Pathway Commons Protein-Protein Interactions	1.0	null
TRAPPC3	Pathway Commons Protein-Protein Interactions	1.0	null
ChIP_ZFX_18555785	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
MKN7_STOMACH	CCLE Cell Line Proteomics	1.0	5.12586
Lung squamous cell carcinoma_LUSC_TCGA-66-2800-01A-01R-1201-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me3_erythroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
AP3B1	Pathway Commons Protein-Protein Interactions	1.0	null
HADHA	Pathway Commons Protein-Protein Interactions	1.0	null
ANXA6	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A_48H:K10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.2618
rheumatoid arthritis	GWASdb SNP-Disease Associations	1.0	0.576367
RABL6	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_keratinocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
MAPK7	Pathway Commons Protein-Protein Interactions	1.0	null
SH3GL1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_limb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Regulation of RhoA activity	PID Pathways	1.0	null
positive regulation of signal transduction	GO Biological Process Annotations 2015	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.83755
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-A45Z-01A-21R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCIH1755	DepMap CRISPR Gene Dependency	1.0	3.04931
PIK3R4	Pathway Commons Protein-Protein Interactions	1.0	null
RHOQ	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5456-11A-02R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
COG4	Pathway Commons Protein-Protein Interactions	1.0	null
GSE200839,GSE233826_5_v_4_tnrc18_human	RummaGEO Gene Perturbation Signatures	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-DW-5560-01A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
interplay	GeneRIF Biological Term Annotations	1.0	null
MDA-MB-435	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.848975
SCYL1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_77_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
MAP2K4	Pathway Commons Protein-Protein Interactions	1.0	null
MITF-21258399-MELANOMA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
POLR2A_lung_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.356
SNX3	Pathway Commons Protein-Protein Interactions	1.0	null
ERBB2IP	Pathway Commons Protein-Protein Interactions	1.0	null
upregulated	GeneRIF Biological Term Annotations	1.0	null
HADHB	Pathway Commons Protein-Protein Interactions	1.0	null
CHMP2A	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A.TP53.M_24H:O14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.13775
H3K4me1_CH12.LX_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
PMC12486367-Supplementary_Data2.pdf-437-ZNF837_ZNF837	Rummagene Transcription Factor Associations 2026	1.0	null
heart_6b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-GATA3_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
RAB3GAP1	Pathway Commons Protein-Protein Interactions	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-RB-A7B8-01A-12R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-2Y-A9H2-01A-12R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ZNF341	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.5844
GSE128730_3_v_1_neratinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NANOG-16518401-CHIP-PET-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
KMS-28PE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.06638
OSBPL11	Pathway Commons Protein-Protein Interactions	1.0	null
trans-Golgi network transport vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.406
gamma-glutamyl transpeptidase deficiency	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.117
IGR-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
abnormality of body weight	GWASdb SNP-Phenotype Associations	1.0	0.333306
nutrition disease	GWASdb SNP-Disease Associations	1.0	0.374359
skeletalmuscle_b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
ITGB4	Pathway Commons Protein-Protein Interactions	1.0	null
STX18	Pathway Commons Protein-Protein Interactions	1.0	null
LGMN	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_small intestine_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
SW 1463	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.08093
CRCGN008_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.78835
orbital frontal cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.01827
Adrenocortical carcinoma_ACC_TCGA-OR-A5K2-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_4_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
dorsolateral prefrontal cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.40244
PMC9974104-jci-133-159940-s017.xlsx-GT3-INCP-GATA3_Co-down-Symbol_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
TCF12_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
hsa-miR-300	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
COLO679_SKIN	CCLE Cell Line Proteomics	1.0	5.75084
breast cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.120955
ESYT1	Pathway Commons Protein-Protein Interactions	1.0	null
E2F6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	64.7416
PLEKHH1	Pathway Commons Protein-Protein Interactions	1.0	null
vitamin c_mus musculus_gpl6246_gse19378	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GSE113952,GSE113953_1_v_0_chtop_human	RummaGEO Gene Perturbation Signatures	-1.0	null
crosstalk	GeneRIF Biological Term Annotations	1.0	null
STARD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21955
NCI-H2810	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.915898
GSE176008_0_v_1_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
breast cancer cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.119362
PMC10170086-41598_2023_34519_MOESM6_ESM.xlsx-Sheet3-The_overlapping_genes_between_significantly_co-expressed_genes_and_significantly_differentially_expressed_genes_of_BARX2_in_LIHC_BARX2	Rummagene Transcription Factor Associations 2026	1.0	null
KLF12	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	176.796
H3K4me3_epithelial cell of esophagus_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
ribonucleoprotein complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.156513
RAB5A	Pathway Commons Protein-Protein Interactions	1.0	null
TRAPPC4	Pathway Commons Protein-Protein Interactions	1.0	null
NUFIP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.30513
RIF1	Pathway Commons Protein-Protein Interactions	1.0	null
Sarcoma_SARC_TCGA-DX-A2IZ-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN015_MCF10A.TP53.M_24H:E13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.4015
molecular function regulator	GO Molecular Function Annotations 2015	1.0	null
bronchial disease	GWASdb SNP-Disease Associations	1.0	0.944108
LYN	Pathway Commons Protein-Protein Interactions	1.0	null
KDM4A	ENCODE Transcription Factor Targets	1.0	null
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
MELHO	CCLE Cell Line Gene CNV Profiles	1.0	1.80974
PMC8519939-41525_2021_248_MOESM5_ESM.xlsx-E2F1_UP_V1_UP-Gene_name_E2F1	Rummagene Transcription Factor Associations 2026	1.0	null
cortactin	GeneRIF Biological Term Annotations	1.0	null
morphological abnormality of the central nervous system	GWASdb SNP-Phenotype Associations	1.0	0.075453
MYO7B	Pathway Commons Protein-Protein Interactions	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A80Q-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ISL1-27105846-CHIP-SEQ-CPCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
TP73	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.2579
MAPKAPK3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE168587,GSE168752_3_v_1_tp53_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC9950457-mmc3.xlsx-GRHL2_binding_sites-RBBP8NL_GRHL2	Rummagene Transcription Factor Associations 2026	1.0	null
adenocarcinoma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.066023
primary visual cortex (striate cortex, area V1/17)_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.17109
spinal (inferior) vestibular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.3123
VPS25	Pathway Commons Protein-Protein Interactions	1.0	null
GSE168401_1_v_3_harmine_human	RummaGEO Drug Perturbation Signatures	1.0	null
496100323_FWM_possible Alzheimer's disease_TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.14132
GSE202434,GSE202438_8_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
excretory gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.069295
urogenital system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.058267
Pancreatic adenocarcinoma_PAAD_TCGA-LB-A7SX-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
MAP2K1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.18897
NOMO1	DepMap CRISPR Gene Dependency	1.0	3.1349
cytoplasmic mrna processing body	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.428284
ITGB1	Pathway Commons Protein-Protein Interactions	1.0	null
RHOA	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_megakaryocyte_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of the cardiovascular system	GWASdb SNP-Phenotype Associations	1.0	0.04081
Head and Neck squamous cell carcinoma_HNSC_TCGA-KU-A6H7-06A-21R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CDK6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.76265
CHP134	DepMap CRISPR Gene Dependency	1.0	2.43165
mp1	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.449
POLR2A_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
disease of metabolism	GWASdb SNP-Disease Associations	1.0	0.097649
MAPK8IP3	Pathway Commons Protein-Protein Interactions	1.0	null
PPM1B	Pathway Commons Protein-Protein Interactions	1.0	null
atrophy/degeneration affecting the central nervous system	GWASdb SNP-Phenotype Associations	1.0	0.510092
GSE244233_1_v_0_quercetin_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K4me2_A549_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN017_MCF10A.WT.HP_24H:H10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.66685
KDM5B	ENCODE Transcription Factor Targets	1.0	null
regulation of hydrolase activity	GO Biological Process Annotations 2015	1.0	null
SH3GLB2	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EX-A1H6-01B-11R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ACSL5	Pathway Commons Protein-Protein Interactions	1.0	null
PMC4960540-srep30217-s5.xls-VD_metabolism-V_VDR_Q3_VDR	Rummagene Transcription Factor Associations 2026	1.0	null
ZFX	ChEA Transcription Factor Targets	1.0	null
GSE147876,GSE147877_4_v_7_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
UNC93B1	Pathway Commons Protein-Protein Interactions	1.0	null
HMGB1P1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.3052
CYTH3	Pathway Commons Protein-Protein Interactions	1.0	null
RHOV	Pathway Commons Protein-Protein Interactions	1.0	null
RAC2	Pathway Commons Protein-Protein Interactions	1.0	null
POLR2A_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN015_MCF10A.TP53.M_24H:K11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.12812
Ebf4	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	42.8955
SNU626	DepMap CRISPR Gene Dependency	1.0	3.93339
GSE239688_4_v_0_canagliflozin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
orbital frontal cortex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.21183
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70O-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
prostate gland cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.066801
layer IIIb of caudal entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.66829
TP53-23651856-MEF-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
Fibroma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.141
mda-mb-231 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.31332
CRCGN017_MCF10A.WT.HP_24H:H24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.94865
TCF12_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
WDFY3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE242290_3_v_0_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
MICA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.03652
15892885-tableS1c	GeneSigDB Published Gene Signatures	1.0	null
GSE147366_1_v_2_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
U-2 OS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.49214
MOB1B	Pathway Commons Protein-Protein Interactions	1.0	null
NANOG	ChEA Transcription Factor Targets	1.0	null
mammary gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.159409
PMC6411037-NIHMS981149-supplement-4.xlsx-Table_S3D-Table_S3D_Result_of_GSEA_with_human_ST-EPN_gene_set_DEGs_in_PDGFA_tumors_relative_to_RELA_fusion_tumors_are_listed_in_the_table_RELA	Rummagene Transcription Factor Associations 2026	1.0	null
PMC9618568-41467_2022_34255_MOESM4_ESM.xlsx-TAL1-Unnamed_0_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
Mesothelioma_MESO_TCGA-LK-A4NZ-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
UACC-257	COSMIC Cell Line Gene Mutation Profiles	1.0	null
AMO-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
abnormality of the head	GWASdb SNP-Phenotype Associations	1.0	0.122979
mRNA_EOMES_19796622	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
CRCGN012_HEPG2_24H:G01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.29134
PMC8858874-NIHMS1764275-supplement-Supplemental_Table_2.xlsx-R1_SOX2_bound_genes_5000bp_6-9--Gene_Name_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
Perturb_17580_KO_Rif1_SRP348198	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	20.0
PBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	38.3158
Congenital Abnormalities	CTD Gene-Disease Associations	1.0	1.04051
KIF1A	Pathway Commons Protein-Protein Interactions	1.0	null
RUNX1-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
cancer	GWASdb SNP-Disease Associations	1.0	0.041919
anterior (rostral) cingulate (medial prefrontal) cortex_21 yrs_F_13057	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.920541
GSE188721_3_v_4_mesp1_human	RummaGEO Gene Perturbation Signatures	1.0	null
positive regulation of intracellular signal transduction	GO Biological Process Annotations 2015	1.0	null
17683608-TableS2	GeneSigDB Published Gene Signatures	1.0	null
Lung adenocarcinoma_LUAD_TCGA-MP-A4T6-01A-32R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cytoplasmic part	GO Cellular Component Annotations 2015	1.0	null
PGAM5	Pathway Commons Protein-Protein Interactions	1.0	null
striatum_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.857959
CAL-85-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.847694
Cayman type cerebellar ataxia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.768
PMC6855629-pone.0225186.s009.xlsx-Sheet1-DEGs_downregulated_in_HEK293_MEIS1_KO_MEIS1	Rummagene Transcription Factor Associations 2026	1.0	null
TXLNG	Pathway Commons Protein-Protein Interactions	1.0	null
atherosclerosis	GWASdb SNP-Phenotype Associations	1.0	0.256313
HOOK2	Pathway Commons Protein-Protein Interactions	1.0	null
AXIN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64663
mRNA_SOX2_16767105	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
ES-I3 Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	0.908966
CRCGN017_MCF10A.WT.HP_24H:O12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.8108
SRP9	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-6436-01A-11R-1686-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me2_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
acute lymphoblastic leukemia cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.096041
H3K27me3_cardiac mesoderm_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
personality disorder	GWASdb SNP-Disease Associations	1.0	0.716372
JHH7	CCLE Cell Line Gene CNV Profiles	1.0	1.33716
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_5_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
Inflammation	CTD Gene-Disease Associations	1.0	1.50043
gtpaseactivating	GeneRIF Biological Term Annotations	1.0	null
DYNC1LI1	Pathway Commons Protein-Protein Interactions	1.0	null
Breast	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-8601-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PPP2CA	Pathway Commons Protein-Protein Interactions	1.0	null
GSE202434,GSE202438_6_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
VZ in subgenual cingulate neocortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.872642
phenotypic abnormality	GWASdb SNP-Phenotype Associations	1.0	0.684265
POLR2A_bone marrow macrophage_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Tcf12	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.3792
hippocampus (hippocampal formation)_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.949649
HNF1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.4437
928 MEL	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.994844
NF1	Pathway Commons Protein-Protein Interactions	1.0	null
PHOX2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.1512
H3K27me3_erythroblast_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2935-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Reproductive system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.006
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4334-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC387762__F5	PFOCR Pathway Figure Associations 2023	1.0	null
PDCD4	Pathway Commons Protein-Protein Interactions	1.0	null
heart_5b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.01737
RAB11A	Pathway Commons Protein-Protein Interactions	1.0	null
CREB1	ChEA Transcription Factor Targets	1.0	null
CRCGN017_MCF10A.WT.HP_24H:N23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.38015
H3K9me3_G1E_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
POLR2AphosphoS5_HCT116_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CSNK1A1	Pathway Commons Protein-Protein Interactions	1.0	null
paper	GeneRIF Biological Term Annotations	1.0	null
SEPT9	Pathway Commons Protein-Protein Interactions	1.0	null
ventrolateral prefrontal cortex_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.985324
ventrolateral prefrontal cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.988115
ETV5::FIGLA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	49.684
SYNJ2BP	Pathway Commons Protein-Protein Interactions	1.0	null
POLR2A_MCF 10A_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RRAS	Pathway Commons Protein-Protein Interactions	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-ZF-A9R0-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
immunologic hypersensitivity	GWASdb SNP-Phenotype Associations	1.0	0.321827
tissues, cell types and enzyme sources	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.275794
excretory gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
POU5F1-16518401-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
hsa-miR-873	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
CRCGN013_HEPG2_24H:N13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.44719
CRCGN009_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.73244
hela	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
LRPPRC	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3440-01A-02R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TP53BP2	Pathway Commons Protein-Protein Interactions	1.0	null
organism form	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
PMC12000322-41419_2025_7601_MOESM9_ESM.xlsx-H3122-AR_somatic_filtered_PASS-Unnamed_60_AR	Rummagene Transcription Factor Associations 2026	1.0	null
VPS37B	Pathway Commons Protein-Protein Interactions	1.0	null
IM-95	COSMIC Cell Line Gene Mutation Profiles	1.0	null
STAT6	Pathway Commons Protein-Protein Interactions	1.0	null
t66-lung_consensus	MoTrPAC Rat Endurance Exercise Training	1.0	1.82676
NCIH292	CCLE Cell Line Gene CNV Profiles	-1.0	-1.37291
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_85_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
GSE178714_1_v_4_smad2_human	RummaGEO Gene Perturbation Signatures	1.0	null
H3K27me3_BJ_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCIH1092	CCLE Cell Line Gene CNV Profiles	-1.0	-2.07649
midbrain reticular formation	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.47807
animal	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.052728
GSE174701_1_v_0_maml3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
scaffold	GeneRIF Biological Term Annotations	1.0	null
VPS51	Pathway Commons Protein-Protein Interactions	1.0	null
FNTA	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3447-01A-01R-1766-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN011_HEPG2_24H:M13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.84755
LSM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48154
pc3	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A17X-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CLTC	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_CD8 Naive Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
colon	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Psoas_Muscle	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-2.09956
BAIAP2	Pathway Commons Protein-Protein Interactions	1.0	null
sequences	GeneRIF Biological Term Annotations	1.0	null
Electroencephalographic traits in alcoholism	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.552288
Perturb_13435_KD_Zc3h13_SRP098937	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	6.69407
PMC4387713-supp_gad.255984.114_Table_S4.xlsx-S4A-Down_Nanog_KD-Unnamed_1_AR	Rummagene Transcription Factor Associations 2026	1.0	null
TTI1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC3817717__F2	PFOCR Pathway Figure Associations 2024	1.0	null
H3K4me2_A549_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
TRRAP	Pathway Commons Protein-Protein Interactions	1.0	null
TRIM28_HEK293_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ANXA7	Pathway Commons Protein-Protein Interactions	1.0	null
GSE121866_0_v_3_six4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TMEM243	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.12768
SMC3	Pathway Commons Protein-Protein Interactions	1.0	null
genomic	GeneRIF Biological Term Annotations	1.0	null
GTPase activator activity	GO Molecular Function Annotations 2023	1.0	null
MG-63	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE216043_11_v_6_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
personality disorder	GWASdb SNP-Phenotype Associations	1.0	0.616892
GOLGA7	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of intracellular signal transduction	GO Biological Process Annotations 2023	1.0	null
SK-MEL-30	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SH3GL2	Pathway Commons Protein-Protein Interactions	1.0	null
ERLIN1	Pathway Commons Protein-Protein Interactions	1.0	null
PRKAB1	Pathway Commons Protein-Protein Interactions	1.0	null
GCNP_SHH_UP_EARLY.V1	MSigDB Signatures of Differentially Expressed Genes for Cancer Gene Perturbations	1.0	null
CAPZA1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC9296003-supp_gad.348982.121_Supplementary_Table_S1.xlsx-Partitions_EPC1-PHF1-FLAG-Unnamed_19_PHF1	Rummagene Transcription Factor Associations 2026	1.0	null
SREBF2	JASPAR Predicted Transcription Factor Targets	1.0	null
MSLN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0405
LAMTOR3	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-6988-01A-11R-1915-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STX7	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN012_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.02029
HSFY1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.76749
YY1_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MAX_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-A5HZ-01A-21R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-FOXA1_FOXA1	Rummagene Transcription Factor Associations 2026	1.0	null
HOOK1	Pathway Commons Protein-Protein Interactions	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_ALL-SYMBOL_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
estradiol_mus musculus_gpl4134_gse23072	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
CRCGN014_HEPG2_3H:P19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.97892
hsa-miR-3622b-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
TCFAP2C-20176728-TROPHOBLAST-STEM-CELLS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
PMC5291205-srep41905-s3.xlsx-LPS_datasets_gmx-Conserved_gene_regulation_during_acute_inflammation_between_zebrafish_and_mammals_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
SLC25A5	Pathway Commons Protein-Protein Interactions	1.0	null
GNB5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.48219
MAX_MCF-7_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
LCLC-103H	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.71837
NRAS	Pathway Commons Protein-Protein Interactions	1.0	null
LSG1	Pathway Commons Protein-Protein Interactions	1.0	null
FOXC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.2065
CAMA1	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.868959
SGK3	Pathway Commons Protein-Protein Interactions	1.0	null
H3K9me3_osteoblast_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
diabetes mellitus	GWASdb SNP-Phenotype Associations	1.0	0.294937
UACC-812	Sanger Dependency Map Cancer Cell Line Proteomics	1.0	2.81418
H3K4me3_epithelial cell of proximal tubule_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
RUNX1-22343733-PBMC-HUMAN-BONEMARROW	ChEA Transcription Factor Targets 2022	1.0	null
MYC_MCF-7_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me3_kidney epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
PPP5C	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_epithelial cell of proximal tubule_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
NSF	Pathway Commons Protein-Protein Interactions	1.0	null
ZNF692	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	47.7269
GBA	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of cellular metabolic process	GO Biological Process Annotations 2015	1.0	null
YY1	ENCODE Transcription Factor Targets	1.0	null
hippocampus (hippocampal formation)_16 pcw_M_12287	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.75226
GSE228106_0_v_5_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
CRCGN010_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.58829
JUND	ENCODE Transcription Factor Targets	1.0	null
15897907-SuppTable2	GeneSigDB Published Gene Signatures	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A41B-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CREB1-20920259-GC1-SPG-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
CRCGN012_HEPG2_24H:G05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.07303
SPTAN1	Pathway Commons Protein-Protein Interactions	1.0	null
ZWINT	Pathway Commons Protein-Protein Interactions	1.0	null
GSE195663_0_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
BNIP2-ARHGAP8 complex	CORUM Protein Complexes	1.0	null
RIMS1	Pathway Commons Protein-Protein Interactions	1.0	null
POLR2A_A549_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H2AFZ_keratinocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC387762__F5	PFOCR Pathway Figure Associations 2024	1.0	null
type ii diabetes mellitus	GWASdb SNP-Phenotype Associations	1.0	0.594972
H3K27me3_cardiac mesoderm_hg19_7	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE175787_4_v_6_rhoc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CDC42SE2	Pathway Commons Protein-Protein Interactions	1.0	null
VPS35	Pathway Commons Protein-Protein Interactions	1.0	null
769P_KIDNEY	CCLE Cell Line Proteomics	1.0	7.17615
POLR2A_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
STAMBPL1	Pathway Commons Protein-Protein Interactions	1.0	null
Developmental disorder of mental health	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.034
OCT4-20526341-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
PIN1	Pathway Commons Protein-Protein Interactions	1.0	null
thorax	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
IMR32	DepMap CRISPR Gene Dependency	1.0	2.42739
PMC9911396-41467_2023_36178_MOESM11_ESM.xlsx-Sheet1-Genes_in_10kb_vicinity_of_ZBTB12_ChIP-seq_peaks_ZBTB12	Rummagene Transcription Factor Associations 2026	1.0	null
GSE135514_2_v_0_dasatinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
vomeralnasalorgan.VMO.	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-1.81744
H3K4me3_ES-E14_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
MAFK_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K9me3_G1E-ER4_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
COV362	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13253
SMAD2/3-21741376-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GSE210870_0_v_2_snai1_human	RummaGEO Gene Perturbation Signatures	1.0	null
cytosol	GO Cellular Component Annotations 2015	1.0	null
PTPN6	Pathway Commons Protein-Protein Interactions	1.0	null
PLEKHA5	Pathway Commons Protein-Protein Interactions	1.0	null
GSE188570,GSE188571_5_v_0_decitabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ULK3	Pathway Commons Protein-Protein Interactions	1.0	null
BZW2	Pathway Commons Protein-Protein Interactions	1.0	null
MAP1S	Pathway Commons Protein-Protein Interactions	1.0	null
hematopoietic system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.057746
GSE228106_3_v_4_paclitaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CDC42BPB	Pathway Commons Protein-Protein Interactions	1.0	null
XRCC5_02_114	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.58496
EGR1-20690147-ERYTHROLEUKEMIA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
cell part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.183328
intracellular part	LOCATE Predicted Protein Localization Annotations	1.0	null
Gastrointestinal stromal tumor_Gastric Tissue_GSE15966	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.55352
CP in temporal polar cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.894703
ERGIC2	Pathway Commons Protein-Protein Interactions	1.0	null
MVB12A	Pathway Commons Protein-Protein Interactions	1.0	null
GSE156923_2_v_3_rbmx_human	RummaGEO Gene Perturbation Signatures	1.0	null
RAB11B	Pathway Commons Protein-Protein Interactions	1.0	null
ARF6	Pathway Commons Protein-Protein Interactions	1.0	null
lung disease	GWASdb SNP-Disease Associations	1.0	0.255057
H3K27me3_fibroblast of dermis_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me1_brown adipose tissue_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
STX16	Pathway Commons Protein-Protein Interactions	1.0	null
Thoracic disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.064
CHMP1B	Pathway Commons Protein-Protein Interactions	1.0	null
TGFBRAP1	Pathway Commons Protein-Protein Interactions	1.0	null
SUM159PT	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.988533
PRKAA1	Pathway Commons Protein-Protein Interactions	1.0	null
OUMS-23	COSMIC Cell Line Gene Mutation Profiles	1.0	null
USE1	Pathway Commons Protein-Protein Interactions	1.0	null
STX17	Pathway Commons Protein-Protein Interactions	1.0	null
signalling	GeneRIF Biological Term Annotations	1.0	null
NKIRAS2	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN016_MCF10A.TP53.M_24H:K11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.44254
TBP_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K27me3_CH12.LX_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RBBP5_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ARHGEF1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_brown adipose tissue_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
EXOC6	Pathway Commons Protein-Protein Interactions	1.0	null
GSE119978,GSE180930_6_v_8_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K4me3_cardiac mesoderm_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
PRDM14	ChEA Transcription Factor Targets	1.0	null
H3K27me3_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
testicular cancer cell	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
STAT3	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_embryonic fibroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-N6-A4VC-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MEF2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.6642
integument	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Weight Loss	CTD Gene-Disease Associations	1.0	1.31837
H3K27me3_erythroblast_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE226584,GSE226589_1_v_0_ezh2_human	RummaGEO Gene Perturbation Signatures	1.0	null
TCOF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.05393
NO11	DepMap CRISPR Gene Dependency	1.0	3.52439
SK-MEL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.948136
AHNAK	Pathway Commons Protein-Protein Interactions	1.0	null
primary motor-sensory cortex (samples)_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.22115
COLO 699	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.57838
HLA-C	Pathway Commons Protein-Protein Interactions	1.0	null
AR-19668381-PC3-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
ventrolateral prefrontal cortex_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.920822
alitretinoin_homo sapiens_gpl6480_gse43090	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
dorsolateral prefrontal cortex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.15779
ATP6V1C2	Pathway Commons Protein-Protein Interactions	1.0	null
determinant	GeneRIF Biological Term Annotations	1.0	null
KPNB1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_ES-E14_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
regulation of endocytic recycling	GO Biological Process Annotations 2023	1.0	null
concomitant	GeneRIF Biological Term Annotations	1.0	null
CFL1	Pathway Commons Protein-Protein Interactions	1.0	null
REPS1	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-4A-A93W-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JHH-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.966162
SEC22B	Pathway Commons Protein-Protein Interactions	1.0	null
PLEKHA1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205163,GSE205164_3_v_7_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
artery disease	GWASdb SNP-Disease Associations	1.0	0.090406
TFRC	Pathway Commons Protein-Protein Interactions	1.0	null
GATA2_G1E-ER4_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
COLO 853	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37867
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_MAP_AA-SYMBOL_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
Blood Coagulation Disorders	CTD Gene-Disease Associations	1.0	1.11775
SW626	Sanger Dependency Map Cancer Cell Line Proteomics	-1.0	-2.67965
epithelioma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.261284
PACSIN2	Pathway Commons Protein-Protein Interactions	1.0	null
anterior amygdaloid area	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.49804
ZBTB7A_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A182-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE210682_2_v_3_methadone_human	RummaGEO Drug Perturbation Signatures	1.0	null
SCP2	Pathway Commons Protein-Protein Interactions	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-P5-A5F6-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE210870_0_v_1_snai1_human	RummaGEO Gene Perturbation Signatures	1.0	null
CHD7_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE135030_11_v_0_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
torc1 complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	1.08425
RABL3	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A2IR-01A-11R-A180-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
abnormality of the urinary system	GWASdb SNP-Phenotype Associations	1.0	0.990273
GSE242290_3_v_11_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
BT16	DepMap CRISPR Gene Dependency	1.0	2.35676
Atherosclerosis	CTD Gene-Disease Associations	1.0	1.2013
GPRC5A	Pathway Commons Protein-Protein Interactions	1.0	null
DSTN	Pathway Commons Protein-Protein Interactions	1.0	null
PMC8519939-41525_2021_248_MOESM5_ESM.xlsx-NFE2L2_V2-Ensemble_gene_ID_NFE2L2	Rummagene Transcription Factor Associations 2026	1.0	null
EFO-27	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K4me3_LNCaP clone FGC_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
prolinerich	GeneRIF Biological Term Annotations	1.0	null
KIF11	Pathway Commons Protein-Protein Interactions	1.0	null
Rho GTPase activation protein	InterPro Predicted Protein Domain Annotations	1.0	null
EPS8	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3443-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SMC3	ENCODE Transcription Factor Targets	1.0	null
WDFY1	Pathway Commons Protein-Protein Interactions	1.0	null
SNU-1040	COSMIC Cell Line Gene Mutation Profiles	1.0	null
cellular_component	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.044791
RPS6KA3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE205163,GSE205164_2_v_8_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
serving	GeneRIF Biological Term Annotations	1.0	null
A-Vietnam-1203-2004(H5N1)_24Hour_None_GSE43204	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.44875
GSE131649_6_v_8_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
MEWO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NEU1	Pathway Commons Protein-Protein Interactions	1.0	null
occipital neocortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.954111
PMC3419980-leu201249x4.xls-H3K9Ac-RUNX1ETO_peaks_2fold-All_gene_regions_overlapping_with_RUNX1-ETO_peaks_changing_histone_acetylation_more_than_2-fold_after_knock-down_RUNX1	Rummagene Transcription Factor Associations 2026	1.0	null
HBL-100	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.992129
JAK1	Pathway Commons Protein-Protein Interactions	1.0	null
TLN1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_H7_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KHDRBS1	Pathway Commons Protein-Protein Interactions	1.0	null
mek2	GeneRIF Biological Term Annotations	1.0	null
ECSIT	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-BC-A69H-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CHMP1A	Pathway Commons Protein-Protein Interactions	1.0	null
mammary gland tumor cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.409351
Whole body	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
POLR2A_MCF-7_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC11282827-40659_2024_524_MOESM5_ESM.xlsx-TAL1-sequence_name_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
GATA2	ENCODE Transcription Factor Targets	1.0	null
CALM1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormal nervous system electrophysiology	GWASdb SNP-Phenotype Associations	1.0	0.969142
H3K4me3_NT2-D1_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-FOXA3_FOXA3	Rummagene Transcription Factor Associations 2026	1.0	null
H3K27me3_endothelial cell of umbilical vein_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
A4/FUK	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.74445
LU165	DepMap CRISPR Gene Dependency	1.0	5.52077
PMC8046804-41467_2021_22478_MOESM11_ESM.xlsx-Del_AA-TCGA-Unnamed_34_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
TP53	JASPAR Predicted Transcription Factor Targets	1.0	null
FLI1-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
20436685-ST5-1	GeneSigDB Published Gene Signatures	1.0	null
BCAP29	Pathway Commons Protein-Protein Interactions	1.0	null
disease of anatomical entity	GWASdb SNP-Disease Associations	1.0	0.052835
H3K4me1_kidney_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
H3K27me3_endothelial cell of umbilical vein_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H2AFZ_A549_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SNAI2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.6119
CRCGN011_HEPG2_24H:G13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.7634
SUZ12	ChEA Transcription Factor Targets	1.0	null
EOL-1-CELL	COSMIC Cell Line Gene Mutation Profiles	1.0	null
RQCD1	Pathway Commons Protein-Protein Interactions	1.0	null
BT474	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.744357
DOCK1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE144453,GSE144454_1_v_0_tfdp1_human	RummaGEO Gene Perturbation Signatures	1.0	null
layer V of area 35c	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.0164
skin_5f	HPA Tissue Sample Gene Expression Profiles	-1.0	-0.936293
subparafascicular nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.36779
reproductive system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
PMC11257629-media-3.xls-Dong_et_al_2023-Comparision_of_METTL3_KD_DEG_with_Dong_et_al_GRGs_AR	Rummagene Transcription Factor Associations 2026	1.0	null
cytoskeleton	LOCATE Curated Protein Localization Annotations	1.0	null
NAAA	Pathway Commons Protein-Protein Interactions	1.0	null
GSE195559_8_v_4_notch1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
lymphocytic leukemia cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.121177
SNAI3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.2205
PMC8481886-Table_2.xlsx-A_subsets-AF_MSC_UdRPC_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
TTC642	DepMap CRISPR Gene Dependency	1.0	3.60562
FANCI	Pathway Commons Protein-Protein Interactions	1.0	null
PE01	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.946791
TP63	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.6686
PMC9296003-supp_gad.348982.121_Supplementary_Table_S1.xlsx-Partitions_EPC1-PHF1-FLAG-Unnamed_20_PHF1	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me3_SK-N-SH_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
GSE133087_1_v_2_metformin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
FLNB	Pathway Commons Protein-Protein Interactions	1.0	null
FOXD3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	91.6555
E2F6_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN015_MCF10A.TP53.M_24H:O12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.94917
CRCGN017_MCF10A.WT.HP_24H:N09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.73007
Disease of mental health	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.034
Acute Myeloid Leukemia_LAML_TCGA-AB-2824-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5468-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cdc42gap	GeneRIF Biological Term Annotations	1.0	null
GSE202434,GSE202438_2_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE193258,GSE193259_9_v_3_osimertinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CRCGN009_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.7318
H3K27me3_cardiac mesoderm_hg19_8	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RABAC1	Pathway Commons Protein-Protein Interactions	1.0	null
endocrine gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.057541
COV504	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.972569
skeletalmuscle_e	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
GSE239844_11_v_2_crizotinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K4me1_embryonic fibroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN016_MCF10A.TP53.M_24H:L22	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.48182
NCI-H441	COSMIC Cell Line Gene Mutation Profiles	1.0	null
WASH2P	Pathway Commons Protein-Protein Interactions	1.0	null
DNM1L	Pathway Commons Protein-Protein Interactions	1.0	null
Non-alcoholic fatty liver disease activity score in non-alcoholic fatty liver disease	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.604576
GSE232218_1_v_0_valproic acid_human	RummaGEO Drug Perturbation Signatures	1.0	null
VSNL1	Pathway Commons Protein-Protein Interactions	1.0	null
BAZ1A	Pathway Commons Protein-Protein Interactions	1.0	null
LAMP2	Pathway Commons Protein-Protein Interactions	1.0	null
PMC12000322-41419_2025_7601_MOESM9_ESM.xlsx-H3122-AR_somatic_filtered_PASS-Unnamed_47_AR	Rummagene Transcription Factor Associations 2026	1.0	null
STAG1	Pathway Commons Protein-Protein Interactions	1.0	null
NUGC4	CCLE Cell Line Gene CNV Profiles	-1.0	-1.81338
POLR2AphosphoS5_HCT116_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_54_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
NEK6	Pathway Commons Protein-Protein Interactions	1.0	null
MCF-7	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.992271
SSRP1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_A549_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE120200,GSE127269_1_v_2_asxl1_human	RummaGEO Gene Perturbation Signatures	1.0	null
POLR2A_MCF-7_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-2L-AAQA-01A-21R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PRKAG1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_BJ_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBC1D10B	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A.TP53.M_24H:L19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.59625
PMC10011543-41419_2023_5707_MOESM4_ESM.xlsx-genes_with_unique_InDel-F5-Pneo-r__CIC-1n_h-r__CIC-2n_h-r_CIC	Rummagene Transcription Factor Associations 2026	1.0	null
RPL41	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.50332
GSE153867_6_v_4_olaparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
MS-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K27me3_cardiac mesoderm_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
LLGL2	Pathway Commons Protein-Protein Interactions	1.0	null
pc-3 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.34926
YY1_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF737	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05139
CRCGN010_HEPG2_24H:H07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.4087
targets	GeneRIF Biological Term Annotations	1.0	null
RHEB	Pathway Commons Protein-Protein Interactions	1.0	null
PSEN1	Pathway Commons Protein-Protein Interactions	1.0	null
regulation of phosphorylation	GO Biological Process Annotations 2015	1.0	null
LGR5	Pathway Commons Protein-Protein Interactions	1.0	null
Testicular cancer cell	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
CDC5L	Pathway Commons Protein-Protein Interactions	1.0	null
ATM	Pathway Commons Protein-Protein Interactions	1.0	null
non-membrane-bounded organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.066324
Brain Lower Grade Glioma_LGG_TCGA-DB-A75P-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAPGEF4	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN010_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.77663
GSE142210_2_v_10_panobinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K4me1_astrocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE223893_11_v_9_setd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ARH77	DepMap CRISPR Gene Dependency	1.0	4.36794
torc2 complex	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
abnormality of male internal genitalia	GWASdb SNP-Phenotype Associations	1.0	0.66742
GSE240439_1_v_3_decitabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
Esophagus - Mucosa	GTEx Tissue Gene Expression Profiles 2023	1.0	1.07632
inferolateral temporal cortex (area TEv, area 20)_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.02028
IZ in superolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.86047
AP2A1	Pathway Commons Protein-Protein Interactions	1.0	null
BIN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.13261
H3K18ac_H1	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
PAX9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.4142
PPP1R9B	Pathway Commons Protein-Protein Interactions	1.0	null
SDF4	Pathway Commons Protein-Protein Interactions	1.0	null
OCI-LY-10	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.67888
CDK4	Pathway Commons Protein-Protein Interactions	1.0	null
MAP2K2	Pathway Commons Protein-Protein Interactions	1.0	null
prostate cancer	GWASdb SNP-Phenotype Associations	1.0	0.66742
RAB9A	Pathway Commons Protein-Protein Interactions	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-FG-A60L-01A-12R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Binge eating behaviour in bipolar disorder	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.752288
TRIM24	Pathway Commons Protein-Protein Interactions	1.0	null
ATR	Pathway Commons Protein-Protein Interactions	1.0	null
HPAFII	DepMap CRISPR Gene Dependency	1.0	2.49544
H3K9ac_NT2-D1_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-FR-A3YO-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DAOY	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PMC8202205-NIHMS1706275-supplement-Table_S3.xlsx-Day_2_GATA6-dependent_genes-GATA6-dependent_mRNA_expression_Day_2_Mesendoderm_FDR_0_05_GATA6	Rummagene Transcription Factor Associations 2026	1.0	null
lymphoblastic leukemia cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.271952
CRCGN015_MCF10A.TP53.M_24H:J23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.81348
HT1376	DepMap CRISPR Gene Dependency	1.0	2.72804
CENPV	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3465-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RPS13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.39719
compares	GeneRIF Biological Term Annotations	1.0	null
GSE154936_3_v_2_remdesivir_human	RummaGEO Drug Perturbation Signatures	-1.0	null
outer CP in midcingulate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.39946
H3K4me2_H1-hESC_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
MRTFA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48398
Mafg	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	30.6176
TCF21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0628
RASSF8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47364
SARNP	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27me3_fibroblast of lung_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Translation preinitiation complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.553
639-V	COSMIC Cell Line Gene Mutation Profiles	1.0	null
TUBGCP2	Pathway Commons Protein-Protein Interactions	1.0	null
CTV1DM	DepMap CRISPR Gene Dependency	1.0	4.64778
CAKI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850089
IQGAP1	Pathway Commons Protein-Protein Interactions	1.0	null
ADRM1	Pathway Commons Protein-Protein Interactions	1.0	null
NB6	DepMap CRISPR Gene Dependency	1.0	3.19776
GTPase regulator activity	GO Molecular Function Annotations 2025	1.0	null
SG in dorsomedial parietal cortex (area 7m)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.16278
CRCGN014_HEPG2_3H:D07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.29925
tumors	GeneRIF Biological Term Annotations	1.0	null
PHF8	ENCODE Transcription Factor Targets	1.0	null
CRCGN009_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.83773
RHOH	Pathway Commons Protein-Protein Interactions	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.864609
SWAP70	Pathway Commons Protein-Protein Interactions	1.0	null
colorectum	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Mammary gland	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
HEC-1-A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
PRKDC	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_HEPG2_48H:A14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.09703
CRCGN010_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.01489
H3K4me3_cardiac mesoderm_hg19_7	ENCODE Histone Modification Site Profiles	1.0	null
H3K4me1_small intestine_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
AP-1 adaptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.426
HSC-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
nr2c2_20864514_liver_1yo_lof_mouse_gpl4134_gse21903	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.054938
SFT2D3	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-ED-A66X-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cerebellar vermis	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.865903
Female reproductive organ cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.029
SOX10	MotifMap Predicted Transcription Factor Targets	1.0	null
CRCGN016_MCF10A.TP53.M_24H:O11	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.45734
KIAA0196	Pathway Commons Protein-Protein Interactions	1.0	null
Lung adenocarcinoma_LUAD_TCGA-73-7498-01A-12R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hippocampus (hippocampal formation)_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.85737
PTK2B	Pathway Commons Protein-Protein Interactions	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_3_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me3_thymus_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Abnormalities, Drug-Induced	CTD Gene-Disease Associations	1.0	1.04647
regulation of small gtpase mediated signal transduction	GO Biological Process Annotations 2015	1.0	null
NEC8	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A3MA-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC9378714-41467_2022_31999_MOESM10_ESM.xlsx-Supplementary_Data_7-Supplementary_Data_7_Collation_of_genes_possible_regulated_or_co-expressed_with_ELF5_ELF5	Rummagene Transcription Factor Associations 2026	1.0	null
hippocampus (hippocampal formation)_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.872354
ADD3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE48812_9_v_6_sulforaphane_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ZDHHC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05381
ZBTB7A_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TMED10	Pathway Commons Protein-Protein Interactions	1.0	null
TOM1	Pathway Commons Protein-Protein Interactions	1.0	null
YD15	CCLE Cell Line Gene CNV Profiles	1.0	1.95536
endocrine gland	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
STAT5-23275557-MAMMARY-EPITHELIUM-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
CSNK2A2	Pathway Commons Protein-Protein Interactions	1.0	null
wm115	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
abnormality of the lung	GWASdb SNP-Phenotype Associations	1.0	0.169511
XPOT	Pathway Commons Protein-Protein Interactions	1.0	null
POLR2AphosphoS5_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KLC2	Pathway Commons Protein-Protein Interactions	1.0	null
NCI-H2461	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.900029
ARL15	Pathway Commons Protein-Protein Interactions	1.0	null
EXOC2	Pathway Commons Protein-Protein Interactions	1.0	null
motor neuron atrophy	GWASdb SNP-Phenotype Associations	1.0	0.510092
H3K4me3_cardiac mesoderm_hg19_5	ENCODE Histone Modification Site Profiles	1.0	null
MYO18A	Pathway Commons Protein-Protein Interactions	1.0	null
DYNC1H1	Pathway Commons Protein-Protein Interactions	1.0	null
TCF4	ChEA Transcription Factor Targets	1.0	null
MAX_A549_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF263	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	48.0025
umbilicalcord	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.23083
EZH2	ENCODE Transcription Factor Targets	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A2RM-01A-21R-A18M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ACSL3	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of cell communication	GO Biological Process Annotations 2015	1.0	null
RHOU	Pathway Commons Protein-Protein Interactions	1.0	null
PITPNA	Pathway Commons Protein-Protein Interactions	1.0	null
FLI1	ChEA Transcription Factor Targets	1.0	null
Perturb_15641_KO_Shh_ERP023558	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.92839
SOX2-21211035-LN229-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
UCSD-242L	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.39409
GSE174701_4_v_7_maml3_human	RummaGEO Gene Perturbation Signatures	-1.0	null
HAX1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE131649_2_v_3_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Nephritis	CTD Gene-Disease Associations	1.0	1.11466
PMC8764619-mmc7.xlsx-supplementary_table_for_the_Ven-GSE131737_TFAP2B_target_genes_H_sapiens_970_TFAP2B	Rummagene Transcription Factor Associations 2026	1.0	null
H3K27me3_Colonic Mucosa	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
ZNF281	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	285.258
Bladder Urothelial Carcinoma_BLCA_TCGA-XF-A8HH-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
abnormality of the immune system	GWASdb SNP-Phenotype Associations	1.0	0.06787
COR-L279	Sanger Dependency Map Cancer Cell Line Proteomics	-1.0	-2.82191
ATP6V1E1	Pathway Commons Protein-Protein Interactions	1.0	null
Neoplasms	CTD Gene-Disease Associations	1.0	1.03345
NKX2-5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.5775
STXBP3	Pathway Commons Protein-Protein Interactions	1.0	null
SH3BP1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A.TP53.M_24H:E17	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.5172
RANBP17	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-A4CI-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KRAS	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_megakaryocyte_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
GSE118939_1_v_0_nras_human	RummaGEO Gene Perturbation Signatures	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-FG-A711-01A-21R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EIF2B1	Pathway Commons Protein-Protein Interactions	1.0	null
17312329-SuppTable2	GeneSigDB Published Gene Signatures	1.0	null
COPE	Pathway Commons Protein-Protein Interactions	1.0	null
MAX_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HN-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF354A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	80.9945
b220.bcell	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.8639
LN-18	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.848975
OVCA 432	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.26544
NFIC_ECC-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me3_spleen_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
496100659_PCx_no dementia_no TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.10204
Skin Cutaneous Melanoma_SKCM_TCGA-FW-A3TU-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5084-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN010_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.36308
GNAI3	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN009_HEPG2_24H:M19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.0034
GSE132694,GSE132717_0_v_2_meis1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
18787218-tableS1	GeneSigDB Published Gene Signatures	1.0	null
striatum_19 pcw_F_12885	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.88382
mRNA_ESRRB_16767105	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
H3K4me3_Caco-2_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
RAB21	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN008_HEPG2_24H:C21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.36142
H3K4me3_kidney epithelial cell_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN010_HEPG2_24H:C20	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.62171
GNPAT	Pathway Commons Protein-Protein Interactions	1.0	null
breast	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
SP in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.850598
intracellular membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
U266B1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.56441
OSBPL8	Pathway Commons Protein-Protein Interactions	1.0	null
FAN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25011
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A700-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SK-N-AS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.56552
E2F8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.0456
PHLDB1	Pathway Commons Protein-Protein Interactions	1.0	null
Intestinal disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.128
corpus callosum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.22513
GSE239844_11_v_10_crizotinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K4me2_keratinocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CCDC80	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17888
ZNF143_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H1_BMP4_Derived_Trophoblast_Cultured_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.03704
CRCGN017_MCF10A.WT.HP_24H:J07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.33122
LCAM1	DepMap CRISPR Gene Dependency	1.0	2.47297
H3K4me1_erythroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
positive regulation of mapk cascade	GO Biological Process Annotations 2015	1.0	null
GSE229468,GSE229471_0_v_3_znf587_human	RummaGEO Gene Perturbation Signatures	1.0	null
G3BP1	Pathway Commons Protein-Protein Interactions	1.0	null
TEX13B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99697
TE-8	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CRCGN013_HEPG2_24H:I13	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.61611
EPLC272H	CCLE Cell Line Gene CNV Profiles	1.0	1.34146
Lung adenocarcinoma_LUAD_TCGA-78-7166-01A-12R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Zfx	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	40.7536
deep layers of rostral entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.952302
prostate cancer	GWASdb SNP-Disease Associations	1.0	0.770158
OSBPL3	Pathway Commons Protein-Protein Interactions	1.0	null
pilus	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.27998
cell part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
H3K4me3_CH12.LX_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
alcohol-induced mental disorder	GWASdb SNP-Disease Associations	1.0	1.10764
GRTP1	Pathway Commons Protein-Protein Interactions	1.0	null
ALDH6A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.41194
GSE169356_2_v_1_ivermectin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
AGK	Pathway Commons Protein-Protein Interactions	1.0	null
positive regulation of catalytic activity	GO Biological Process Annotations 2015	1.0	null
gastrointestinal tract	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
TCF4-23295773-U87-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
MYC	ENCODE Transcription Factor Targets	1.0	null
SEC23A	Pathway Commons Protein-Protein Interactions	1.0	null
adenocarcinoma cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.225144
Cervical cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.233
reproductive organ cancer	GWASdb SNP-Disease Associations	1.0	0.230508
KMS-28BM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.19354
Acute Myeloid Leukemia_LAML_TCGA-AB-2995-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HLA-A	Pathway Commons Protein-Protein Interactions	1.0	null
Sarcoma_SARC_TCGA-FX-A2QS-11A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Spi1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	39.1042
GSE212330_1_v_0_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5KV-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN013_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	7.5461
SARS-CoV MA15_Day4-PFU-10^4_None_GSE33266	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	1.45735
NSDHL	Pathway Commons Protein-Protein Interactions	1.0	null
GSE223893_11_v_10_setd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
BLOC1S5	Pathway Commons Protein-Protein Interactions	1.0	null
PMC8858874-NIHMS1764275-supplement-Supplemental_Table_2.xlsx-R1_SOX2_bound_genes_5000bp_6-9--Nearest_Ensembl_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
disease of mental health	GWASdb SNP-Disease Associations	1.0	0.117829
eeg abnormality	GWASdb SNP-Phenotype Associations	1.0	0.969142
BLOC1S2	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_bronchial epithelial cell_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CTCFL	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	47.0105
FST	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05054
H3K4me1_testis_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
NBPF12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.72163
UBAC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36888
EXOC4	Pathway Commons Protein-Protein Interactions	1.0	null
viscus	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
jurkat cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.393819
Liver hepatocellular carcinoma_LIHC_TCGA-ED-A82E-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung Diseases	CTD Gene-Disease Associations	1.0	1.08231
PRDM14-21183938-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
CRCGN013_HEPG2_24H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.67108
regulatory	GeneRIF Biological Term Annotations	1.0	null
SDE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8462
dorsal subdivision of VLC	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.60109
abnormality of the male genitalia	GWASdb SNP-Phenotype Associations	1.0	0.220074
GSE135030_3_v_2_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TSPAN8	Pathway Commons Protein-Protein Interactions	1.0	null
VAV3	Pathway Commons Protein-Protein Interactions	1.0	null
SK-MEL-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.67136
GSE119978,GSE180930_0_v_4_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
structures	GeneRIF Biological Term Annotations	1.0	null
PRKCD	Pathway Commons Protein-Protein Interactions	1.0	null
PPP1CB	Pathway Commons Protein-Protein Interactions	1.0	null
TST	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.02016
NKX2-4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.82
TMEM109	Pathway Commons Protein-Protein Interactions	1.0	null
layer IIIu of area 35r	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.948886
PROP1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	42.9872
GNA11	Pathway Commons Protein-Protein Interactions	1.0	null
RAB5B	Pathway Commons Protein-Protein Interactions	1.0	null
Excretory gland	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
ARL2	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-Q1-A73S-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF669	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.475
Liver hepatocellular carcinoma_LIHC_TCGA-FV-A3I0-01A-11R-A22L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IGFBP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.14504
prostate gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.064242
21152935-TableS2	GeneSigDB Published Gene Signatures	1.0	null
LNCAP-CLONE-FGC	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NCI-H441	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
pituitary	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-1.31531
GSE119978,GSE180930_0_v_7_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NCI-H2196	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.864707
GBAS	Pathway Commons Protein-Protein Interactions	1.0	null
ANXA9	Pathway Commons Protein-Protein Interactions	1.0	null
GSE119978,GSE180930_0_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HS578T	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.50882
GOLPH3	Pathway Commons Protein-Protein Interactions	1.0	null
Nasopharyngeal cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.678
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A63T-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE145639_7_v_4_adar_human	RummaGEO Gene Perturbation Signatures	-1.0	null
A704	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ARFGEF1	Pathway Commons Protein-Protein Interactions	1.0	null
MAFK_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
leukemia cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.082864
H3K27me3_thymus_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
YY1_HCT116_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE182179_0_v_3_kdsr_human	RummaGEO Gene Perturbation Signatures	-1.0	null
RAB20	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_Caco-2_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
S117	DepMap CRISPR Gene Dependency	1.0	2.57503
CANX	Pathway Commons Protein-Protein Interactions	1.0	null
COPG1	Pathway Commons Protein-Protein Interactions	1.0	null
interacts	GeneRIF Biological Term Annotations	1.0	null
WIDR	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850089
H3K4me3_Mobilized CD34 Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
thorax	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.092921
NB10	COSMIC Cell Line Gene Mutation Profiles	1.0	null
STX12	Pathway Commons Protein-Protein Interactions	1.0	null
molecular_function	GO Molecular Function Annotations 2015	1.0	null
TAP2	Pathway Commons Protein-Protein Interactions	1.0	null
ONECUT1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.8116
GSE178714_5_v_0_smad2_human	RummaGEO Gene Perturbation Signatures	1.0	null
abnormality of immune system physiology	GWASdb SNP-Phenotype Associations	1.0	0.114619
RNF14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.49322
AP3S1	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-QK-A6II-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-78-7158-01A-11R-2039-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAD21_CH12.LX_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CRCGN014_HEPG2_24H:M15	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.2666
COPB2	Pathway Commons Protein-Protein Interactions	1.0	null
kidney	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
layer I of piriform cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.848964
GSE187006_0_v_1_valproic acid_human	RummaGEO Drug Perturbation Signatures	1.0	null
CCK81	DepMap CRISPR Gene Dependency	1.0	3.76739
17880687-TableS3	GeneSigDB Published Gene Signatures	1.0	null
GSE149035_2_v_0_hepacam_human	RummaGEO Gene Perturbation Signatures	1.0	null
dorsolateral prefrontal cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.82721
SEPT11	Pathway Commons Protein-Protein Interactions	1.0	null
SHISAL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5434
Infertility, Female	CTD Gene-Disease Associations	1.0	1.0637
AR	ChEA Transcription Factor Targets	1.0	null
muscle	GTEx Tissue Gene Expression Profiles	-1.0	-1.06499
PGAM1	Pathway Commons Protein-Protein Interactions	1.0	null
abnormality of the coronary arteries	GWASdb SNP-Phenotype Associations	1.0	0.256313
H3K27me3_megakaryocyte_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MCM2	Pathway Commons Protein-Protein Interactions	1.0	null
all	GWASdb SNP-Phenotype Associations	1.0	0.067896
ADPRS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.42191
obesity	GWASdb SNP-Disease Associations	1.0	0.693397
PTPN9	Pathway Commons Protein-Protein Interactions	1.0	null
CDC42	Pathway Commons Protein-Protein Interactions	1.0	null
YY1_HCT116_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE230263,GSE230265_3_v_1_runx1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Perturb_17570_KD_Tead4_SRP089678	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-14.9117
H3K4me1_K562_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CAKI2	DepMap CRISPR Gene Dependency	1.0	4.79701
RBX1	Pathway Commons Protein-Protein Interactions	1.0	null
SMAD2	Pathway Commons Protein-Protein Interactions	1.0	null
USH1C	Pathway Commons Protein-Protein Interactions	1.0	null
negative regulation of intracellular transport	GO Biological Process Annotations 2023	1.0	null
Lung Neoplasms	CTD Gene-Disease Associations	1.0	1.01663
H4K20me1_astrocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
FAM21A	Pathway Commons Protein-Protein Interactions	1.0	null
SLC30A9	Pathway Commons Protein-Protein Interactions	1.0	null
testis	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.900232
ATP6V1C1	Pathway Commons Protein-Protein Interactions	1.0	null
MVP	Pathway Commons Protein-Protein Interactions	1.0	null
posteroventral (inferior) parietal cortex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.06985
ETHE1	Pathway Commons Protein-Protein Interactions	1.0	null
SGPL1	Pathway Commons Protein-Protein Interactions	1.0	null
dorsolateral prefrontal cortex_13 pcw_M_12820	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.15886
CSNK1D	Pathway Commons Protein-Protein Interactions	1.0	null
POU5F1	ChEA Transcription Factor Targets	1.0	null
hsa-miR-3652	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
RBM34_02_121	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	4.80735
SEPT2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE213650_3_v_2_everolimus_human	RummaGEO Drug Perturbation Signatures	-1.0	null
SK-MEL-31	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.946791
Fetal Death	CTD Gene-Disease Associations	1.0	1.07128
biological regulation	GO Biological Process Annotations 2015	1.0	null
EIF2B3	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3427-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE140965_1_v_4_mybpc3_human	RummaGEO Gene Perturbation Signatures	1.0	null
DCTN3	Pathway Commons Protein-Protein Interactions	1.0	null
YTHDC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27574
GSE188570,GSE188571_3_v_4_decitabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
posteroventral (inferior) parietal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.09557
H3K4me3_H1-hESC_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE176008_8_v_1_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K4me1_heart_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
H2AFZ_astrocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
positive regulation of signaling	GO Biological Process Annotations 2015	1.0	null
CACYBP	Pathway Commons Protein-Protein Interactions	1.0	null
GSE195663_7_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
SNU-638 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.135
PMC6145927-41467_2018_5729_MOESM6_ESM.xlsx-TF_Activity_Genesets-Larsen_ZEB1_DN_ZEB1	Rummagene Transcription Factor Associations 2026	1.0	null
mediodorsal nucleus of thalamus_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.21048
GOLPH3L	Pathway Commons Protein-Protein Interactions	1.0	null
H3K27ac_H1	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
negative regulation of endocytic recycling	GO Biological Process Annotations 2025	1.0	null
orbital frontal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.87851
PHF8_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
EZH2_fibroblast of dermis_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
UBIAD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.20569
COPZ1	Pathway Commons Protein-Protein Interactions	1.0	null
CHMP4B	Pathway Commons Protein-Protein Interactions	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-J4-A83J-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
animal	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.53602
Disease of anatomical entity	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.234
cytoplasmic part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
Lung squamous cell carcinoma_LUSC_TCGA-37-A5EN-01A-21R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ATP6V1A	Pathway Commons Protein-Protein Interactions	1.0	null
17880687-TableS1	GeneSigDB Published Gene Signatures	1.0	null
H3K4me1_CH12.LX_mm9_4	ENCODE Histone Modification Site Profiles	1.0	null
Vesicle coat	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.097
inferior olive, medial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.36029
17880687-TableS2	GeneSigDB Published Gene Signatures	1.0	null
A-VN-1203-2004(H5N1)_Day1-10^4pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.61829
TJP2	Pathway Commons Protein-Protein Interactions	1.0	null
EPLC-272H	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.30486
ALLSIL	CCLE Cell Line Gene CNV Profiles	-1.0	-1.55771
H3118	DepMap CRISPR Gene Dependency	1.0	15.7271
E2F1	ChEA Transcription Factor Targets	1.0	null
whole body	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.23362
IQGAP3	Pathway Commons Protein-Protein Interactions	1.0	null
central nervous system disease	GWASdb SNP-Disease Associations	1.0	0.091359
ANXA1	Pathway Commons Protein-Protein Interactions	1.0	null
ZFP62	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.19668
RMND1	Pathway Commons Protein-Protein Interactions	1.0	null
cytoplasm	GO Cellular Component Annotations 2015	1.0	null
CRCGN015_MCF10A.TP53.M_24H:L09	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.51658
hsa-miR-4480	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
CRCGN011_HEPG2_24H:G14	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.8962
PDGF signaling pathway	PANTHER Pathways	1.0	null
JUND_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBC1D15	Pathway Commons Protein-Protein Interactions	1.0	null
skeletalmuscle_d	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38407
HCC1419	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.794883
Diabetes Mellitus, Type 2	HuGE Navigator Gene-Phenotype Associations	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-85-8052-01A-11R-2247-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BLOC1S6	Pathway Commons Protein-Protein Interactions	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A3HE-01A-21R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE147366_1_v_4_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
20436685-ST4-1	GeneSigDB Published Gene Signatures	1.0	null
parasolitary nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.66564
GSE202434,GSE202438_4_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
intracellular organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.049932
PMC2263127-pone.0001816.s001.xls-E2F3_down_Bild-Symbol_E2F3	Rummagene Transcription Factor Associations 2026	1.0	null
GSE128730_3_v_5_neratinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
cell part	GO Cellular Component Annotations 2015	1.0	null
PLEK2	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN015_MCF10A.WT.HP_24H:P23	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.21123
H3K9ac_ES-Bruce4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
ADAP1	Pathway Commons Protein-Protein Interactions	1.0	null
U-937	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.17334
Arsenic	CTD Gene-Chemical Interactions	1.0	null
MYC_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE202434,GSE202438_3_v_11_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
LRCH4	Pathway Commons Protein-Protein Interactions	1.0	null
PPP2R2A	Pathway Commons Protein-Protein Interactions	1.0	null
RAC3	Pathway Commons Protein-Protein Interactions	1.0	null
HCC1395	DepMap CRISPR Gene Dependency	1.0	2.18406
Acute Myeloid Leukemia_LAML_TCGA-AB-2891-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE239844_6_v_2_crizotinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GDI2	Pathway Commons Protein-Protein Interactions	1.0	null
NCIH1694	CCLE Cell Line Gene CNV Profiles	-1.0	-1.38851
GSE125862_2_v_0_dexamethasone_human	RummaGEO Drug Perturbation Signatures	1.0	null
CRCGN015_HEPG2_48H:H01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.54994
H3K4me3_cardiac mesoderm_hg19_6	ENCODE Histone Modification Site Profiles	1.0	null
MITF-21258399-MELANOMA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
kidney disease	GWASdb SNP-Disease Associations	1.0	1.13288
anterior (rostral) cingulate (medial prefrontal) cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.67694
HS 578T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.847694
HIP1R	Pathway Commons Protein-Protein Interactions	1.0	null
GSE102467_1_v_0_pazopanib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Colorectal Carcinoma	DisGeNET Gene-Disease Associations	1.0	null
CRCGN014_HEPG2_24H:J18	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	5.98855
SOX2-18692474-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
SNAI1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.1368
GATA4-25053715-YYC3-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
VPS26A	Pathway Commons Protein-Protein Interactions	1.0	null
MEF2C	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	43.0063
GSE206729_3_v_0_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
COLO679	CCLE Cell Line Gene CNV Profiles	1.0	3.2803
Signaling by Rho GTPases	Reactome Pathways 2024	1.0	null
ATP6V1G1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN017_MCF10A.WT.HP_24H:P10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.85525
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3328-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GOLT1B	Pathway Commons Protein-Protein Interactions	1.0	null
Duodenum Mucosa	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-1.04688
Ikzf3	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	30.9484
HCC1195	CCLE Cell Line Gene CNV Profiles	-1.0	-1.62136
TJP1	Pathway Commons Protein-Protein Interactions	1.0	null
epithelial cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055064
MAPK8	Pathway Commons Protein-Protein Interactions	1.0	null
endocytosis	GeneRIF Biological Term Annotations	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2920-03B-01T-0760-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MAPRE1	Pathway Commons Protein-Protein Interactions	1.0	null
LRRC59	Pathway Commons Protein-Protein Interactions	1.0	null
Kidney Chromophobe_KICH_TCGA-KO-8409-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DCLRE1C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.1061
km3	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
Disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.034
amyotrophic lateral sclerosis	GWASdb SNP-Disease Associations	1.0	0.600463
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A497-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC89	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.949134
Lung adenocarcinoma_LUAD_TCGA-55-A491-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN009_HEPG2_24H:K08	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.40266
posteroventral (inferior) parietal cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.72675
NCI-H2073	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.930502
salivarygland_6c	HPA Tissue Sample Gene Expression Profiles	1.0	1.11251
DNAJC2	ChEA Transcription Factor Targets	1.0	null
Transport vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.296
DOCK5	Pathway Commons Protein-Protein Interactions	1.0	null
COLO849	CCLE Cell Line Gene CNV Profiles	1.0	1.4388
p190	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.719
PMC9911396-41467_2023_36178_MOESM11_ESM.xlsx-Sheet1-Genes_in_10kb_vicinity_of_ZBTB12_ChIP-seq_peaks_hic_ZBTB12	Rummagene Transcription Factor Associations 2026	1.0	null
AP1G1	Pathway Commons Protein-Protein Interactions	1.0	null
prostate neoplasm	GWASdb SNP-Phenotype Associations	1.0	0.66742
PPT1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_HCT116_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CRCGN012_HEPG2_24H:D07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.02675
H3K4me3_H7_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
TLN2	Pathway Commons Protein-Protein Interactions	1.0	null
BCOR-27268052-CHIP-SEQ-BCELLS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
protein complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.330589
EXOC5	Pathway Commons Protein-Protein Interactions	1.0	null
hematopoietic cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.077311
ventrolateral prefrontal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	2.28946
NCIH1573	DepMap CRISPR Gene Dependency	1.0	2.37332
SFXN1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:F21	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.06027
AIDA	Pathway Commons Protein-Protein Interactions	1.0	null
GSE242290_1_v_8_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CRCGN015_HEPG2_48H:C19	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	4.68963
H3K4me3_lung_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
ATP6V1B2	Pathway Commons Protein-Protein Interactions	1.0	null
GSE131649_6_v_0_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
H3K4me3_cardiac mesoderm_hg19_8	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of the skeletal system	GWASdb SNP-Phenotype Associations	1.0	0.049173
dorsolateral prefrontal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	2.46254
EPCAM	Pathway Commons Protein-Protein Interactions	1.0	null
Lung adenocarcinoma_LUAD_TCGA-78-7147-01A-11R-2039-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRCGN009_HEPG2_24H:H03	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.33335
Prostate adenocarcinoma_PRAD_TCGA-KK-A7AQ-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RTN3	Pathway Commons Protein-Protein Interactions	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A71A-01A-22R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE125219,GSE125221_3_v_8_arid1a_human	RummaGEO Gene Perturbation Signatures	1.0	null
H3K4me3_placenta_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-O2-A52N-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ventrolateral prefrontal cortex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.59116
RD	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-7752-01A-11R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TCF3-18467660-MESC-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
H3K4me1_erythroblast_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
E2F1-18555785-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Uterine disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.105
ERLIN2	Pathway Commons Protein-Protein Interactions	1.0	null
RAB6A	Pathway Commons Protein-Protein Interactions	1.0	null
BT549	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.58723
GSE161800_0_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-39-5040-01A-21R-2125-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HEC251	CCLE Cell Line Gene CNV Profiles	-1.0	-1.5174
Lung squamous cell carcinoma_LUSC_TCGA-85-A5B5-01A-21R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NANOG-16518401-MESC-mouse	ChEA Transcription Factor Binding Site Profiles	1.0	null
trans-Golgi network transport vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.424
GSE205163,GSE205164_2_v_4_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
H2AFZ_fibroblast of lung_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF558	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	126.823
HT-29	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850982
ARHGAP1	Pathway Commons Protein-Protein Interactions	1.0	null
FADU	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.59718
MAD2L1	Pathway Commons Protein-Protein Interactions	1.0	null
C20orf96	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.31843
GSE131649_6_v_11_hemin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
AR-19668381-PC3-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
OV-90	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.46062
PMPCB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.00362
anterior (rostral) cingulate (medial prefrontal) cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.18681
KIAA1033	Pathway Commons Protein-Protein Interactions	1.0	null
GIGYF2	Pathway Commons Protein-Protein Interactions	1.0	null
carcinoma cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.056212
bnip2	GeneRIF Biological Term Annotations	1.0	null
MXI1	ENCODE Transcription Factor Targets	1.0	null
H3K4me3_ES-E14_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
CLN5	Pathway Commons Protein-Protein Interactions	1.0	null
AP3D1	Pathway Commons Protein-Protein Interactions	1.0	null
ITGB4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9817
iPS-18 Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	1.96637
brain	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
A549_LUNG	CCLE Cell Line Proteomics	1.0	2.25101
anterior (rostral) cingulate (medial prefrontal) cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.24408
regulation of endocytic recycling	GO Biological Process Annotations 2025	1.0	null
MAPK14	Pathway Commons Protein-Protein Interactions	1.0	null
CHD4	Pathway Commons Protein-Protein Interactions	1.0	null
male reproductive organ cancer	GWASdb SNP-Disease Associations	1.0	0.384742
RSU1	Pathway Commons Protein-Protein Interactions	1.0	null
fetus	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
H3K4me1_placenta_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
P53-21459846-SAOS-2-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
SKG-IIIA	COSMIC Cell Line Gene Mutation Profiles	1.0	null
MAX_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GP5D	DepMap CRISPR Gene Dependency	1.0	2.0983
PPM1A	Pathway Commons Protein-Protein Interactions	1.0	null
BZW1	Pathway Commons Protein-Protein Interactions	1.0	null
GSE119978,GSE180930_0_v_8_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TBX5-21415370-HL-1-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
CTV-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
EHD4	Pathway Commons Protein-Protein Interactions	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-CF-A3MI-01A-11R-A20F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TGBC11TKB	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ARL6IP1	Pathway Commons Protein-Protein Interactions	1.0	null
epithelial cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.063899
CEBPB-22108803-LS180-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2966-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
regulation of metabolic process	GO Biological Process Annotations 2015	1.0	null
VAC14	Pathway Commons Protein-Protein Interactions	1.0	null
NFIC_ECC-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MON2	Pathway Commons Protein-Protein Interactions	1.0	null
H2AFZ_A549_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MCAS	COSMIC Cell Line Gene Mutation Profiles	1.0	null
head and face region of M1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.20667
GSE205163,GSE205164_2_v_6_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
MYC_MCF-7_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
STOML2	Pathway Commons Protein-Protein Interactions	1.0	null
Clathrin vesicle coat	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.22
CHMP5	Pathway Commons Protein-Protein Interactions	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5M9-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Rho GTPase cycle	Reactome Pathways 2014	1.0	null
regulation of intracellular signal transduction	GO Biological Process Annotations 2015	1.0	null
ATG5	Pathway Commons Protein-Protein Interactions	1.0	null
C-33-A	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTSA	Pathway Commons Protein-Protein Interactions	1.0	null
ATG3	Pathway Commons Protein-Protein Interactions	1.0	null
SKOV3	DepMap CRISPR Gene Dependency	1.0	2.43157
SNU-182	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.972569
H3K27ac_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of the systemic arterial tree	GWASdb SNP-Phenotype Associations	1.0	0.106478
COPA	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_fibroblast of skin of abdomen_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CYTH1	Pathway Commons Protein-Protein Interactions	1.0	null
TRIM62	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.20921
RHOA	Hub Proteins Protein-Protein Interactions	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_SBP_AA-SYMBOL_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
PHF8_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CX-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.850982
PCTP	Pathway Commons Protein-Protein Interactions	1.0	null
GSE239844_11_v_5_crizotinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
H3K27me3_brain_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SRF	JASPAR Predicted Transcription Factor Targets	1.0	null
Lung adenocarcinoma_LUAD_TCGA-55-8085-01A-11R-2241-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FAM129B	Pathway Commons Protein-Protein Interactions	1.0	null
ENGASE	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.02785
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-5546-01A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H1915	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.42573
plant form	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.316588
positive regulation of MAPK cascade	GO Biological Process Annotations 2025	1.0	null
ANKFY1	Pathway Commons Protein-Protein Interactions	1.0	null
STAT5A	Pathway Commons Protein-Protein Interactions	1.0	null
YKT6	Pathway Commons Protein-Protein Interactions	1.0	null
leukocyte	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.064577
GSE242290_3_v_7_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ITGA6	Pathway Commons Protein-Protein Interactions	1.0	null
FADU	DepMap CRISPR Gene Dependency	1.0	3.41665
TEC	Pathway Commons Protein-Protein Interactions	1.0	null
GSE242290_3_v_2_glutathione_human	RummaGEO Drug Perturbation Signatures	-1.0	null
diethylstilbestrol_mus musculus_gpl6887_gse37969	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
ARL5A	Pathway Commons Protein-Protein Interactions	1.0	null
TM9SF1	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_24H:G01	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.11378
lateral hemisphere of cerebellum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.17944
regulation of biological process	GO Biological Process Annotations 2015	1.0	null
DYNC1I2	Pathway Commons Protein-Protein Interactions	1.0	null
CEBPB-26923725-CHIP-SEQ-MESODERM-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.057512
ARHGAP17	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me2_osteoblast_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
NCI-H1092	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.55724
Kidney renal papillary cell carcinoma_KIRP_TCGA-GL-A9DE-11A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5469-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-MITF_Targets_enrichment-Unnamed_53_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
Perturb_4000_OE_LIN28A_SRP096196	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	2.77377
NDUFAF8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19863
SKNFI	DepMap CRISPR Gene Dependency	1.0	2.07092
496100578_FWM_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.64736
NCI-H2228	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.34014
positive regulation of ERK1 and ERK2 cascade	GO Biological Process Annotations 2025	1.0	null
FOXL1	JASPAR Predicted Transcription Factor Targets	1.0	null
mRNA_NIPBL_20720539	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
PANC1_PANCREAS	CCLE Cell Line Proteomics	1.0	3.21436
Fetal Growth Retardation	CTD Gene-Disease Associations	1.0	1.20558
RAN	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN016_MCF10A.TP53.M_24H:H10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.03085
COPB1	Pathway Commons Protein-Protein Interactions	1.0	null
gastrointestinal tract	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.052431
limitans nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.12387
cytoplasmic ribonucleoprotein granule	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.136688
HELA	COSMIC Cell Line Gene Mutation Profiles	1.0	null
EZH2_skeletal muscle myoblast_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE245270_2_v_4_isoproterenol_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NCI-H2110	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PLS1	Pathway Commons Protein-Protein Interactions	1.0	null
PANC 02.03	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02643
PTP4A1	Pathway Commons Protein-Protein Interactions	1.0	null
KYSE-30	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.972569
TRIM28	ENCODE Transcription Factor Targets	1.0	null
Lung adenocarcinoma_LUAD_TCGA-05-4410-01A-21R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VZ in septal region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.14535
SACM1L	Pathway Commons Protein-Protein Interactions	1.0	null
CASK	Pathway Commons Protein-Protein Interactions	1.0	null
RHOF	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN014_HEPG2_3H:P24	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.1613
Hepatic Cirrhosis_Liver_GSE6764	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.73021
molt4	HPA Cell Line Gene Expression Profiles	-1.0	-0.894171
Rho GTPase-activating protein domain	InterPro Predicted Protein Domain Annotations	1.0	null
GSE128730_7_v_1_neratinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
inner CP in posterosuperior (dorsal) parietal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.971403
acquired metabolic disease	GWASdb SNP-Disease Associations	1.0	0.158939
C666-1 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.718
CRCGN014_HEPG2_24H:I12	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	3.11298
CRCGN014_HEPG2_24H:L05	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.52318
blastocysts	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.49269
EPB41L2	Pathway Commons Protein-Protein Interactions	1.0	null
disease	GWASdb SNP-Disease Associations	1.0	0.070319
NMB	DepMap CRISPR Gene Dependency	1.0	3.33706
SCFD1	Pathway Commons Protein-Protein Interactions	1.0	null
respiratory system disease	GWASdb SNP-Disease Associations	1.0	0.230847
GADD45GIP1	Pathway Commons Protein-Protein Interactions	1.0	null
IQGAP2	Pathway Commons Protein-Protein Interactions	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2867-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SW 1573	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13253
TMOD3	Pathway Commons Protein-Protein Interactions	1.0	null
RRP15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17474
BT549_BREAST	CCLE Cell Line Proteomics	1.0	3.43048
urinary system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
PMC8519939-41525_2021_248_MOESM5_ESM.xlsx-E2F1_UP_V1_UP-Ensemble_gene_ID_E2F1	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me3_K562_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
LNCAP	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
ACTB	Pathway Commons Protein-Protein Interactions	1.0	null
GATA2	JASPAR Predicted Transcription Factor Targets	1.0	null
lymphoid cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.066736
CAL148	CCLE Cell Line Gene CNV Profiles	-1.0	-1.42025
GTF2F1_02_110	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.80735
CRCGN015_HEPG2_48H:O10	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	7.4723
TBX5-21415370-HL-1-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
H3K27me3_CD4+ CD25int CD127+ Tmem Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
Neuro D	MotifMap Predicted Transcription Factor Targets	1.0	null
PMC7818749-12931_2021_1617_MOESM1_ESM.xlsx-TBX4-ENSEMBL_TBX4	Rummagene Transcription Factor Associations 2026	1.0	null
VAPA	Pathway Commons Protein-Protein Interactions	1.0	null
DOPEY2	Pathway Commons Protein-Protein Interactions	1.0	null
Perturb_5353_KO_Dux_SRP201141	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	3.69198
OAW28	CCLE Cell Line Gene CNV Profiles	1.0	1.80824
ARHGAP18	Pathway Commons Protein-Protein Interactions	1.0	null
stamen	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.249006
PSAP	Pathway Commons Protein-Protein Interactions	1.0	null
EPB41L5	Pathway Commons Protein-Protein Interactions	1.0	null
CRCGN011_HEPG2_24H:K07	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	1.0	2.62195
CTCF	ENCODE Transcription Factor Targets	1.0	null
ETV2::FIGLA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.727
Nr1h4	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	16.4937
GSE114284_4_v_3_irf1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
H3K4me3_kidney_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
VPS11	Pathway Commons Protein-Protein Interactions	1.0	null
erk	GeneRIF Biological Term Annotations	1.0	null
CRCGN017_MCF10A.WT.HP_24H:I16	Carcinogenome Chemical Perturbation Carcinogenicity Signatures	-1.0	-2.13755
Prenatal Exposure Delayed Effects	CTD Gene-Disease Associations	1.0	1.45299
TPD52	Pathway Commons Protein-Protein Interactions	1.0	null
intracellular non-membrane-bounded organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.068306
ARAP3	Pathway Commons Protein-Protein Interactions	1.0	null
GSE202434,GSE202438_3_v_0_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
NIPSNAP1	Pathway Commons Protein-Protein Interactions	1.0	null
H3K4me3_LNCaP clone FGC_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
H3K4me3_HCT116_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
negative regulation of intracellular transport	GO Biological Process Annotations 2025	1.0	null
Necrosis	CTD Gene-Disease Associations	1.0	1.5619
SNU840	CCLE Cell Line Gene CNV Profiles	-1.0	-2.35145
GSE218819_3_v_4_kdm5b_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC10746608-427_2023_709_MOESM4_ESM.xlsx-SOX2_targets_enrichment-Unnamed_4_SOX2	Rummagene Transcription Factor Associations 2026	1.0	null
H3K4me1_CH12.LX_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-39-5021-01A-01R-1443-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
alimentary canal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
intestinal mucosa	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
H3K27me3_CD8 Memory Primary Cells	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null