association	dataset	threshold value	standardized value
GSE168587,GSE168752_3_v_1_tp53_human	RummaGEO Gene Perturbation Signatures	-1.0	null
MAGI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.47608
496100656_HIP_no dementia_no TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.77569
GCM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.37822
KPNA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.94249
ACSM6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.75336
MAGT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.08435
GSE216043_10_v_9_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
BIRC6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.32285
GSE169697,GSE169725_0_v_5_prrx1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
TRAPPC11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.43829
hsa-miR-4693-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
SET-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.81466
TM9SF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58121
496100523_HIP_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.23893
SNU886	DepMap CRISPR Gene Dependency	1.0	2.54753
MBTD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.93107
RERF-GC-1B	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.99775
496100527_FWM_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	8.62231
hsa-miR-4784	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
ENDOV	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.52217
MTX3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04261
ASIC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.0026
KCI-MOH1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.61391
GSE228263_0_v_1_elesclomol_human	RummaGEO Drug Perturbation Signatures	1.0	null
CCT7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91454
hsa-miR-3175	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
PSMG3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.1112
NDUFC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54367
MYBBP1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.29082
EEF1G	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	9.33216
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-ETV4_ETV4	Rummagene Transcription Factor Associations 2026	1.0	null
PEAK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.02988
POLR2M	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80952
ESRP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.2372
UQCRHL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57763
SNU601	CCLE Cell Line Gene CNV Profiles	1.0	1.87141
ATP6V1D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.12517
TOMM40L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.64408
PMC7592539-12885_2020_7456_MOESM4_ESM.xlsx-Sup_TableS3_LMS_del_genes_conf-19q13_43_TP63	Rummagene Transcription Factor Associations 2026	1.0	null
ZNF565	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57781
GSE226408_1_v_0_inpp4b_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Mitotic arrest phase fetal germ cell_Fetal gonad_Human	CellMarker Gene-Cell Type Associations	1.0	null
GSE76425_0_v_12_lenalidomide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HCC1897	CCLE Cell Line Gene CNV Profiles	1.0	1.34877
hsa-miR-3158-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
NCI-H1581	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.4869
MDAMB157	CCLE Cell Line Gene CNV Profiles	-1.0	-2.16594
NUP205	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59674
RAP1GAP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.37367
REV3L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.27738
496100494_HIP_no dementia_TBI_100+_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	5.75625
WASF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.42463
KIF22	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.13555
NAPG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63197
GSE89032,GSE89033_0_v_1_sfpq_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
TBX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.07487
TDRD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.80837
CARD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16943
CST6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21742
hsa-miR-765	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
CERCAM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.31329
FAM234A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8363
PPP6R2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.13538
LMO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.55446
CCDC66	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.0092
hsa-miR-4270	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
SVBP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8157
POLA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19987
DNAJB11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.09537
NCAPD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38134
GSE201042_2_v_1_ptpmt1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
MARK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.16632
COLO-704	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.936702
GSE161170,GSE161268_1_v_3_med1_human	RummaGEO Gene Perturbation Signatures	1.0	null
TAFAZZIN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.10136
ITGB5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23914
RBM28	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.13269
GSE216043_3_v_2_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NCIH1781	CCLE Cell Line Gene CNV Profiles	-1.0	-1.51728
Male reproductive system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.093
Gene expression (Transcription)	Reactome Pathways 2024	1.0	null
GSE77108_5_v_1_saha_human	RummaGEO Drug Perturbation Signatures	1.0	null
HEXA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.01623
TIMM8B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37726
HCC1534	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.846623
HAND1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.004
EPC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.40882
RI1	CCLE Cell Line Gene CNV Profiles	1.0	1.79938
CABP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.15665
MPDZ	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.75089
ENTREP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32157
MICU2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.81416
GSE240344_1_v_0_uxs1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE160304,GSE163392_7_v_3_zswim8_human	RummaGEO Gene Perturbation Signatures	1.0	null
MKNK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0734
PC-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04093
ARMCX5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.22124
HCC202	CCLE Cell Line Gene CNV Profiles	1.0	1.37303
ICC108	DepMap CRISPR Gene Dependency	1.0	2.19597
A498	CCLE Cell Line Gene CNV Profiles	1.0	1.34012
LCLC-97TM1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.06341
HCC4011	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02844
GNL3L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.60619
IPPK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.22585
EIF3G	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55363
KYAT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.34392
DAD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53379
COG4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63687
TLE5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.99414
GGPS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27174
MAPRE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.38456
PFDN6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.01666
GSE77108_3_v_9_saha_human	RummaGEO Drug Perturbation Signatures	1.0	null
NCIH1339	CCLE Cell Line Gene CNV Profiles	1.0	1.40714
HYLS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.35208
DNAJB14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21288
hsa-miR-3605-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
CHERP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	6.34711
VDAC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.31404
DPAGT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53727
GSE140997_10_v_1_nsun6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
SNU-484	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.06341
SRP14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27218
496100651_FWM_probable Alzheimer's disease_TBI_83_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.23674
PMC8709578-elife-69843-supp4.xlsx-HSF1_ChIP-seq_peaks-Gene_Name_HSF1	Rummagene Transcription Factor Associations 2026	1.0	null
DYNC1H1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.67025
HCC1195	CCLE Cell Line Gene CNV Profiles	-1.0	-2.69886
TRIB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.23295
COX14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.67985
NCI-H820	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.01779
KP-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02735
PMC12619835-41467_2025_66007_MOESM8_ESM.xlsx-Classical_KLF5_peaks-Nearest_Ensembl_1_KLF5	Rummagene Transcription Factor Associations 2026	1.0	null
COPS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.00017
PEPD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84401
SNU878	CCLE Cell Line Gene CNV Profiles	1.0	1.75158
WDR44	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.62421
MMS22L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25164
SMO	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21011
OV-90	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.08308
GSE140997_4_v_3_nsun6_human	RummaGEO Gene Perturbation Signatures	1.0	null
GINS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37873
TIMM44	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2015
ASCC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.40659
ASPRV1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52734
GSE200673,GSE200691_2_v_0_hmga2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
NCI-H1623	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.47591
NCIH526	CCLE Cell Line Gene CNV Profiles	1.0	1.3325
NCIH650	DepMap CRISPR Gene Dependency	1.0	2.40825
NDEL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.84851
NCI-H1437	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02735
UACC893	DepMap CRISPR Gene Dependency	1.0	4.90379
C1orf54	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93747
EEF1AKMT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82147
GSE241701_4_v_0_daxx_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
CCER2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37313
HOXD13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.82436
T3M3	DepMap CRISPR Gene Dependency	1.0	8.32035
GSE200673,GSE200691_2_v_3_hmga2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
MPST	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.16066
MAK16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57451
SUPT6H	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68747
HS 746T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.00183
H2BK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.38572
GSE234289_5_v_2_rfx6_human	RummaGEO Gene Perturbation Signatures	1.0	null
UQCC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.94407
FZD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.86199
HOXB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.1083
T-47D	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02844
PMC12619835-41467_2025_66007_MOESM8_ESM.xlsx-Classical_KLF5_peaks-Gene_Name_1_KLF5	Rummagene Transcription Factor Associations 2026	1.0	null
XPO6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23498
JMSU1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.60078
HCC78	CCLE Cell Line Gene CNV Profiles	1.0	1.70096
NCIH2170	CCLE Cell Line Gene CNV Profiles	1.0	1.72147
SKNDZ	CCLE Cell Line Gene CNV Profiles	-1.0	-1.64468
RERF-LC-OK	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20947
ECHDC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.28919
OCI-LY-10	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.45217
SU8686	CCLE Cell Line Gene CNV Profiles	-1.0	-1.32038
TK	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.949848
UPF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.27864
MDA-MB-157	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.54008
GSE77108_3_v_1_saha_human	RummaGEO Drug Perturbation Signatures	1.0	null
PLPPR3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.02208
LN18	CCLE Cell Line Gene CNV Profiles	-1.0	-2.10321
hsa-miR-3660	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
ZNF100	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91008
CAMA1	CCLE Cell Line Gene CNV Profiles	1.0	1.50073
SCC-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.3021
C8166	DepMap CRISPR Gene Dependency	1.0	2.55549
RGPD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.12356
A172	CCLE Cell Line Gene CNV Profiles	-1.0	-1.78116
SMU1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5462
CKAP2L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.28762
PMC8020666-pnas.2015855118.sd09.xlsx-LPS_24_human_DRSG_higherRes-Hg_gene_id_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
LRRC73	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.14328
FAM177A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63757
CTNND1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.73377
SFXN5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.90553
HS 936.T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.46471
IRAK4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.21133
SNU-601	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.23306
HMGN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.368
hsa-miR-4659a-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
HMGCS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88413
CHST10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.60999
496100489_HIP_possible Alzheimer's disease_no TBI_100+_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.54743
RBAK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.67965
NCI-H716	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894756
GSE201309_5_v_3_matrine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE140997_4_v_6_nsun6_human	RummaGEO Gene Perturbation Signatures	1.0	null
MFM-223	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.85268
TIPIN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45584
NCI-H1975	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02735
SCN4A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18705
ANKIB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96985
CAMA-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.25338
SAR1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.37969
GSE131649_2_v_0_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
DCHS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4518
NPIPA5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.50428
APLP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36351
G96	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38685
HCC202	DepMap CRISPR Gene Dependency	1.0	6.76916
CNTROB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.28289
TENT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.32226
EIF3D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56231
CCDC18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35157
TEAD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.17686
GSE236437_0_v_3_aldosterone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NCI-H187	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.949848
hsa-miR-3614-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
TOMM20	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63295
IFITM3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36908
PMC8020666-pnas.2015855118.sd11.xlsx-LPS_attenuatedResponse-Unnamed_1_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
ERCC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94803
RRP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.07502
EFM-19	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.61391
NUP153	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88766
JAGN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21498
hsa-miR-1256	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
CA12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79967
hsa-miR-1273g	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
TPP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.54361
KRAS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45851
TMD8	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	3.19232
hsa-miR-4656	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
HCC827	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.960595
BLZF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.06383
MAPK8IP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.09305
NR2E1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.20834
HAUS7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48106
NCIH2286	CCLE Cell Line Gene CNV Profiles	-1.0	-1.64848
MAX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.25607
GSE149264,GSE149267_4_v_3_trp53_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
NCI-H1299	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13607
RMUG-S	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.46478
ROS50	DepMap CRISPR Gene Dependency	1.0	22.6916
Male infertility	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.787
hsa-miR-4685-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
hsa-miR-4675	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
HCC78	DepMap CRISPR Gene Dependency	1.0	3.44736
XYLT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64281
RNASE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2575
DLX3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.85336
NCOR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.735
hsa-miR-4651	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
NHLRC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.20928
KP4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.28608
GSE246716_0_v_1_trappc1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
UBE2W	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.9113
NCI-H1092	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20947
PSORS1C2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.58207
CDK5RAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.78478
hsa-miR-764	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
MRPL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.10517
GRPEL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41942
MRPL57	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85427
VAMP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.82427
CES3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.462
D542MG	DepMap CRISPR Gene Dependency	1.0	2.46561
GSE201309_1_v_0_matrine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ZDHHC6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.25148
ING3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75695
PALM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49255
NCSTN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.08746
RPS19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22492
LS1034	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.883149
PNMA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.33087
GSE198165,GSE198166_8_v_4_zfp266_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
TMEM19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2618
ZCCHC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41303
hsa-miR-491-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
WM88	DepMap CRISPR Gene Dependency	1.0	2.98146
TXNL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.26147
TMEM106A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.18725
496100376_FWM_probable Alzheimer's disease_TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.02019
NCI-H23	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02844
MED21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.71488
HT1376	CCLE Cell Line Gene CNV Profiles	-1.0	-1.4501
GSE131377_1_v_0_spocd1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
ZNF384	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.20175
OVSAHO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.960595
GSE160304,GSE163392_2_v_3_zswim8_human	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-296-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
BAZ2A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.37372
S100A4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.30582
NCI-H1573	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.31827
ATP6V0D1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.23053
NCI-H146	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.11346
ZNF536	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.06449
AGS	CCLE Cell Line Gene CNV Profiles	1.0	1.60013
Spermatogonial cell_Testis_Human	CellMarker Gene-Cell Type Associations	1.0	null
GSE140997_2_v_1_nsun6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
hsa-miR-1587	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
MEC1	CCLE Cell Line Gene CNV Profiles	-1.0	-2.10392
MRPS31	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17554
FABP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08564
496100586_HIP_no dementia_no TBI_89_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.16275
TAB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.52775
GSE241701_1_v_0_daxx_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
PSMB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.24695
ALKAL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.09428
CHAGO-K-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.3021
CD37	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88773
hsa-miR-3150b-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
NTERA-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.829636
C20orf96	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.51809
GSE182770,GSE182784_0_v_1_chd2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ADM5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.37898
CDK10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03474
SNU886	CCLE Cell Line Gene CNV Profiles	1.0	1.38141
RTL6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.20041
LITAF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.43584
496100508_PCx_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.52706
MTRF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.48474
TRAPPC2L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.12221
NCIH1993	DepMap CRISPR Gene Dependency	1.0	2.14458
MTREX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36363
COPS4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9512
JEKO1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.60626
hsa-miR-299-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
FKRP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.363
RINT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77366
PRPF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.89215
TPRX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.39474
ONS76	CCLE Cell Line Gene CNV Profiles	-1.0	-1.54971
spleen	HPA Tissue Protein Expression Profiles	1.0	0.78692
TDRD12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8689
NBDY	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.31018
XPR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.09316
GSE123502,GSE123504_1_v_0_chd4_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
FAF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.18151
DGKA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.25489
SUGT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.46343
PMC7041704-JEM_20180649_TableS1.xlsx-shared_LPS_downregulated_genes-Unnamed_7_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
GSE201309_5_v_7_matrine_human	RummaGEO Drug Perturbation Signatures	1.0	null
ZNF773	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.29087
TP63	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.01446
SMIM19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.24732
SMC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.61464
LZTS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27309
SELENOH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66106
PFN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.05981
496100333_FWM_probable Alzheimer's disease_no TBI_79_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.04986
PODXL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94225
LS123	CCLE Cell Line Gene CNV Profiles	1.0	1.65765
GCIY	CCLE Cell Line Gene CNV Profiles	1.0	2.5075
EPS15L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.85218
hsa-miR-3151	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
U-2932	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.81693
496100317_FWM_no dementia_no TBI_81_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.64218
GSE76425_0_v_7_lenalidomide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ARPC1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5643
GSE149264,GSE149267_4_v_5_trp53_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DNAJA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.14201
UNK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.09307
GSE241701_2_v_3_daxx_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
NCI-H345	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.829636
PMC7041704-JEM_20180649_TableS1.xlsx-shared_LPS_downregulated_genes-Unnamed_6_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
TIGAR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.94669
496100412_FWM_possible Alzheimer's disease_TBI_87_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.1664
UGT3A2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.04884
496100562_FWM_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.12091
MIA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.16853
HPAFII	DepMap CRISPR Gene Dependency	1.0	2.44789
NIHOVCAR3	CCLE Cell Line Gene CNV Profiles	-1.0	-1.45177
HNRNPH3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0539
KARPAS-422	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.41494
HCC202	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.19887
ENTR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.21366
GSN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.20435
GSE216043_10_v_8_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
AGS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.3021
COLO 699	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.46471
RNPEPL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46033
prostate	HPA Tissue Protein Expression Profiles	1.0	1.25759
GSE171401_1_v_0_adnp_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GSE153871_4_v_2_cytarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
Azoospermia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.714
POLDIP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.10398
RMUGS	CCLE Cell Line Gene CNV Profiles	1.0	1.79212
NCIH2087	CCLE Cell Line Gene CNV Profiles	-1.0	-2.78591
LN-18	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-3.00911
496100478_HIP_dementia_TBI_86_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	5.89635
PRRG3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45523
GSE234514,GSE234516_2_v_3_palbociclib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PTGR3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.50406
NCIH1581	CCLE Cell Line Gene CNV Profiles	-1.0	-1.48847
chr19_51390748_CCTCAGACCCAGGAGTCCAGATCCCCAGCTCCTCCTCG_C_b38	GTEx eQTL 2025	1.0	1.61739
Epigenetic regulation of gene expression	Reactome Pathways 2024	1.0	null
hsa-miR-3170	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
GSE131649_6_v_7_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GALM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.28381
MKX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.94256
PRSS16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.20176
ZNF433	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.44264
RI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.20318
PTRH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.19992
SPSB4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.53727
INTS14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.47597
NCI-H522	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.42432
GSE173873_2_v_13_stra8_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GSE131649_6_v_3_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
PRRG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.26731
ENOPH1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.72579
hsa-miR-4526	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
L1236	DepMap CRISPR Gene Dependency	1.0	2.5433
hsa-miR-3197	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
PMC8020666-pnas.2015855118.sd09.xlsx-LPS_4_chimp_DRSG_higherRes-Hg_gene_id_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
SARAF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.28838
HDMYZ	DepMap CRISPR Gene Dependency	1.0	2.06165
OVCA 420	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.47591
GSE226316_11_v_2_tead2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
SYNGR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57479
FIGNL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.43364
HGC-27	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38685
MITD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.84647
PPP4C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05833
hsa-miR-651	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
GSE217685_0_v_1_ddx20_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-4725-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
GSE107505_1_v_2_nanog_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
MRNIP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41711
NCO2	CCLE Cell Line Gene CNV Profiles	1.0	1.37886
Regulation of endogenous retroelements	Reactome Pathways 2024	1.0	null
NIH:OVCAR-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.87055
DENND10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.58587
ZR-75-30	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.02683
chr19_51390101_G_C_b38	GTEx eQTL 2025	1.0	1.02211
SNU-719	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.87113
DDX46	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.14252
GSE140997_4_v_8_nsun6_human	RummaGEO Gene Perturbation Signatures	1.0	null
HIVEP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.35464
SNU5	DepMap CRISPR Gene Dependency	1.0	2.0499
PPIL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57069
NCI-H2170	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.47591
496100405_TCx_probable Alzheimer's disease_no TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.03394
MSC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31394
HSPA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66477
hsa-miR-4441	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
H4	DepMap CRISPR Gene Dependency	1.0	4.33331
Regulation of endogenous retroelements by Piwi-interacting RNAs (piRNAs)	Reactome Pathways 2024	1.0	null
TEN	CCLE Cell Line Gene CNV Profiles	-1.0	-1.40186
KARPAS299	CCLE Cell Line Gene CNV Profiles	-1.0	-1.80425
KYO1	DepMap CRISPR Gene Dependency	1.0	4.63201
HARS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25295
SW626	DepMap CRISPR Gene Dependency	1.0	2.61504
PROX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56769
XRCC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.40648
MFSD11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.05422
HCC1500	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.883149
TEX13B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.87384
GRPEL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37587
GSE198165,GSE198166_5_v_4_zfp266_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GSE131649_2_v_3_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE201309_4_v_7_matrine_human	RummaGEO Drug Perturbation Signatures	1.0	null
HCC1937	CCLE Cell Line Gene CNV Profiles	1.0	1.99557
THYN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.95087
SNAI2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.33208
NAA80	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.61445
PMC8020666-pnas.2015855118.sd09.xlsx-LPS_24_human_DRSG_higherRes-Ensemble_gene_id_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
NCI-H1355	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.00402
496100505_TCx_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.66458
TAF1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.34305
C9orf78	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0238
OCUM1	DepMap CRISPR Gene Dependency	1.0	2.24513
G112	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894756
GSE202434,GSE202438_2_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC12358249-supplementary_table_s5_ioaf064.xlsx-DMRT1_-_vs_WT__4_months-Unnamed_1_DMRT1	Rummagene Transcription Factor Associations 2026	1.0	null
G44	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.31033
ANKRD54	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46153
GSE196117_6_v_7_clarithromycin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TOMM5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.15094
TRNAU1AP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.46086
ARHGEF18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.13106
hsa-miR-4659b-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
hsa-miR-4692	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
hsa-miR-608	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
ZCCHC24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.35978
NELFCD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.18855
PCM6	CCLE Cell Line Gene CNV Profiles	-1.0	-1.86352
GSE201309_4_v_3_matrine_human	RummaGEO Drug Perturbation Signatures	1.0	null
AARS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.50461
BMPR1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.09065
GSE166536_3_v_2_docetaxel_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE131649_6_v_0_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
HEC-1-A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.11954
GSE236437_0_v_1_aldosterone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC8020666-pnas.2015855118.sd09.xlsx-LPS_4_chimp_DRSG_higherRes-Ensemble_gene_id_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
NVL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16408
hsa-miR-4514	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
hsa-miR-940	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
PMC10709143-41556_2023_1271_MOESM9_ESM.xls-Up_in_PAX7--Target_name_PAX7	Rummagene Transcription Factor Associations 2026	1.0	null
OVCAR-4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.30062
MCF10DCIS.COM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.936702
DHFR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.099
PAAF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.88394
GSE127790_13_v_3_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
testis	HPA Tissue Protein Expression Profiles	1.0	0.78692
496100330_PCx_possible Alzheimer's disease_no TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.04244
NCI-H1930	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.948772
SW 780	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10011
hsa-miR-583	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
TTC709	DepMap CRISPR Gene Dependency	1.0	2.70165
GSE216043_7_v_9_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
ALDH9A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.34165
HCC1011	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.28608
NPIPA7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.79092
PRNP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.40745
XRCC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19841
NDUFAF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.2083
496100543_FWM_probable Alzheimer's disease_TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.77649
FOXL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38864
G130	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.960595
hsa-miR-4489	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
NDC80	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19677
PMC8390401-12094_2021_2621_MOESM2_ESM.xls-S4-Supplemental_Table_S4_Differentially_expressed_genes_between_cases_with_G-CSF-induced_pY-STAT3_DMFI_1_5_STAT3_Low_v_DMFI_1_5_STAT3_High_STAT3	Rummagene Transcription Factor Associations 2026	1.0	null
CALM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.24401
hsa-miR-4271	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
H4	CCLE Cell Line Gene CNV Profiles	1.0	2.39787
OVCAR4	CCLE Cell Line Gene CNV Profiles	1.0	2.87942
TAL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.15089
RAB40AL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.38029
GSE222047_0_v_1_imidazole_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE77108_4_v_7_saha_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMC8635809-Table_2.xls-LPS-upregulated-Unnamed_4_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
T98G	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894756
KCNA6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.0809
GSE131377_4_v_2_spocd1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
NCI-H441	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.893701
KARPAS-620	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.03983
VPS16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04699
hsa-miR-296-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
HS695T	DepMap CRISPR Gene Dependency	1.0	2.44112
ECHDC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.24417
FAM181B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32853
SPIN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.85661
hsa-miR-3150a-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
SF172	CCLE Cell Line Gene CNV Profiles	1.0	1.51774
SW 1417	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.03983
MEC2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.46985
496100278_FWM_no dementia_TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.71057
NFILZ	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.03093
hsa-miR-3199	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
CUEDC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36616
GSE77108_5_v_9_saha_human	RummaGEO Drug Perturbation Signatures	1.0	null
496100554_FWM_no dementia_no TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.58368
KLE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.829636
SEZ6L2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.47395
GIT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.20674
GSE234289_4_v_1_rfx6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
bone marrow	HPA Tissue Gene Expression Profiles	1.0	1.11711
PMC8020666-pnas.2015855118.sd11.xlsx-LPS_attenuatedResponse-Human_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
FAM3C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.59431
PMC8020666-pnas.2015855118.sd11.xlsx-LPS_strongerResponse-Human_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-4260	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
SLFN12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16626
PISD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17435
MAP1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92043
GLIS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.16737
NCI-H226	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.958507
ZNF280D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.13373
P4HTM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.17207
VBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55819
SKM1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.49582
DDX54	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23978
NFU1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.50668
DAP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53653
HOP-62	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.846623
GSE205976,GSE205978_2_v_5_cep83_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TTC30B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.89743
TENT5B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.14564
NCIN87	CCLE Cell Line Gene CNV Profiles	1.0	1.42997
ZNF19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54565
BHY	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.960595
OCI-M2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.11709
C1orf116	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.32642
RIPK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.39105
PRRC2A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60985
KIAA1958	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.10464
RT4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.958507
PSMD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45586
GUK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.20154
HCC461	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894756
TMEM60	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.82229
HGC27	CCLE Cell Line Gene CNV Profiles	-1.0	-1.37915
PMC8567280-EMBR-22-e53014-s007.xlsx-Sheet1-Nearest_genes_to_BAZ2A-bound_C2-Enhancers_BAZ2A	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-3162-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
HCC4006	CCLE Cell Line Gene CNV Profiles	-1.0	-1.40167
GSE154337_0_v_1_temozolomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
HCC1937	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09885
GSE131649_2_v_7_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
HCC4017	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02735
Sertoli cell-only syndrome	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.3
MAPK12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.61914
MED14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.73641
GSE140074_1_v_0_kif20a_human	RummaGEO Gene Perturbation Signatures	-1.0	null
SEC13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22397
chr19_51385259_T_C_b38	GTEx eQTL 2025	1.0	1.10334
TAOK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.02411
RMG-I	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0776
HMCES	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.89816
UFD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4363
BE2M17	DepMap CRISPR Gene Dependency	1.0	4.32913
SCN1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60543
PRPF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.62554
TRMU	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.55113
Infertility	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.219
IZUMO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.0146
RL	CCLE Cell Line Gene CNV Profiles	-1.0	-1.88975
GPR108	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.42444
PK59	CCLE Cell Line Gene CNV Profiles	1.0	1.8014
GSE202434,GSE202438_12_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HPAC	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.35581
hsa-miR-125a-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
hsa-miR-1225-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
NLRX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41186
GSE196117_6_v_0_clarithromycin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
TNFSF12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.19886
NCIH929	CCLE Cell Line Gene CNV Profiles	-1.0	-2.19013
LGALS3BP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87177
OXA1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32198
HCC515	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13607
SEC61A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.17777
NCIH1623	CCLE Cell Line Gene CNV Profiles	1.0	1.45333
GSE76425_0_v_10_lenalidomide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
NAGA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.08117
HCC193	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13607
GRK3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.24073
ABC1	CCLE Cell Line Gene CNV Profiles	1.0	1.5494
KYSE-270	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.28608
NCI-H1838	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02844
GSE234289_3_v_1_rfx6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
UBE2T	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20142
DETROIT 562	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20947
CUX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.18555
hsa-miR-4690-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
EW7	DepMap CRISPR Gene Dependency	1.0	2.24869
HCC1569	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.46471
hsa-miR-4446-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
hsa-miR-4689	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
LNX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.9885
SNRPG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.11476
SNU668	CCLE Cell Line Gene CNV Profiles	1.0	2.18469
COV362	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.9455
GSE197532,GSE197533_0_v_1_gemcitabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
UMC-11	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.65745
KINGS1	DepMap CRISPR Gene Dependency	1.0	2.45573
SATB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.5345
hsa-miR-4741	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
POLR1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17547
TRIM26	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36304
NCCSTCK140	CCLE Cell Line Gene CNV Profiles	1.0	1.60426
A549	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.35759
SUM 1315M02	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.846623
PANC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894756
DIABLO	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.2478
FBXL19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.83599
TOR1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.31254
MTO1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57304
GSE131377_4_v_3_spocd1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
HCC1162	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.85268
SCN4B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13459
PLXNB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22861
NCI-N87	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.36016
COLO-818	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.846623
ADPRS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.74409
PMC8020666-pnas.2015855118.sd11.xlsx-LPS_strongerResponse-Unnamed_1_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
IKZF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.51221