association	dataset	threshold value	standardized value
GTEX-QLQ7-1526-SM-2S1QA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Golgi apparatus	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GTEX-WZTO-1126-SM-3NM93	GTEx Tissue Sample Gene Expression Profiles	1.0	0.8689
TCF4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.065
IZ in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.36158
GTEX-N7MS-1626-SM-3LK5F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.98036
GSE221327_5_v_2_clpp_human	RummaGEO Gene Perturbation Signatures	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JD-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-VUSG-0626-SM-4KL1Z	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35934
RASSF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48746
KYSE-270	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09226
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A63U-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
molecular_function	GO Molecular Function Annotations 2015	1.0	null
medial habenular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.19761
GTEX-XGQ4-0626-SM-4AT56	GTEx Tissue Sample Gene Expression Profiles	1.0	0.944555
TFB2M	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.82784
RPL35	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48372
THUMPD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46398
SG in caudal perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.40583
OCIMY5	CCLE Cell Line Gene CNV Profiles	-1.0	-1.39843
GTEX-XGQ4-0126-SM-4AT4H	GTEx Tissue Sample Gene Expression Profiles	1.0	0.920555
KARPAS-422 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.613
G43417UB	GlyGen Glycosylated Proteins	1.0	null
SIN3A_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ETS2	MotifMap Predicted Transcription Factor Targets	1.0	null
SPIN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.72402
GTEX-S3XE-2026-SM-3K2B5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
OVMANA	CCLE Cell Line Gene CNV Profiles	-1.0	-1.66949
indusium griseum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.02783
GTEX-N7MT-1426-SM-3LK5M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06153
HEY2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.4793
gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.050369
TGW	DepMap CRISPR Gene Dependency	1.0	2.09218
Leaf primordium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.603
EID2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.39032
ZNF556	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08784
GTEX-WY7C-0526-SM-3NB3D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02839
Bone disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
ACTRT3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.4148
Prostate adenocarcinoma_PRAD_TCGA-EJ-A65D-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
USF1_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-PLZ5-1526-SM-3P5ZX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01364
GATA3-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-WCDI-0005-SM-3NB2M	GTEx Tissue Sample Gene Expression Profiles	1.0	0.860692
Lung adenocarcinoma_LUAD_TCGA-97-A4M7-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-POMQ-0426-SM-3P61G	GTEx Tissue Sample Gene Expression Profiles	1.0	2.19123
TBXT	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.1389
SMAD9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32051
Skin Cutaneous Melanoma_SKCM_TCGA-RP-A690-06A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ALDOC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56273
GTEX-OHPK-0426-SM-3MJH3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.78493
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JF-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GA10	CCLE Cell Line Gene CNV Profiles	1.0	1.61996
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-7871-01A-11R-2232-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100455_FWM_dementia_TBI_86_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.18915
WM2664	DepMap CRISPR Gene Dependency	1.0	2.25777
GTEX-OIZI-0008-SM-2XCFD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.18348
CTCF_MEL cell line_mm9_5	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5877-11A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cerebral hemisphere	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Disease of anatomical entity	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
TP53I11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.14801
GTEX-R55C-1626-SM-48FEG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZR-75-30	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.85247
animal	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.235457
COPRS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.26226
EBC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.28355
PMC10274973-media-3.xlsx-ST18-Supplementary_Table_18_476_Bonferroni_significant_results_P_2_67_x_10-6_of_gene_based_association_analyses_H-MAGMA_dlPFC_cortical_neurons_for_sensation_seeking_factor_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-V955-0005-SM-3P5ZC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2782
NUDT8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69078
H3K27me3_G1E-ER4_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TXNDC16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9638
Brain Lower Grade Glioma_LGG_TCGA-VW-A8FI-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-4859-01A-02R-1426-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4QS-1126-SM-3NMD5	GTEx Tissue Sample Gene Expression Profiles	1.0	3.88186
neostriatum	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
k562	HPA Cell Line Gene Expression Profiles	1.0	0.872575
FAM76B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57997
KYSE-180	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.73765
Lung adenocarcinoma_LUAD_TCGA-49-4512-01A-21R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H522	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.31216
GTEX-R53T-0826-SM-48FCP	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48554
DDB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66356
SERPINB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.82745
peripheral portion of GPi	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.962223
SPI1_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
organ system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.451831
atypical lipomatous tumor	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.889258
GSE202434,GSE202438_12_v_14_talazoparib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Harderian gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.517
GTEX-WZTO-0826-SM-3NM8Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02652
ARHGAP27	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58979
Prostate adenocarcinoma_PRAD_TCGA-KC-A7F5-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
spleen	GTEx Tissue Gene Expression Profiles	1.0	0.835267
GTEX-OOBJ-2126-SM-3NB1N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14604
ZNF428	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57471
GTEX-SNOS-1126-SM-4DM67	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45838
GTEX-UJHI-0006-SM-3DB8H	GTEx Tissue Sample Gene Expression Profiles	1.0	0.890756
ZFP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.14807
GTEX-RM2N-1326-SM-48FCW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35121
CTCF_lung_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GA-10	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.55534
Liver hepatocellular carcinoma_LIHC_TCGA-2Y-A9H3-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LCN10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07215
GTEX-X5EB-2026-SM-4E3KA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.60935
GTEX-X5EB-0004-SM-46MWA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
tissues, cell types and enzyme sources	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
GTEX-XUJ4-0005-SM-4BOQ6	GTEx Tissue Sample Gene Expression Profiles	1.0	0.930169
PACSIN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15032
AU565	CCLE Cell Line Gene CNV Profiles	-1.0	-1.34467
GTEX-RN64-0726-SM-48FCV	GTEx Tissue Sample Gene Expression Profiles	1.0	2.27493
GTEX-PX3G-0826-SM-48TZS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.854374
Brain Lower Grade Glioma_LGG_TCGA-CS-6188-01A-11R-1896-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U3ZM-1126-SM-4DXUB	GTEx Tissue Sample Gene Expression Profiles	1.0	0.845636
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5892-01A-11R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X4LF-0006-SM-3NMCO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.27777
SP in caudal subicular cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.12615
SUSA	DepMap CRISPR Gene Dependency	1.0	3.39771
RNASE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93825
TSEN15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22483
NFIX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	52.148
GTEX-TKQ2-0926-SM-4DXU5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MAX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.5019
GTEX-Q734-2026-SM-3GADA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.883201
GTEX-QEG4-1226-SM-2S1P6	GTEx Tissue Sample Gene Expression Profiles	1.0	0.906554
NCI-H820	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.22735
Prostate adenocarcinoma_PRAD_TCGA-VP-A872-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CASC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92679
FXYD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98208
SH4	DepMap CRISPR Gene Dependency	1.0	2.90074
Perturb_12868_KD_EP400_SRP059494	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
KMS20	CCLE Cell Line Gene CNV Profiles	-1.0	-1.33496
H3K4me1_heart_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5192-01A-01R-1426-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me1_bone marrow_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
brain	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
WSB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.42476
GTEX-P44H-0426-SM-2XCEZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Rectum adenocarcinoma_READ_TCGA-AF-3911-01A-01R-1736-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SLC66A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18322
bewo	HPA Cell Line Gene Expression Profiles	1.0	1.12102
GTEX-S4Z8-0626-SM-4AD6J	GTEx Tissue Sample Gene Expression Profiles	1.0	1.30708
ZSCAN21	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.2503
496100410_TCx_possible Alzheimer's disease_TBI_87_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.24737
kidney_c	HPA Tissue Sample Gene Expression Profiles	1.0	1.28858
KMS-12-BM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.64549
C-type lectin-like	InterPro Predicted Protein Domain Annotations	1.0	null
DLGAP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16319
CEMIP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.81972
Acute Myeloid Leukemia_LAML_TCGA-AB-3005-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-75-7025-01A-12R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JUND_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
143B	DepMap CRISPR Gene Dependency	1.0	2.38937
KARPAS-620	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09226
PMC7806950-mmc2.xlsx-HP1g_Significant-DEGs-Table_S2_Significant_DEGs_following_targeting_of_dSaCas9-repressors_to_DUX4_DUX4	Rummagene Transcription Factor Associations 2026	1.0	null
ZNF665	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58943
GTEX-X5EB-0626-SM-46MVQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.849745
GTEX-P4QS-0426-SM-3NMCQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19793
HPAC	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.993098
ZNF333	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19761
GTEX-XQ8I-1326-SM-4BOPV	GTEx Tissue Sample Gene Expression Profiles	1.0	1.64077
GTEX-QVUS-0011-R8A-SM-3GAD7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.868531
GTEX-XUYS-0426-SM-47JX3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.64471
GTEX-U8XE-0008-SM-4E3K4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.958217
SRY-25088423-EMBRYONIC GONADS-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
GTEX-T6MN-0008-SM-4DM7H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-S4Z8-0226-SM-4AD5K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07088
inner CP in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.982992
urogenital system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.054402
GTEX-OHPN-0008-SM-4E3HW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16806
H3K4me1_megakaryocyte_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-UPJH-0001-SM-3NMDE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GMCL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.18852
agranular insular cortex (area Iag)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.919172
TTC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.35869
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-A6JU-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SERPINB6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92333
GTEX-TMZS-0006-SM-3DB8G	GTEx Tissue Sample Gene Expression Profiles	1.0	1.1925
MAML3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.24835
GTEX-TMMY-2226-SM-4DXTN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.830058
Outer membrane protein complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.535
TMEM44	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83848
ARL2BP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67186
Prostate adenocarcinoma_PRAD_TCGA-XJ-A83F-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CWF19L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06342
CTCF_limb_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-YL-A8SF-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CDK18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39105
USP15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51671
GTEX-S4Q7-0008-SM-3NM8A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08424
GTEX-SUCS-0006-SM-4DM59	GTEx Tissue Sample Gene Expression Profiles	1.0	0.886468
GTEX-T8EM-0426-SM-4DM7E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.13602
ZBTB26	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.1223
CD68	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.95111
GTEX-S4Z8-0926-SM-4AD6Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.55269
ADAM10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08641
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A68G-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-S9-A6U0-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NPJ8-0426-SM-2HMK6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-OIZH-1826-SM-2YUNP	GTEx Tissue Sample Gene Expression Profiles	1.0	0.862817
NDUFB8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.76777
ZC3H11A_MEL cell line_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SELENOK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.71166
SOX11_DEPLETION_GDS4801_326_human_Z138 mantle cell lymphoma (MCL) cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
Bone inflammation disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
HCC1500	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.942729
testis_7e	HPA Tissue Sample Gene Expression Profiles	1.0	1.06236
Whole body	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
H3K4me1_kidney_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
CTCF_embryonic fibroblast_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney Chromophobe_KICH_TCGA-KN-8434-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WHPG-2326-SM-3NMBP	GTEx Tissue Sample Gene Expression Profiles	1.0	0.88162
GTEX-TMMY-0226-SM-33HBA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
tissues, cell types and enzyme sources	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.231482
mRNA_FOXP1_21924763	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	-1.0	null
Brain - Cerebellum	GTEx Tissue Gene Expression Profiles 2023	1.0	3.60817
caudal (posterior) extramural migratory stream	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.9563
D283MED	CCLE Cell Line Gene CNV Profiles	-1.0	-2.19456
GSE206729_3_v_1_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MH-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
sarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.642615
GTEX-RN64-0326-SM-2TC5J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.838058
ME1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.95436
GTEX-OHPM-0006-SM-2HMKU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06144
ATP6V0B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54774
central nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
LN18	DepMap CRISPR Gene Dependency	1.0	4.49727
AMER1_OE_GDS4802_549_human_HEK293	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
WSU-NHL	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.55125
GSE95386_0_v_1_trim24_human	RummaGEO Gene Perturbation Signatures	-1.0	null
head	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.050984
LHX8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45208
RXRA_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-A57E-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TCF12	ENCODE Transcription Factor Targets	1.0	null
chr16_70042576_G_A_b38	GTEx eQTL 2025	1.0	2.10593
hsa-miR-4799-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
GTEX-TKQ1-1226-SM-4GICJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08568
H3K4me3_G1E-ER4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-PLZ6-0006-SM-33HBZ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.88772
Lung adenocarcinoma_LUAD_TCGA-44-7660-01A-11R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF48	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.73525
ARHGAP5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.79696
RFX7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.941
ZNF623	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54483
blood vessel	GTEx Tissue Gene Expression Profiles	1.0	1.20379
496100447_HIP_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.1159
EFM-19	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.868996
male reproductive system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.389289
H3K4me1_brain_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
SRSF6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06456
Corpus striatum	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
stratum pyramidale of caudal CA1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.17663
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3451-01A-02R-1188-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CDK4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07411
GTEX-OHPL-1826-SM-2YUN8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ANKRD33B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.60958
NAB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05664
GTEX-XAJ8-0006-SM-46MVM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07654
Lung squamous cell carcinoma_LUSC_TCGA-77-A5G1-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K27me3_testis_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-P4QT-1626-SM-2S1NP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-WFG7-0926-SM-4LMK7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.22704
GTEX-OIZH-3026-SM-3NB1G	GTEx Tissue Sample Gene Expression Profiles	1.0	1.74746
USF2	JASPAR Predicted Transcription Factor Targets	1.0	null
PFEIFFER	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.1638
Acute Myeloid Leukemia_LAML_TCGA-AB-2934-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Telencephalon	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
WASHC2C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.2585
MPLKIP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.94046
496100543_FWM_probable Alzheimer's disease_TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.4875
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A1ZJ-06A-12R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Midgut epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.306
SCRT2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.3008
Lung squamous cell carcinoma_LUSC_TCGA-33-4533-01A-01R-1201-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TOX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0421
NCI-H2009	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.931013
GTEX-WFG7-0005-SM-3GIKM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06893
GTEX-R3RS-0008-SM-48FF1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.871928
GTEX-N7MS-0626-SM-2YUN7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.951653
TIE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.26126
Lung squamous cell carcinoma_LUSC_TCGA-68-7757-01B-11R-2296-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
medioventral part of putamen	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.71933
GTEX-OXRL-0005-SM-3LK6A	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02113
GTEX-WH7G-1526-SM-4LVMX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05973
NCI-H2170 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.998
Viscus	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
RAD21_MEL cell line_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-SJXC-0226-SM-2XCDU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-T6MN-2026-SM-4DM7L	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41722
GTEX-R55G-0006-SM-2TC6O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.890649
kidney_a	HPA Tissue Sample Gene Expression Profiles	1.0	1.95071
SEC31B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.25044
H3-4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.73527
KARPAS-45	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-Q734-0008-SM-48U2I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.906877
ABHD17C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37783
GTEX-QMRM-0005-SM-3NB2A	GTEx Tissue Sample Gene Expression Profiles	1.0	0.837619
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5085-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VZ in caudal midinferior temporal cortex (area TF)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.15533
MDST8	DepMap CRISPR Gene Dependency	1.0	2.08234
SHG-44 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.995
pyramidal cells of caudal CA4	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.01826
Head and Neck squamous cell carcinoma_HNSC_TCGA-CR-5247-01A-01R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF99	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70835
GTEX-TML8-0005-SM-32QPA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.15672
GTEX-S7SE-0526-SM-2XCD8	GTEx Tissue Sample Gene Expression Profiles	1.0	0.975081
PMC7794364-41540_2020_161_MOESM3_ESM.xlsx-NSP_Unique_-_PPH2_predictions-Gene_Sym_SMAD9	Rummagene Transcription Factor Associations 2026	1.0	null
496100492_TCx_probable Alzheimer's disease_no TBI_89_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.19212
GTEX-U3ZM-1226-SM-3DB9G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.935344
CTCF_G1E-ER4_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-TKQ1-0926-SM-4DXU2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.42837
substantia nigra, compact part	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.32523
GTEX-N7MS-0126-SM-3TW8O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.927999
GSE102505_6_v_0_tunicamycin_human	RummaGEO Drug Perturbation Signatures	1.0	null
496100523_HIP_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.43243
liposarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.89777
PMC11096100-41588_2024_1714_MOESM3_ESM.xlsx-ST18-Unnamed_1_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-XPT6-0226-SM-4B65L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
TBX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.1076
whole body	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.236332
NCIH322	CCLE Cell Line Gene CNV Profiles	1.0	1.43783
CDKN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.43257
GTEX-X62O-0008-SM-46MU5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07141
ARMC10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98147
colon	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
COLO 320DM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.852125
GTEX-REY6-1426-SM-48FDK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.848919
ACTB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78616
ARNT2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.6734
MIER1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.35569
CD4_Naive_Primary_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	0.945366
Mesothelioma_MESO_TCGA-TS-A7OY-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PRDM11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94743
MKN45	DepMap CRISPR Gene Dependency	1.0	2.70776
NPM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.65517
BECKER	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PA-TU-8988T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09226
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4969-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NETO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82402
GTEX-S4UY-0008-SM-3NM8H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
u698	HPA Cell Line Gene Expression Profiles	-1.0	-0.859594
Acute Myeloid Leukemia_LAML_TCGA-AB-2848-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE221327_5_v_0_clpp_human	RummaGEO Gene Perturbation Signatures	1.0	null
chr16_70045684_C_T_b38	GTEx eQTL 2025	1.0	3.47017
GTEX-T5JW-0003-SM-3NMAD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MZ in temporal polar cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.01342
SKNFI	DepMap CRISPR Gene Dependency	1.0	2.91214
496100577_FWM_probable Alzheimer's disease_TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.14844
KPL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.47889
GTEX-RTLS-1326-SM-46MUN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-V955-1926-SM-4KL1L	GTEx Tissue Sample Gene Expression Profiles	1.0	0.955779
Testis	GTEx Tissue Gene Expression Profiles 2023	1.0	1.09669
496100407_FWM_probable Alzheimer's disease_no TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.66536
gallbladder	HPA Tissue Protein Expression Profiles	1.0	0.762372
JUN-27471255-CHONDROCYTES-MOUSE-RIB	ChEA Transcription Factor Targets 2022	1.0	null
EN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81174
GTEX-WY7C-0006-SM-3NB3L	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07973
H3K4me1_G1E_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-WFG7-0626-SM-4LMK6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.52526
GSE261563_9_v_1_atrx_human	RummaGEO Gene Perturbation Signatures	-1.0	null
endocrine gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.050602
AGXT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.47511
GTEX-TKQ2-0004-SM-3NMAC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZNF16	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	53.7179
PLEKHG5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45158
GALNT12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.97123
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4870-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HINT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80654
paraventricular nucleus of hypothalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.53986
cellular_component	LOCATE Predicted Protein Localization Annotations	1.0	null
G122	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.2085
IMR32	CCLE Cell Line Gene CNV Profiles	-1.0	-1.6066
GTEX-UPJH-0126-SM-4IHLL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10584
GTEX-XQ3S-0126-SM-4BOO9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.26405
HDLM2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.44536
GTEX-PX3G-1626-SM-2S1PT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-QESD-2026-SM-447BI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00518
viscus	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
496100397_PCx_no dementia_no TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16262
GTEX-XPT6-1626-SM-4B655	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43457
ONECUT3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	53.9639
Liver hepatocellular carcinoma_LIHC_TCGA-MR-A8JO-01A-12R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_HeLa-S3_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
OVSAHO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.931324
PRRX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69979
GTEX-R55C-0326-SM-3GAF1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
POU5F1-26923725-CHIP-SEQ-MESODERM-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
SATB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.2504
Lung squamous cell carcinoma_LUSC_TCGA-66-2756-01A-01R-0851-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-5435-01A-01R-1686-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr16_69964435_A_T_b38	GTEx eQTL 2025	1.0	2.10117
FLNC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.71467
CBX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.00168
H3K27me3_megakaryocyte_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
USF1_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5878-11A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
uterine cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.161139
Brain Lower Grade Glioma_LGG_TCGA-FG-6692-01A-11R-1896-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SJSA1	DepMap CRISPR Gene Dependency	1.0	2.4559
HCC1419	DepMap CRISPR Gene Dependency	1.0	3.0531
head	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-U8XE-0726-SM-3DB8O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.928907
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-6225-01A-11R-1915-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DHPS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57021
pontobulbar body	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.70781
POLR2A_H54_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KIF22	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33122
HSBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85116
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4981-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE206729_3_v_0_trps1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-O5YW-0006-SM-3LK6E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2891
MRPL41	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65165
KLF13	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	47.7852
GTEX-XXEK-0926-SM-4BRWH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
C-type lectin, conserved site	InterPro Predicted Protein Domain Annotations	1.0	null
GTEX-R55G-0626-SM-48FDB	GTEx Tissue Sample Gene Expression Profiles	1.0	0.917898
GSE186647,GSE217288_11_v_7_hnrnpc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CAR-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869988
SKNMC	CCLE Cell Line Gene CNV Profiles	-1.0	-1.52434
GTEX-XUZC-2126-SM-4BRW8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.12543
GTEX-RTLS-0726-SM-46MV4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-PLZ5-0426-SM-3P612	GTEx Tissue Sample Gene Expression Profiles	1.0	0.889994
Kidney renal clear cell carcinoma_KIRC_TCGA-3Z-A93Z-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
molt4	HPA Cell Line Gene Expression Profiles	-1.0	-1.68688
large intestine	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
FOSL2	ENCODE Transcription Factor Targets	1.0	null
chr16_69970895_C_A_b38	GTEx eQTL 2025	1.0	4.10207
DPPA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.67047
ZKSCAN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20907
NCI-H520	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.92858
Connective tissue disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
TMSB4X	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83614
chr16_69941728_A_T_b38	GTEx eQTL 2025	1.0	3.14515
H3K4me2_HepG2_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-X3Y1-0006-SM-3P5ZG	GTEx Tissue Sample Gene Expression Profiles	1.0	0.844875
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A2MJ-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Basal ganglion	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
LYRM9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89123
MSTO211H	CCLE Cell Line Gene CNV Profiles	1.0	2.2881
CTCF_G1E-ER4_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
WTX_OE_GDS4802_34_human_HEK293	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
GTEX-U3ZN-0006-SM-3DB7Y	GTEx Tissue Sample Gene Expression Profiles	1.0	0.975098
GTEX-OHPK-1826-SM-2YUMR	GTEx Tissue Sample Gene Expression Profiles	1.0	0.902379
Kidney Chromophobe_KICH_TCGA-KN-8435-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PLA2G3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94368
Skin Cutaneous Melanoma_SKCM_TCGA-DA-A1I8-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MORN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.11981
EVX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94143
parataenial nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.01552
kidney_b	HPA Tissue Sample Gene Expression Profiles	1.0	2.0826
SP1_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GCM1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.6319
GTEX-U3ZM-1626-SM-4DXSK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14205
GTEX-XV7Q-2326-SM-4BRVZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.872711
Cerebellum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.338
GTEX-P78B-0426-SM-2I5F5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
RNF220	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57733
chr16_69953861_C_T_b38	GTEx eQTL 2025	1.0	1.87627
GTEX-U3ZM-1526-SM-3DB9D	GTEx Tissue Sample Gene Expression Profiles	1.0	0.91326
KDM4B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.37368
GTEX-TKQ2-1726-SM-4DXUP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.11906
Acute Myeloid Leukemia_LAML_TCGA-AB-2932-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
muscle cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.250663
ZNF668	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.85367
GTEX-OXRL-0426-SM-3NM97	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18811
Cerebral hemisphere	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
TE10	CCLE Cell Line Gene CNV Profiles	1.0	1.52447
GTEX-WRHU-1126-SM-4E3I1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.57024
GTEX-TKQ2-1226-SM-4DXSV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.896912
HS695T	DepMap CRISPR Gene Dependency	1.0	5.33242
Osteoarthritis	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
hsa-miR-4758-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
SMC3_CH12.LX_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-PX3G-0926-SM-48U12	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07848
GTEX-VJYA-0226-SM-4KL1Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11669
nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
SPECC1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.73963
NCIH1650	CCLE Cell Line Gene CNV Profiles	1.0	2.20566
ZNF524	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.0978
GTEX-S7SF-0008-SM-3NM8T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.857144
GTEX-XYKS-1026-SM-4BRVH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07147
GTEX-S95S-1126-SM-4B64E	GTEx Tissue Sample Gene Expression Profiles	1.0	0.879071
MNT	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.2954
Sarcoma_SARC_TCGA-IW-A3M6-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC10274973-media-3.xlsx-ST18-Unnamed_9_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-X8HC-1626-SM-46MWE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
hsa-miR-3909	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
GTEX-RU72-0226-SM-46MUD	GTEx Tissue Sample Gene Expression Profiles	1.0	2.14271
GTEX-VJYA-1426-SM-4KL1Y	GTEx Tissue Sample Gene Expression Profiles	1.0	0.982603
GTEX-WL46-0926-SM-3LK7T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.915803
GTEX-U8T8-1126-SM-4DXUE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06287
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-A48D-01A-11R-A24Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-G6-A5PC-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WEY5-0006-SM-3GIKG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02967
Root primordium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.625
GTEX-QLQW-1226-SM-2S1Q9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
myxoid liposarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.33589
GSE162892_3_v_2_isox_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-V955-0926-SM-4JBJ8	GTEx Tissue Sample Gene Expression Profiles	1.0	2.79166
SGO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80324
Sarcoma_SARC_TCGA-LI-A67I-01A-31R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
salivary gland	HPA Tissue Protein Expression Profiles	1.0	0.762372
TKFC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45916
MDA-MB-231	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.931324
corpus striatum	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
HBL-100	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.878328
SCARF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30169
ELOC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06848
Uterine Carcinosarcoma_UCS_TCGA-N8-A4PL-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RD	DepMap CRISPR Gene Dependency	1.0	2.05197
NFIB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	48.9592
GTEX-X5EB-2626-SM-4E3HZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.16354
TFEB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.9755
CTCF_G1E-ER4_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SSB_02_107	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	-1.0	-0.59946
UMUC11	DepMap CRISPR Gene Dependency	1.0	2.62917
Lung adenocarcinoma_LUAD_TCGA-55-1594-01A-01R-0946-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100505_TCx_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.10059
SLC35E2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99882
GYG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51791
MSL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51117
CL-34	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HGC27	DepMap CRISPR Gene Dependency	1.0	2.05509
GTEX-S3XE-1126-SM-4AD4N	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.859931
GTEX-S95S-0008-SM-4AT5M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Brain - Amygdala	GTEx Tissue Gene Expression Profiles 2023	1.0	5.62058
MARK4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.26855
Gastrointestinal tract	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
ZIC1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	58.8711
PMC10679662-mmc2.xlsx-NC-D5-ZEB2-siRNA-Downregulated-Gene_Symbol_ZEB2	Rummagene Transcription Factor Associations 2026	1.0	null
retinal pigment epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.470375
CTCF_bone marrow macrophage_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
caudate nucleus	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-P4QS-2126-SM-3NMCF	GTEx Tissue Sample Gene Expression Profiles	1.0	2.11326
KMH2	CCLE Cell Line Gene CNV Profiles	1.0	2.15286
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-4731-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SU-DHL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.60006
GTEX-SIU7-0426-SM-2XCDX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
CTCF_heart_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE149035_7_v_0_hepacam_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PPCS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89705
GTEX-TKQ2-1826-SM-33HB2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
BICR 31	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.01653
SMC3_MEL cell line_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-RU1J-0006-SM-2TF6M	GTEx Tissue Sample Gene Expression Profiles	1.0	0.861193
Skin Cutaneous Melanoma_SKCM_TCGA-HR-A2OG-06A-21R-A18U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
interpositus (intermediate) nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.878741
Acute Myeloid Leukemia_LAML_TCGA-AB-2817-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MYCN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.6429
GTEX-S4P3-0006-SM-3K2AW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.05427
Gastrointestinal tract	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTEX-V1D1-0326-SM-4JBIY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02089
NR1D1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.4971
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IN-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QDVN-1626-SM-48TZC	GTEx Tissue Sample Gene Expression Profiles	1.0	2.11859
SLC52A2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49491
GTEX-QESD-0526-SM-2I5G5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.826627
hsa-miR-328	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
GTEX-XMD1-2826-SM-4AT5F	GTEx Tissue Sample Gene Expression Profiles	1.0	0.981291
CA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84846
kidney	GTEx Tissue Gene Expression Profiles	1.0	2.18987
inner SZ in midlateral extrastriate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.917741
UMUC1	DepMap CRISPR Gene Dependency	1.0	2.32687
TMEM268	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37874
dexamethasone_homo sapiens_gpl4133_gse42619	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GTEX-U3ZH-1526-SM-4DXV1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.70842
GTEX-VUSG-0526-SM-4KL22	GTEx Tissue Sample Gene Expression Profiles	1.0	1.34863
GTEX-OOBJ-0426-SM-3NB1S	GTEx Tissue Sample Gene Expression Profiles	1.0	2.29261
CTCF_C2C12_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-P4PQ-0226-SM-2S1NK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.843568
ganglion	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Sarcoma_SARC_TCGA-Z4-A9VC-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OUMS-23	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.931324
SCML2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.61818
496100337_HIP_possible Alzheimer's disease_no TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.07581
GTEX-S4Q7-1226-SM-4AD5I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06382
HEP G2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.05893
FLT4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12507
GSE128333_2_v_1_tcf4_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-PWCY-0008-SM-48TE9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.857057
Mesonephric duct	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.66
EBC1	CCLE Cell Line Gene CNV Profiles	1.0	1.6934
PMC10882188-ADB-29-e13365-s002.xlsx-ST18-Unnamed_8_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
TSR3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8845
GTEX-WH7G-2026-SM-3NMBL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.866906
Head and Neck squamous cell carcinoma_HNSC_TCGA-KU-A66S-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
METTL22	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5937
GTEX-XPT6-0008-SM-4B64Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.03771
GTEX-OIZF-0006-SM-2I5GQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.257
Lung adenocarcinoma_LUAD_TCGA-J2-8192-01A-11R-2241-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WFON-2026-SM-4LVMW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24918
Interdigit	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.793
NCI-H510A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.931324
MYOCD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.3963
COV413A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.68059
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A685-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SPI1	ENCODE Transcription Factor Targets	1.0	null
HOXB7-26014856-BT474-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Vermiform appendix	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.233
GTEX-SIU7-0001-SM-3NMAW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-X261-0326-SM-3NMD4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.88305
Disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.218
Kidney Chromophobe_KICH_TCGA-KL-8329-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PVOW-0008-SM-48TE8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08558
GSE193351_1_v_0_ruxolitinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-XK95-0426-SM-4AT4R	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.012
Kidney renal clear cell carcinoma_KIRC_TCGA-GK-A6C7-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MLX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.7277
ZEB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.2644
GMPPB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74294
ZNF605	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18337
pyramidal cells of rostral CA4	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.04124
skeletal muscle	HPA Tissue Gene Expression Profiles	-1.0	-1.89044
Palindromic rheumatism	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.292
Caudate nucleus	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
HMX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30624
rostral part of entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.8131
RNA polymerase II termination complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.566
CCNQ	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80697
SNU1272	CCLE Cell Line Gene CNV Profiles	-1.0	-1.3769
SNU16	CCLE Cell Line Gene CNV Profiles	1.0	1.43823
H3K27me3_CH12.LX_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-T2YK-0005-SM-32QOV	GTEx Tissue Sample Gene Expression Profiles	1.0	0.990545
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70X-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U8XE-1226-SM-4E3HN	GTEx Tissue Sample Gene Expression Profiles	1.0	1.17232
CTCF_brain_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-A8OW-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
COLO 741	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.087
H3K27me3_liver_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GIMEN	DepMap CRISPR Gene Dependency	1.0	3.96955
H3K4me1_ES-E14_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-WK11-2526-SM-3NM9Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.904884
GTEX-WH7G-1026-SM-4LVML	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A708-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pinguecula	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.888
496100416_FWM_dementia_TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.23409
NCI-H2198	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.48766
RERF-LC-KJ	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.993098
Dbf4-dependent protein kinase complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.905
COTL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49699
VZ in posterosuperior (dorsal) parietal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.824149
GTEX-SNOS-1526-SM-32PLW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MEF2D	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.9292
GSE162892_4_v_5_isox_human	RummaGEO Drug Perturbation Signatures	1.0	null
PLK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52785
GTEX-S341-0006-SM-3NM8D	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43447
skeletal system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.051485
Bone marrow-derived dendritic cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.917
GTEX-PW2O-1426-SM-48TCD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.67318
GTEX-XOTO-0008-SM-4GICE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01486
VZ in midlateral extrastriate cortex (area 19)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.923064
GTEX-WFG7-0008-SM-4LMKB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
RIPOR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08263
GTEX-QEG5-0426-SM-2I5GJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
TCF12_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_H54_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
cellular_component	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
GTEX-T5JC-0626-SM-3NMA6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.02937
GTEX-VUSG-0726-SM-3GIK1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
EBF3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	37.4448
496100527_FWM_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.0409
TRIR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33316
GTEX-O5YU-0008-SM-4E3I7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.885183
IPC298	DepMap CRISPR Gene Dependency	1.0	2.7842
GTEX-XXEK-0726-SM-4BRWF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.32782
496100368_PCx_probable Alzheimer's disease_no TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.14292
H3K4me1_limb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
EML3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57782
Rectum adenocarcinoma_READ_TCGA-DY-A1H8-01A-21R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
placenta_6a	HPA Tissue Sample Gene Expression Profiles	-1.0	-0.941721
ACHN	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.871486
MITF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.11217
connective tissue cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.2595
GTEX-RM2N-0008-SM-48FF3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Cerebral cortex	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTL-16	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.942729
GTEX-SSA3-0008-SM-47JWJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
TSPAN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06693
GTEX-TMMY-0008-SM-4DXU3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MDA-MB-468	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.99212
496100366_TCx_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.04824
heart muscle	HPA Tissue Protein Expression Profiles	1.0	0.762372
GTEX-XMK1-2026-SM-4B65K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08768
Lung squamous cell carcinoma_LUSC_TCGA-43-A474-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE167956_1_v_0_trim28_human	RummaGEO Gene Perturbation Signatures	1.0	null
extracellular region	GO Cellular Component Annotations 2015	1.0	null
GTEX-VJYA-1326-SM-3GIJC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.894777
496100648_PCx_no dementia_no TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.02642
FZD9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87516
GTEX-S33H-0126-SM-4AD62	GTEx Tissue Sample Gene Expression Profiles	1.0	0.964809
Head and Neck squamous cell carcinoma_HNSC_TCGA-IQ-A61O-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE131649_4_v_9_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
NGRN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85669
GTEX-PW2O-0426-SM-48TCC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.59624
small intestine	HPA Tissue Protein Expression Profiles	1.0	0.762372
PMC10015223-can-22-1444_supplementary_data_2_suppsd2.xlsx-K2-ATF3_peaks_Context3-Nearest_Ensembl_ATF3	Rummagene Transcription Factor Associations 2026	1.0	null
inferior olive, dorsal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.914371
GTEX-NPJ8-0007-SM-2D7VX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
PMC8481886-Table_2.xlsx-A_subsets-AF_MSC_UdRPC_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
PIWIL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84481
PMC6167382-41467_2018_6258_MOESM4_ESM.xlsx-TEAD-associated_GSC-Specific_UP-Nearest_Ensembl_GSC	Rummagene Transcription Factor Associations 2026	1.0	null
PMC8444148-NIHMS1529754-supplement-1529754_Tab_S2.xlsx-downregulated_in_ATF4OE-RNA-seq_of_C3_ATF4_OE_and_C3_neurons_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
RPS6KA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.02518
cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.42364
GTEX-QXCU-0008-SM-48FCH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Rectum adenocarcinoma_READ_TCGA-DY-A1DD-01A-21R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF442	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13405
polymorphic layer of caudal subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.40533
GSE207302,GSE207303_0_v_2_tp53bp2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
HPBALL	CCLE Cell Line Gene CNV Profiles	-1.0	-1.6569
OVMANA	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.90583
GTEX-PX3G-0008-SM-48U2L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14644
REL	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.5294
GTEX-SJXC-0526-SM-2XCFG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SUCLG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.81079
GTEX-OOBJ-3026-SM-3NB1D	GTEx Tissue Sample Gene Expression Profiles	1.0	1.51131
GTEX-UPK5-0008-SM-4IHJD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Protein body	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.673
GTEX-T5JW-0005-SM-3GADE	GTEx Tissue Sample Gene Expression Profiles	1.0	0.932398
POU1F1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74068
GTEX-S4Q7-1326-SM-4AD74	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2499
cochlear nuclei	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.39127
GTEX-WRHU-1326-SM-4E3K7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.79934
skeletalmuscle_b	HPA Tissue Sample Gene Expression Profiles	-1.0	-2.07549
FBXW11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68006
layer IIIa of caudal entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.827219
Neuro D	MotifMap Predicted Transcription Factor Targets	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CW-5581-01A-02R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CBX8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33491
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A2GT-06A-12R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
inner CP in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.49961
hsa-miR-490-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
DAUDI cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.767
Musculoskeletal system disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
Intracellular membrane-bounded organelle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GTEX-SIU8-0526-SM-2XCDP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
HES1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.1504
ZNF843	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.1833
CAL-148	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.38614
SPEF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80881
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-A4II-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STAT6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22646
CASKIN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.29922
GTEX-W5X1-0001-SM-3P61V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.989471
GTEX-SUCS-0008-SM-4DM53	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Lung adenocarcinoma_LUAD_TCGA-55-A494-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HNRNPK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33537
ZKSCAN7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55312
GTEX-WYJK-1026-SM-3NM8W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01381
rostral (anterior) extramural migratory stream	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.47389
GTEX-UJHI-0426-SM-3DB8Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Prostate adenocarcinoma_PRAD_TCGA-KK-A7B3-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-MW-A4EC-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-654-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
LSS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25209
stratum lacunosum-moleculare of rostral CA1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.16486
GTEX-XGQ4-0005-SM-4AT5U	GTEx Tissue Sample Gene Expression Profiles	1.0	1.21804
internal male genital organ	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.443347
NAT9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04823
lower (caudal) rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.81882
GTEX-XK95-0008-SM-4AT5G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZNF449	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.5544
TBX15	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.1688
GTEX-RWSA-0008-SM-47JYX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.920898
SOX6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21902
UCP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.10632
TCEANC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31603
blood	GTEx Tissue Gene Expression Profiles	1.0	0.824374
NFKBIL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8751
STK24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.53897
GTEX-XUZC-0005-SM-4BOQ8	GTEx Tissue Sample Gene Expression Profiles	1.0	0.869298
caudal putamen	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.12734
Lung adenocarcinoma_LUAD_TCGA-53-A4EZ-01A-12R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me1_G1E-ER4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-XBEW-0006-SM-4AT4E	GTEx Tissue Sample Gene Expression Profiles	1.0	0.902607
GTEX-T6MN-0002-SM-3NMAH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
nucleus subputaminalis	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.45629
GP5D	DepMap CRISPR Gene Dependency	1.0	2.21611
membrane-bounded organelle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
SOD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.74504
GTEX-RM2N-0006-SM-2TF5H	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11148
CALU-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37874
GTEX-T6MO-1926-SM-32QOJ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.882348
KP2	CCLE Cell Line Gene CNV Profiles	1.0	1.77248
GTEX-XOT4-0526-SM-4B66O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.833826
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7UY-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
outer CP in subgenual (subcallosal) cingulate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.975558
GTEX-QDVN-0326-SM-2I3FS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
WTX_OE_GDS4802_325_human_HEK293 embryonic kidney cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
Cytoplasmic vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
CEBPZOS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45379
GSE147669_2_v_1_tram2_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-OHPM-0426-SM-3TW8V	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2588
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-A6DG-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BCL2L11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04321
METTL24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52162
H3K4me1_MEL cell line_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
ZNF330	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17699
NCI-H322T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.995282
parathyroid gland	HPA Tissue Protein Expression Profiles	1.0	0.762372
496100330_PCx_possible Alzheimer's disease_no TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.44117
Epibranchial	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.535
MMP25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41682
GSE140441_2_v_0_temozolomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
Disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
SMAD2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.4838
corpus callosum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.984443
RAJI cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.662
MYC	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.4731
SW403	CCLE Cell Line Gene CNV Profiles	-1.0	-1.91858
NCIH2030	CCLE Cell Line Gene CNV Profiles	1.0	1.81935
SRY	ChEA Transcription Factor Targets	1.0	null
RWDD2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37059
GTEX-PWCY-0005-SM-33HBP	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06081
GTEX-XV7Q-0626-SM-4BRV5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2795
cuneate nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.02272
TFEC	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.9752
Intracellular organelle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
Pilus tip	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.026
GTEX-S32W-0426-SM-4AD6H	GTEx Tissue Sample Gene Expression Profiles	1.0	1.82886
central nuclear group	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.964245
GTEX-WI4N-0626-SM-3TW8Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.991923
SW 948	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.14872
PMC12913833-12672_2026_4481_MOESM3_ESM.xlsx-Table_S1-Table_S1_Two-sample_MR_analysis_of_blood_eQTLs_associated_with_LUAD_P_0_05_NR3C2	Rummagene Transcription Factor Associations 2026	1.0	null
TCF12	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.9728
GTEX-OXRL-2126-SM-3NM98	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12245
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
AACS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48736
MGA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.6022
GSE236502_1_v_3_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
Fc-gamma receptor III complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.566
BCR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47916
SPRY2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52003
Preputial gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.737
Kidney Chromophobe_KICH_TCGA-KL-8339-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NPJ8-1926-SM-3MJGB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14376
Kidney Chromophobe_KICH_TCGA-KL-8332-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ARHGEF39	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79003
HCC1493	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.932021
synovial sarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.563723
hsa-miR-1256	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
Rectum adenocarcinoma_READ_TCGA-AG-3591-01A-01R-1736-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Sarcoma_SARC_TCGA-FX-A2QS-11A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-TMMY-0426-SM-33HBB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.961359
GTEX-RWS6-0526-SM-4GIAJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83504
GTEX-XUJ4-1126-SM-4BOPC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-XPVG-0526-SM-4B65N	GTEx Tissue Sample Gene Expression Profiles	1.0	2.08282
GSE150072,GSE169209_4_v_11_qser1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70J-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K4me1_G1E_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4326-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GB2	DepMap CRISPR Gene Dependency	1.0	2.2777
MAFA	MotifMap Predicted Transcription Factor Targets	1.0	null
ZNF766	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.43293
Cecum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.233
PMC8561673-NIHMS1742950-supplement-Table_S7.xlsx-Housekeeping_MYC_ProxTubGenes-Proximal_Tubule_Enriched_Genes_MYC	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-OIZI-0126-SM-3NB13	GTEx Tissue Sample Gene Expression Profiles	1.0	1.53733
PMC7806950-mmc3.xlsx-Sheet3-Table_S3_Comparison_of_DEGs_following_targeting_of_dSaCas9-repressors_to_DUX4_DUX4	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-UJMC-0426-SM-4IHJF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.42972
CAP domain	InterPro Predicted Protein Domain Annotations	1.0	null
SMC3-22415368-MEFS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-QVUS-0426-SM-48FE3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.28597
oculomotor nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.885596
hsa-miR-541	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
127399	DepMap CRISPR Gene Dependency	1.0	7.22433
Amphisome	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.968
PXR (PXR:RXR)	MotifMap Predicted Transcription Factor Targets	1.0	null
NCDN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64315
ZBTB4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35796
Uterine Carcinosarcoma_UCS_TCGA-N5-A4RJ-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XBEC-0008-SM-4AT3X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
choroid plexus of the fourth ventricle	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.20995
GTEX-UPJH-0526-SM-4IHK8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.842575
caudal division of IPC (area 39)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.931052
Coronary artery disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.189
SARS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84337
Acute Myeloid Leukemia_LAML_TCGA-AB-2832-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Scutellum	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.606
GTEX-RWS6-1326-SM-47JXB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05119
alimentary canal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-QV31-1426-SM-2S1QD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-V955-2626-SM-3NM9F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02039
chr16_69977834_T_C_b38	GTEx eQTL 2025	1.0	7.58383
GTEX-REY6-0426-SM-2TF5G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-OOBK-1626-SM-2HMKG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
skbr3	HPA Cell Line Gene Expression Profiles	-1.0	-1.68688
GTEX-S3XE-1326-SM-4AD4H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.859531
Rectum adenocarcinoma_READ_TCGA-DT-5265-01A-21R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GAS2L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91852
GTEX-R55F-1526-SM-2TF4X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.887658
PMC12224929-ADVS-12-2416784-s006.xlsx-DEG_circGLIS3_KD-Unnamed_6_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-WFG8-1926-SM-4LVM1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.66019
APH1A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46543
GTEX-SSA3-0426-SM-32QPI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09053
OCIAML3	DepMap CRISPR Gene Dependency	1.0	2.74134
GSE161846,GSE161849_4_v_0_smarca4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
TNFRSF25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.28211
SNU-407	COSMIC Cell Line Gene Mutation Profiles	1.0	null
EGF-like, conserved site	InterPro Predicted Protein Domain Annotations	1.0	null
Myocardial infarction	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.189
GTEX-XV7Q-0526-SM-4BRWR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40959
TEF-1	MotifMap Predicted Transcription Factor Targets	1.0	null
VZ in subcallosal region	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.2007
CTCF_cortical plate_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZBTB6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.2937
GSE240747_0_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
G141	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.3473
periaqueductal gray substance, ventral portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.78096
GTEX-QXCU-0926-SM-48FEP	GTEx Tissue Sample Gene Expression Profiles	1.0	1.99898
RDH11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67712
SK-MEL-28	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.898833
DDT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03755
GTEX-O5YV-0626-SM-3LK64	GTEx Tissue Sample Gene Expression Profiles	1.0	1.38437
Prostate adenocarcinoma_PRAD_TCGA-J9-A8CL-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LN-18	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.0231
GTEX-TKQ2-1526-SM-4DXUN	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40127
GTEX-XQ3S-2726-SM-4BOP2	GTEx Tissue Sample Gene Expression Profiles	1.0	0.986732
496100329_FWM_probable Alzheimer's disease_TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.01585
GAL3ST3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.20009
GTEX-S32W-2326-SM-2XCAW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14642
chr16_69971005_C_T_b38	GTEx eQTL 2025	1.0	1.04794
AQP5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.50822
MDAMB134VI	CCLE Cell Line Gene CNV Profiles	-1.0	-1.72626
GDM1	CCLE Cell Line Gene CNV Profiles	-1.0	-2.52515
NCI-H1838	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.993098
GTEX-PLZ6-0326-SM-3P61J	GTEx Tissue Sample Gene Expression Profiles	1.0	1.30913
t70-white-adipose_consensus	MoTrPAC Rat Endurance Exercise Training	1.0	1.33216
GTEX-W5WG-0008-SM-4KL25	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.842813
SRSF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4571
PMC12978397-wjon-17-02-247-s002.xlsx-S2-Suppl_2_Two-sample_MR_analysis_of_blood_eQTLs_associated_with_LUAD_P_0_05_NR3C2	Rummagene Transcription Factor Associations 2026	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A4IS-01A-21R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr16_69939224_A_G_b38	GTEx eQTL 2025	1.0	3.16519
Central nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
SK-MM-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.05265
MCF7	DepMap CRISPR Gene Dependency	1.0	3.61863
PAM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23902
S117	CCLE Cell Line Gene CNV Profiles	1.0	1.3723
HEC6	CCLE Cell Line Gene CNV Profiles	1.0	1.96395
TMEM141	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.1256
GTEX-S7PM-0626-SM-4AD4Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10991
GSE162892_3_v_2_sox9_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-U3ZH-0626-SM-4DXT3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48055
SKMM2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.55942
ETV5::DRGX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.2825
Lung adenocarcinoma_LUAD_TCGA-93-A4JP-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PX3G-0726-SM-48TZT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
H3K4me1_erythroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
duodenum	HPA Tissue Protein Expression Profiles	1.0	0.762372
STX7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52375
GTEX-QVJO-0526-SM-447CE	GTEx Tissue Sample Gene Expression Profiles	1.0	3.11932
GSE193258,GSE193259_9_v_0_osimertinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
EIF1AD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.13206
Lung adenocarcinoma_LUAD_TCGA-55-A491-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAD21	ENCODE Transcription Factor Targets	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-G8-6324-01A-11R-2213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-REY6-1126-SM-48FDU	GTEx Tissue Sample Gene Expression Profiles	1.0	0.943641
GTEX-O5YV-0426-SM-3LK66	GTEx Tissue Sample Gene Expression Profiles	1.0	0.833666
SLC24A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41991
GTEX-TKQ2-0826-SM-33HB6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07428
LDLRAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54042
SAP30	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91125
SP in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.07105
TEAD4-26923725-CHIP-SEQ-HEMANGIOBLAST-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Intestinal disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.329
TEAD1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.976
ZNF717	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52355
PUR1	MotifMap Predicted Transcription Factor Targets	1.0	null
Head kidney	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.781
SLC7A11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38527
SLFN5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22435
lipomatous cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.89777
Brain Lower Grade Glioma_LGG_TCGA-FG-A4MU-01B-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF740	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.97888
GTEX-U412-0226-SM-3NMC8	GTEx Tissue Sample Gene Expression Profiles	1.0	0.949461
Kidney renal papillary cell carcinoma_KIRP_TCGA-J7-8537-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12775252-18_2025_5991_MOESM3_ESM.xlsx-Sheet1-Supplementary_Table_2_Up-_and_down-regulated_genes_in_TCF7L2-depleted_EVT_compared_to_control_EVT_TCF7L2	Rummagene Transcription Factor Associations 2026	1.0	null
MDA-MB-453	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.898833
ACKR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31968
Head and Neck squamous cell carcinoma_HNSC_TCGA-P3-A6T8-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X5EB-0008-SM-46MU3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
VPS37C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33419
Clitoral gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.112
DMRTA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.34985
Rectum adenocarcinoma_READ_TCGA-AF-6655-01A-11R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Extracellular region	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GTEX-P4QS-0008-SM-48TDY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.03697
Endoplasmic reticulum	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GTEX-X8HC-0226-SM-4E3K1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-RM2N-1926-SM-48FCU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.1067
HS-683 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.526
Uterine Carcinosarcoma_UCS_TCGA-N5-A4RS-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RXRA::VDR	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3
GATA2_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me1_megakaryocyte_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KK-A7AW-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Large intestine	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTEX-XYKS-0002-SM-4BRWN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04711
liver	HPA Tissue Gene Expression Profiles	-1.0	-1.00521
KCMF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.9768
Brain Lower Grade Glioma_LGG_TCGA-HT-A5RA-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Larval cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.355
MM127	DepMap CRISPR Gene Dependency	1.0	3.01743
H3K4me1_lung_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
LS1034	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.942729
PMC7806950-mmc3.xlsx-Sheet2-Table_S3_Comparison_of_DEGs_following_targeting_of_dSaCas9-repressors_to_DUX4_DUX4	Rummagene Transcription Factor Associations 2026	1.0	null
Intracellular anatomical structure	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
Primary T cells from cord blood	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-2.0876
skeletalmuscle_a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.44352
M059K	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.0034
H322T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.995282
GTEX-SNOS-0326-SM-4DM6C	GTEx Tissue Sample Gene Expression Profiles	1.0	1.29369
GTEX-O5YW-0426-SM-3MJHJ	GTEx Tissue Sample Gene Expression Profiles	1.0	2.44502
HES5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89607
NCIH1048	CCLE Cell Line Gene CNV Profiles	-1.0	-1.80821
GTEX-RWSA-0926-SM-47JXW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.37824
GTEX-R55F-1426-SM-2TF53	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
VZ in caudal subicular cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.02783
GTEX-PLZ5-0006-SM-2S1NZ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.86943
SMSCTR	DepMap CRISPR Gene Dependency	1.0	3.59846
gastrointestinal tract	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
iPS-18 Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	0.831846
hsa-miR-10b	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
Nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTEX-RWS6-0426-SM-47JXH	GTEx Tissue Sample Gene Expression Profiles	1.0	2.02027
reuniens nucleus (medioventral nucleus) of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.954323
PMC9376070-41419_2022_5157_MOESM18_ESM.xlsx-Sheet1-Table_S4_Differentially_expressed_genes_of_HNRNPC-KD_and_NC_cells_identified_in_the_RNA-seq_analysis_AR	Rummagene Transcription Factor Associations 2026	1.0	null
ASPC1	DepMap CRISPR Gene Dependency	1.0	2.50852
Ganglion	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A1Q4-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-TKQ1-1426-SM-4GICK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.873549
GTEX-SJXC-0126-SM-2XCFF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
liver_d	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.10336
GTEX-WRHK-0005-SM-3MJF5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.70898
Sertoli cell_Fetal gonad_Human	CellMarker Gene-Cell Type Associations	1.0	null
Colorectum	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
FOXC1	JASPAR Predicted Transcription Factor Targets	1.0	null
CBL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74077
SF126	DepMap CRISPR Gene Dependency	1.0	2.11691
cerebral cortex	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-SNMC-0226-SM-4DM6F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.31862
PMC11043400-41467_2024_47805_MOESM4_ESM.xlsx-ST12-Unnamed_1_KLF6	Rummagene Transcription Factor Associations 2026	1.0	null
RKO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.05996
GTEX-S32W-0626-SM-2XCBG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.858401
Cysteine-rich  secretory protein, allergen V5/Tpx-1-related	InterPro Predicted Protein Domain Annotations	1.0	null
adrenal gland	HPA Tissue Gene Expression Profiles	1.0	1.22667
GSE127916_1_v_4_nras_human	RummaGEO Gene Perturbation Signatures	1.0	null
496100559_FWM_no dementia_no TBI_87_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.02493
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-RQ-A68N-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.4359
Ureteric bud	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.88
BT-20	COSMIC Cell Line Gene CNV Profiles	1.0	2.15316
GTEX-OXRL-0726-SM-3NM9A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
NCI-H187	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.28542
GTF2F1_02_157	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	2.38827
PCDHB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92823
pineal body	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	3.34271
GTEX-SE5C-0626-SM-2XCDV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.847212
ventral claustrum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.890319
GTEX-UJHI-0326-SM-4IHJE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.9439
GTEX-T5JC-1526-SM-4DM68	GTEx Tissue Sample Gene Expression Profiles	1.0	2.9039
DENND4B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57904
ZNF76	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.4777
Hindbrain	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.338
USF1	JASPAR Predicted Transcription Factor Targets	1.0	null
FLT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.74121
SK-MES-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37713
GTEX-XBEW-0008-SM-4AT3Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GSE162892_3_v_1_isox_human	RummaGEO Drug Perturbation Signatures	-1.0	null
whole body	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Coleoptile	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.539
TBX5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.5688
GTEX-T6MN-0826-SM-32PM4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05259
ANKRD24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75204
U-698-M	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.24005
GTEX-O5YW-3026-SM-3MJHI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01763
H3K4me1_G1E-ER4_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
RPRD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93819
dorsal cochlear nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.826124
COLO-783	COSMIC Cell Line Gene CNV Profiles	-1.0	-3.24687
SRSF8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5768
Type IC spiral ganglion neuron_Brain_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
inferior olive, principal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.978742
GTEX-QXCU-0226-SM-2TC5W	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20595
Disease of anatomical entity	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.085
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A42Y-01A-12R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S7PM-0008-SM-3NM9Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
animal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-R55D-0126-SM-48FEL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08238
LU134A	DepMap CRISPR Gene Dependency	1.0	2.03208
TAF13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04603
endometrial cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.166544
GTEX-T6MN-0011-R1A-SM-32QOY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.952166
GTEX-PWN1-1626-SM-2S1OL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-A468-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4QS-0926-SM-48TBS	GTEx Tissue Sample Gene Expression Profiles	1.0	0.866079
CTCF_ES-Bruce4_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-WFG8-2426-SM-3GILL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
COLO-783	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.99212
reproductive system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055984
Uterus-b cell	Tabula Sapiens Gene-Cell Associations	1.0	-0.124435
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HT-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF85	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.6884
hsa-miR-10a	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
ARL4C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.56362
VPS18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47307
Brain stem	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.338
USF1_GM12878_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me3_G1E-ER4_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
anterior nucleus of pulvinar	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.893861
CTCF_olfactory bulb_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_MEL cell line_mm9_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Neostriatum	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
NIPA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30443
GTEX-XYKS-0226-SM-4BRW3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.86319
alveolar soft part sarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.890898
GTEX-T5JC-0326-SM-4DM5C	GTEx Tissue Sample Gene Expression Profiles	1.0	1.82933
bone marrow	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.221061
muscle	GTEx Tissue Gene Expression Profiles	-1.0	-1.25961
JUND_HepG2_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Colon	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Acute Myeloid Leukemia_LAML_TCGA-AB-2956-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
forebrain	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-P4PQ-0426-SM-3NMCI	GTEx Tissue Sample Gene Expression Profiles	1.0	2.4896
GTEX-XBEC-1326-SM-4AT69	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Skin Cutaneous Melanoma_SKCM_TCGA-W3-A825-06A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2910-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PLCXD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.25405
GTEX-PLZ6-0126-SM-48TC6	GTEx Tissue Sample Gene Expression Profiles	1.0	0.928564
HCC2218	CCLE Cell Line Gene CNV Profiles	-1.0	-1.91858
ZC3H11A	ENCODE Transcription Factor Targets	1.0	null
GTEX-SNOS-0008-SM-4DM6I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MAX	JASPAR Predicted Transcription Factor Targets	1.0	null
ASB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5895
GTEX-P78B-1926-SM-3P616	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.83178
Pancreatic adenocarcinoma_PAAD_TCGA-IB-AAUO-01A-12R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF263	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	46.1614
GTEX-UJMC-0008-SM-4IHKK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.991626
PMC7806950-mmc2.xlsx-SET_Significant-DEGs-Table_S2_Significant_DEGs_following_targeting_of_dSaCas9-repressors_to_DUX4_DUX4	Rummagene Transcription Factor Associations 2026	1.0	null
NUP50	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85684
FIGLA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.4455
liver	GTEx Tissue Gene Expression Profiles	-1.0	-0.843115
RVH421SKINFV1	DepMap CRISPR Gene Dependency	1.0	2.31859
RAD21_CH12.LX_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
LRP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41948
GTEX-TMMY-1926-SM-4DXUU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05901
GTEX-O5YT-0426-SM-3MJHD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.95608
GTEX-R55C-0008-SM-48FCF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.880113
NR1H4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57946
NDUFS7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37688
HCA-7	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.12786
143B	CCLE Cell Line Gene CNV Profiles	-1.0	-1.32636
GATA3-21867929-TH1-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
CTCF_MEL cell line_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-PX3G-2526-SM-48TZV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.866323
hsa-miR-4329	TargetScan Predicted Conserved microRNA Targets	1.0	0.997906
NCI-H1048	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.28814
GTEX-OOBJ-0008-SM-3NB26	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04391
GTEX-WHSE-0926-SM-3NMBS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.950873
RPMI2650	DepMap CRISPR Gene Dependency	1.0	2.70944
Head and Neck squamous cell carcinoma_HNSC_TCGA-HD-A6HZ-11A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Extracellular space	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
JMJD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01342
DDX3Y	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.62084
outer CP in midinferior temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.913545
TUBB2A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.36538
MLLT6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.09952
GTEX-XBED-2626-SM-4E3J5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MLXIPL	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.8568
PMC11392820-41556_2024_1475_MOESM3_ESM.xlsx-Supplementary_Table_9-Supplementary_Table_9_Expression_level_of_OTX2_targeted_genes_n_999_related_to_Figure_6_OTX2	Rummagene Transcription Factor Associations 2026	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-60-2706-01A-01R-0851-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
YY1	JASPAR Predicted Transcription Factor Targets	1.0	null
SZ in subgenual cingulate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.868391
GTEX-PLZ6-0008-SM-48TD5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MAGEL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63785
AEBP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.82601
Lung adenocarcinoma_LUAD_TCGA-44-2665-01A-01R-0946-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr16_69954810_A_C_b38	GTEx eQTL 2025	1.0	2.8799
RARB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.3781
FOSB::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.0482
hsa-miR-3166	TargetScan Predicted Conserved microRNA Targets	1.0	0.123298
GTEX-S4P3-0326-SM-4AD6P	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04269
PCM6	CCLE Cell Line Gene CNV Profiles	-1.0	-1.67899
NR2F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	55.3758
GTEX-NL3G-0008-SM-4E3JX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SW 403	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09226
FOSL2_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
nes	HPA Cell Line Gene Expression Profiles	1.0	1.81514
CTCF	ENCODE Transcription Factor Targets	1.0	null
GTEX-WFON-0526-SM-4LVLY	GTEx Tissue Sample Gene Expression Profiles	1.0	0.899381
NUP58	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07763
YY1	MotifMap Predicted Transcription Factor Targets	1.0	null
RELA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.1111
NR2C2_02_77	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	-1.0	-0.60023
GTEX-RTLS-0526-SM-2TF64	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-OIZI-0626-SM-2XCEH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ICC4	DepMap CRISPR Gene Dependency	1.0	2.01093
EHBP1L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.71285
ZNF518B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.66288
GSE135350_3_v_7_dexamethasone_human	RummaGEO Drug Perturbation Signatures	1.0	null
PMC6533083-elife-44306-supp4.xlsx-Table_S4-Supplementary_File_4_PAX8_gene_signature_expression_PAX8	Rummagene Transcription Factor Associations 2026	1.0	null
NCI-H1437	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37874
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JJ-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Hepatic Cirrhosis_Liver_GSE6764	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.59142
GTEX-RWSA-0626-SM-2XCBD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.926157
GTEX-XXEK-0004-SM-4BRWO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.905663
H3K27me3_erythroblast_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Conjunctival degeneration	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.847
GTEX-UPIC-0005-SM-3GACV	GTEx Tissue Sample Gene Expression Profiles	1.0	0.922326
GTEX-WH7G-1926-SM-4LVMM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.3171
SP1	ENCODE Transcription Factor Targets	1.0	null
testis_4a	HPA Tissue Sample Gene Expression Profiles	1.0	0.890766
OGFR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80339
GTEX-T6MN-1526-SM-4DM5P	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.047
JHOS2	DepMap CRISPR Gene Dependency	1.0	3.33393
PARP11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03587
FOXH1-21741376-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-J4-A67S-01A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MEOX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15308
SRY-25088423-EMBRYONIC-GONADS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
FLI1::DRGX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.7412
cell type cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.212945
GTEX-RN64-2326-SM-48FDW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.21908
PDP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.00675
reproductive organ cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.058966
DPF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68674
GTEX-XPVG-2226-SM-4B65U	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12777
GTEX-QMRM-0626-SM-447BQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.22892
SMC3	ENCODE Transcription Factor Targets	1.0	null
CAL72	DepMap CRISPR Gene Dependency	1.0	2.76939
GTEX-XLM4-0008-SM-4AT4W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.873066
ACHN	CCLE Cell Line Gene CNV Profiles	1.0	1.36723
Head and Neck squamous cell carcinoma_HNSC_TCGA-CQ-7072-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IM-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr16_70011913_G_A_b38	GTEx eQTL 2025	1.0	3.2595
medial preoptic nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.64201
MIDEAS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33774
hsa-miR-4726-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
HAND1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41856
CEBPB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.72633
Lung squamous cell carcinoma_LUSC_TCGA-85-A513-01A-12R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
dentate (lateral) nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.27952
GTEX-XLM4-1526-SM-4AT6D	GTEx Tissue Sample Gene Expression Profiles	1.0	0.938554
female reproductive organ cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.067237
Cellular anatomical entity	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
496100322_FWM_possible Alzheimer's disease_no TBI_100+_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.03848
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7242-01A-11R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-P8-A5KD-11A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CRB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12061
OTX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.8091
Kidney renal papillary cell carcinoma_KIRP_TCGA-WN-A9G9-01A-12R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FU97	CCLE Cell Line Gene CNV Profiles	1.0	2.06659
CTCF_A549_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-UJHI-0226-SM-4IHJL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.36712
Primary hematopoietic stem cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	2.0655
LPAR3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17642
SNCG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33172
BHLHA9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53181
GTEX-X5EB-1426-SM-46MVW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.0622
Uterine Carcinosarcoma_UCS_TCGA-N6-A4VG-01A-31R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55E-0008-SM-48FCG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.954897
CREB3L4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86677
NCI-H2030	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.07997
GTEX-S4UY-0126-SM-3K2BB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-PLZ4-0226-SM-2S1NW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-U4B1-1926-SM-3DB9E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.47587
GTEX-PLZ4-1326-SM-2S1O7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
928 MEL	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.99212
GTEX-XUJ4-0326-SM-4BOP9	GTEx Tissue Sample Gene Expression Profiles	1.0	0.952112
H3K4me1_liver_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
LRRC75B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46845
GTEX-REY6-1026-SM-2TF4Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867987
NCIH1568	CCLE Cell Line Gene CNV Profiles	-1.0	-1.56514
FZD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.60268
GTEX-P78B-0008-SM-48TE1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14347
Brain Lower Grade Glioma_LGG_TCGA-HT-A4DS-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAB5A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92439
GSE99687_0_v_1_smad5_human	RummaGEO Gene Perturbation Signatures	1.0	null
SH2B3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.6517
gracile nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.25794
GTEX-TMZS-0008-SM-47JWM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
DOTC24510	DepMap CRISPR Gene Dependency	1.0	5.76905
GTEX-XMD1-0006-SM-4AT4Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.0222
C3A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.86947
769P	DepMap CRISPR Gene Dependency	1.0	2.13006
HOXB2::ELK1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.3749
GTEX-Q2AI-1226-SM-48U14	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19646
GLIS3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	43.2588
carbohydrate binding	GO Molecular Function Annotations 2015	1.0	null
GTEX-XBEC-0126-SM-4GIDT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.55239
GTEX-XAJ8-1326-SM-47JYT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.28278
Endomembrane system	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
MEIS1-26923725-CHIP-SEQ-HEMOGENIC-ENDOTHELIUM-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Barr body	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.667
DDI2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04298
SUPT3H	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92286
SCC-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.32859
GTEX-S7PM-0426-SM-3NM91	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01256
Kidney renal papillary cell carcinoma_KIRP_TCGA-AL-3473-01A-01R-1193-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DKK3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.60719
periaqueductal gray substance, dorsolateral portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.37778
GTEX-QDVJ-0626-SM-48U1T	GTEx Tissue Sample Gene Expression Profiles	1.0	1.15694
HOXB13	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.5991
H9	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HIF1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.2224
GTEX-WHWD-0426-SM-3LK83	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04755
GTEX-R55E-0726-SM-48FCZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.52112
Cytoplasm	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
H2BC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32958
GSE173201_2_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
F36P	CCLE Cell Line Gene CNV Profiles	-1.0	-1.62154
GTEX-S4UY-0226-SM-3K2AP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-OIZH-0005-SM-2HMJN	GTEx Tissue Sample Gene Expression Profiles	1.0	0.874246
VMRCRCW	DepMap CRISPR Gene Dependency	1.0	2.95129
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-8518-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4QR-0008-SM-48TE2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.906215
METTL18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23139
GTEX-T2IS-2626-SM-32QPP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04849
OTX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12773
HKGZCC	DepMap CRISPR Gene Dependency	1.0	2.42621
GTEX-RTLS-0426-SM-2TF5K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.00003
HNRNPUL1_02_156	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.2854
CTCF_kidney_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-X8HC-2826-SM-46MWJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.01521
GTEX-S4UY-1426-SM-4AD6Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.868277
GTEX-O5YV-2026-SM-2D7VS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.972265
cellular myxoid liposarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	2.44446
H3K4me3_HepG2_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-X5EB-2326-SM-46MW5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
testis_7d	HPA Tissue Sample Gene Expression Profiles	1.0	1.09004
Brain Lower Grade Glioma_LGG_TCGA-S9-A6WM-01A-12R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_A549_hg19_7	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MZ in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.37792
GSE112714_2_v_0_ctnnb1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-REY6-0826-SM-2TF4S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.935849
GTEX-UJMC-0005-SM-3GACU	GTEx Tissue Sample Gene Expression Profiles	1.0	0.878542
RND2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41517
GSE240747_0_v_1_sparc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ZNF219	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22365
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5088-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12179525-mmc1.xlsx-Group_HNF4A_vs_Null_sign-Supplemental_Table_S1_Differentially_expressed_genes_in_HNF4A-transduced_cells_vs_Null_HNF4A	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-W5X1-0008-SM-4LMKA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
eye	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.06117
OCEL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.56519
POLR2A	ENCODE Transcription Factor Targets	1.0	null
Lung adenocarcinoma_LUAD_TCGA-44-8119-01A-11R-2241-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SREBF2	JASPAR Predicted Transcription Factor Targets	1.0	null
connective tissue	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.051756
ZMIZ2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75013
FOXH1-21741376-EPCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-RUSQ-2126-SM-47JXK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.911733
OVCAR-4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.02438
GTEX-QDVJ-0008-SM-48U2E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.909398
SOX2-21211035-LN229-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
basal nucleus of Meynert	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.86927
supraoptic nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.30535
Prostate adenocarcinoma_PRAD_TCGA-KK-A7AZ-01A-12R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cryoglobulinemia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.271
Artery disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.189
GTEX-UPK5-0126-SM-3GADM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08952
GTEX-XV7Q-0008-SM-4BRWL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.10699
synovium cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.563723
HAPLN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54551
RANBP6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57626
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-7046-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S341-0008-SM-4AD6D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZNF484	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49019
NCIH838	CCLE Cell Line Gene CNV Profiles	1.0	1.57302
GTEX-OHPL-1626-SM-2HMIR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.971285
NFIC::TLX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.9375
ARNT::HIF1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.7019
SHISA8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19031
GTEX-XPVG-0008-SM-4GICH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-X4XX-0008-SM-46MVK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08931
GTEX-QLQW-1326-SM-2S1QS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-T5JC-0005-SM-4DM7B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Organelle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GTEX-U3ZM-0326-SM-4DXUJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.29672
GTEX-XAJ8-0326-SM-47JYI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.08145
Prostate adenocarcinoma_PRAD_TCGA-J4-A67Q-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-R55C-1426-SM-48FED	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09975
DEDD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66932
CARHSP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15493
GTEX-XPVG-0726-SM-4B658	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.825659
GTEX-T6MN-0526-SM-32PMS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
CLOCK	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.587
Lung adenocarcinoma_LUAD_TCGA-05-4432-01A-01R-1206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE213228_4_v_3_irak2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
MEF2A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.9846
GTEX-WHSB-0005-SM-3LK7C	GTEx Tissue Sample Gene Expression Profiles	1.0	0.988829
skeletalmuscle_e	HPA Tissue Sample Gene Expression Profiles	-1.0	-2.07549
GTEX-OIZG-1326-SM-2HMIQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14115
Lung squamous cell carcinoma_LUSC_TCGA-85-8288-01A-11R-2296-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CNPPD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52577
cellular_component	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
GSE135350_3_v_1_dexamethasone_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-RUSQ-0326-SM-47JWS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48571
GSE217873_1_v_0_nusap1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3352-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-Q2AG-0926-SM-48U1Q	GTEx Tissue Sample Gene Expression Profiles	1.0	1.28391
Exoribonuclease complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.92
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5099-01A-01R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pterygium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.085
RXRG	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.0767
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5878-01A-11R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
endometrial stromal tumor	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.724907
Brain Lower Grade Glioma_LGG_TCGA-HT-8104-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XV7Q-0726-SM-4BRV6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZNF692	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	55.3352
GTEX-WH7G-0008-SM-4LVNM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Sperm plasma membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.547
Adrenocortical carcinoma_ACC_TCGA-OR-A5J5-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ZNF852	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84741
POLR2AphosphoS5_G1E_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ASXL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13293
GTEX-OHPN-2726-SM-2I5H4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.858588
GTEX-SUCS-1326-SM-4DM5T	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14072
HCC1319	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869988
ZNF671	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.42833
Brain Lower Grade Glioma_LGG_TCGA-S9-A7IX-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KNS81	CCLE Cell Line Gene CNV Profiles	1.0	1.59575
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-7585-01A-11R-2139-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NO-10	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-TMMY-1726-SM-4DXTD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SNU-387	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.55954
ZBTB24	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	55.2271
RXRA_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K4me1_placenta_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-OIZG-0926-SM-3LK5Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SMIM12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.11463
GTEX-XMD3-0008-SM-4AT4V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Liver hepatocellular carcinoma_LIHC_TCGA-DD-A1EK-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5693-01A-11R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Sarcoma_SARC_TCGA-DX-AB2J-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-U8XE-1526-SM-4E3HT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
MXI1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.536
ID3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91639
SALL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55568
KMM-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.942729
IFT172	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78022
NLRX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41186
GTEX-PSDG-0826-SM-48TCZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.27673
integument	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.05069
GTEX-T6MN-0011-R4A-SM-32QPG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
COLO-818	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.82467
CCNB1IP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32531
skeletal muscle cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.32373
adrenal_4a	HPA Tissue Sample Gene Expression Profiles	1.0	0.855047
VZ in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.05993
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70N-01A-12R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RARA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	90.235
UOK101	CCLE Cell Line Gene CNV Profiles	1.0	1.55483
GTEX-P78B-0826-SM-3NMCA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.22393
HOP-92	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.907346
SUDHL1	CCLE Cell Line Gene CNV Profiles	1.0	1.55659
GTEX-OIZI-0005-SM-2XCED	GTEx Tissue Sample Gene Expression Profiles	1.0	0.93428
PLD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80943
OVCAR433	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.14872
RERF-LC-OK	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.14872
Prostate adenocarcinoma_PRAD_TCGA-V1-A8MM-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NUMBL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33373
Kidney Chromophobe_KICH_TCGA-KL-8324-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-UPK5-1526-SM-4JBJA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.03405
ETV5::HOXA2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.465
ZNF106	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84613
GTEX-NL4W-0008-SM-4E3I2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-UJHI-0008-SM-4IHL1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
HMY-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.99212
ANKZF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55118
Brain Lower Grade Glioma_LGG_TCGA-FG-A60L-01A-12R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
LANCL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17634
anterior amygdaloid area	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.68124
medial septal nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.847575
HCC1569	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.34008
kidney	HPA Tissue Gene Expression Profiles	1.0	2.24804
GSE156923_2_v_3_rbmx_human	RummaGEO Gene Perturbation Signatures	-1.0	null
RBM39_02_151	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.39232
IKZF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.0002
Adrenocortical carcinoma_ACC_TCGA-OR-A5KU-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
granular layer of rostral dentate gyrus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.32503
NFIC	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	69.7225
SIN3A	ENCODE Transcription Factor Targets	1.0	null
CTCF_liver_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-6028-01A-11R-1672-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-TM-A84B-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SE5C-0006-SM-4BRW5	GTEx Tissue Sample Gene Expression Profiles	1.0	0.985829
GSE102505_1_v_0_tunicamycin_human	RummaGEO Drug Perturbation Signatures	1.0	null
ZNF652	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.6609
GTEX-P4PP-0426-SM-3NM9H	GTEx Tissue Sample Gene Expression Profiles	1.0	2.69525
ERF::SREBF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.9264
musculoskeletal system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.18453
CARS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.6871
Lung squamous cell carcinoma_LUSC_TCGA-77-8146-01A-11R-2247-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-G6-A8L8-01A-21R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DUS1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52379
PMC5848610-supp_gr.228809.117_Supplemental_Table_S4.xlsx-Table_S4A-Supplemental_Table_S4A_Differentially_expressed_genes_upon_ZFX_Knock_down_in_C42B_ZFX	Rummagene Transcription Factor Associations 2026	1.0	null
ZNF528	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.9107
PMC10015223-can-22-1444_supplementary_data_2_suppsd2.xlsx-K2-ATF3_peaks_Context3-Gene_Name_ATF3	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-WFJO-0005-SM-3GIKY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14535
hsa-miR-4720-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
Brain Lower Grade Glioma_LGG_TCGA-HT-7860-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-77-8148-01A-11R-2247-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SNMC-0006-SM-2XCFE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45909
496100351_FWM_no dementia_TBI_95-99_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.05132
BT-20	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.1784
C-type lectin	InterPro Predicted Protein Domain Annotations	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-5360-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
subgranular zone of caudal dentate gyrus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.920868
GTEX-XUW1-0008-SM-4BOQH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.0834
RCC4	CCLE Cell Line Gene CNV Profiles	1.0	1.69156
adrenal_4d	HPA Tissue Sample Gene Expression Profiles	1.0	0.929511
H1_Derived_Neuronal_Progenitor_Cultured_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.21515
ANKLE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.04397
GTEX-QEL4-0926-SM-3GAD1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Acute Myeloid Leukemia_LAML_TCGA-AB-2915-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CAL148	CCLE Cell Line Gene CNV Profiles	-1.0	-2.0661
extracellular region	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
endometrial stromal sarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.727738
WARS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03859
SCRT1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.6853
CUX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13647
GTEX-VUSG-0008-SM-4KL24	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.944397
Lung adenocarcinoma_LUAD_TCGA-91-8499-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-DU-A7TD-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
CCNB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.93669
GTEX-QEG5-0326-SM-2S1PB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-S95S-0226-SM-4B656	GTEx Tissue Sample Gene Expression Profiles	1.0	3.01567
SP in rostral perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.09077
CHAGO-K-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.32859
GTEX-U3ZN-0526-SM-4DXTH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.949278
GTEX-WH7G-0326-SM-3NMBH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-QDVN-0008-SM-48U2D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
FOS	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.7749
A3/KAW	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.32859
GTEX-WH7G-0426-SM-3NMBJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GSE247084,GSE247087_0_v_1_cdyl_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PLBD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27447
Alimentary canal	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTEX-Q2AH-0326-SM-48U1K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.17951
SW 620	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.64754
colorectum	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
VMRCLCP	CCLE Cell Line Gene CNV Profiles	1.0	1.60723
MDA-MB-330	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.14872
SNU-16	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.28556
GTEX-RTLS-0826-SM-2TF5Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07995
disease of cellular proliferation	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.418394
H3K4me1_embryonic fibroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
SIHA	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.57881
TAOK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65264
GTEX-QLQW-1026-SM-447A9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04409
496100345_FWM_no dementia_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16176
NOA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.25159
Kidney renal clear cell carcinoma_KIRC_TCGA-G6-A8L7-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-UPIC-1126-SM-4IHLO	GTEx Tissue Sample Gene Expression Profiles	1.0	2.26411
GTEX-S4UY-0526-SM-3K2AN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.05601
Intestine	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
SKBR3	CCLE Cell Line Gene CNV Profiles	-1.0	-1.63852
GTEX-WXYG-0005-SM-3NB3M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83501
MEF2C	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.9393
GTEX-V1D1-2126-SM-4JBH4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.28932
GSE128333_4_v_1_tcf4_human	RummaGEO Gene Perturbation Signatures	1.0	null
Internal female genital organ	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.024
Peritrophic membrane	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.674
NAMPT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38611
KMS-11	COSMIC Cell Line Gene Mutation Profiles	1.0	null
BST2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82319
PMC11043400-41467_2024_47805_MOESM4_ESM.xlsx-ST12-Unnamed_2_KLF6	Rummagene Transcription Factor Associations 2026	1.0	null
protein binding	GO Molecular Function Annotations 2015	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-XG-A823-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SREBF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.2667
GDE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.78109
NKX2-8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.79801
IP6K1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79516
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5700-01A-11R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE162892_3_v_5_isox_human	RummaGEO Drug Perturbation Signatures	-1.0	null
parasolitary nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.1757
DENND11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91305
GTEX-QV31-0008-SM-447AT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SERTAD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64899
GTEX-P4PP-0008-SM-48TDV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.910327
CEP55	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82587
NCI-H1650	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.847043
GTEX-POYW-1126-SM-48TCI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35667
GSE131660_2_v_0_piperlongumine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-OIZG-0008-SM-4E3J2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
CHP-212	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.66885
GTEX-X88G-0006-SM-47JX5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01932
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-GR-A4D6-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2944-03A-01T-0740-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC1263	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.48766
HSPA8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32775
Mesothelioma_MESO_TCGA-SC-A6LN-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE186647,GSE217288_2_v_7_hnrnpc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-R53T-0005-SM-3GADK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.934209
chr16_70099984_T_C_b38	GTEx eQTL 2025	1.0	2.12513
RXRA	ENCODE Transcription Factor Targets	1.0	null
SERINC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.59355
CCDC85B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0969
TEN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49707
HCaRG_OE_GDS1411_72_human_HEK293 embryonal kidney cell line	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
SP140	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46128
EMC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.53761
ZNF684	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.8653
MEWO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HES2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.947
POLE3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13471
Liver hepatocellular carcinoma_LIHC_TCGA-FV-A496-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RXRB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.3302
Prostate adenocarcinoma_PRAD_TCGA-YL-A8SL-01B-21R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OIZG-0526-SM-2HMLF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GSE240258_0_v_1_prmt1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
KCI-MOH1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.868996
Brain Lower Grade Glioma_LGG_TCGA-RY-A83Z-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.051043
ZBTB6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33342
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-Q1-A73R-01A-11R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ETV7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.7622
DSC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17428
PMC7895828-41419_2021_3488_MOESM3_ESM.xlsx-Sheet1-Supplementary_Table_3_List_of_deregulated_genes_in_c-MYC_altered_human_HCC_from_TCGA_LIHC_dataset_MYC	Rummagene Transcription Factor Associations 2026	1.0	null
FSTL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08894
GTPBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79085
Kidney renal clear cell carcinoma_KIRC_TCGA-G6-A8L6-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4959-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-TMMY-1526-SM-4DXST	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.859168
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5884-11A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-2Z-A9J2-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC5918774-13287_2018_864_MOESM2_ESM.xls-sheet-hREPC_AND_AF_MSC_AND_UM51_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YL-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KCTD17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91449
Brain morphology (MOSTest)	GWAS Catalog SNP-Phenotype Associations 2025	1.0	3.9699
Brain Lower Grade Glioma_LGG_TCGA-HT-8110-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
epididymis	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.350001
KARS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88446
hESC_Derived_CD184+_Endoderm_Cultured_Cells	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	2.52912
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5882-11A-01R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TUBB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77131
Aorta	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	1.0	1.1002
GTEX-RTLS-0008-SM-48FET	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
chr16_69913933_G_A_b38	GTEx eQTL 2025	1.0	1.02189
GTEX-X4EP-0326-SM-3P5Z6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.950218
JUND	ENCODE Transcription Factor Targets	1.0	null
RPMI 8226	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37713
GSE141143_1_v_0_ibrutinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-RUSQ-0426-SM-47JWR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02978
GSE201735_3_v_1_cdca7_human	RummaGEO Gene Perturbation Signatures	-1.0	null
sense organ	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.056272
GTEX-R53T-2026-SM-3GIJF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07747
animal	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
Waisman syndrome	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.388
H3K4me1_cortical plate_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
bronchus	HPA Tissue Protein Expression Profiles	1.0	0.762372
GTEX-T6MO-0006-SM-32QOU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06996
HOTHC	DepMap CRISPR Gene Dependency	1.0	2.05014
Intracellular vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
Lung squamous cell carcinoma_LUSC_TCGA-NC-A5HP-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
kidney_d	HPA Tissue Sample Gene Expression Profiles	1.0	1.90947
GTEX-WHWD-0005-SM-3LK7D	GTEx Tissue Sample Gene Expression Profiles	1.0	0.852017
GTEX-R55E-1126-SM-48FDZ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.896356
496100508_PCx_possible Alzheimer's disease_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.06697
GBGT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12307
MT-ATP8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8797
Forebrain	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
ZNF677	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46827
GTEX-S7SF-0006-SM-3K2B6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09026
MZF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.4194
C5orf15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12092
GTEX-TMMY-0626-SM-33HBD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.95448
GTEX-SNMC-1026-SM-4DM7K	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18036
PMC8844187-Table_2.xlsx-prostate-DLX1_DLX1	Rummagene Transcription Factor Associations 2026	1.0	null
HCC4017	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37874
Brain Lower Grade Glioma_LGG_TCGA-TM-A7C3-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Root apex	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.509
SEPTIN7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.22873
Endosome	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	5.0
medial subdivision of central nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.88975
PMC11462941-CAS-115-2947-s001.pdf-136-HES1_HES1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-QEG5-0626-SM-2S1PP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
ZNF362	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46028
GTEX-U412-0326-SM-3DB9L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.1424
CNOT6L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.40383
Brain Lower Grade Glioma_LGG_TCGA-HT-A74H-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Mouse - Motor Cortex - Cluster - Sst+ Th+ GABAergic neuron_3	HuBMAP Azimuth Cell Type Annotations	1.0	null
496100420_PCx_probable Alzheimer's disease_no TBI_85_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.08723
GSE135350_2_v_1_dexamethasone_human	RummaGEO Drug Perturbation Signatures	1.0	null
CTCF_MEL cell line_mm9_6	ENCODE Transcription Factor Binding Site Profiles	1.0	null
LN18	CCLE Cell Line Gene CNV Profiles	1.0	1.60666
OVCA 432	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.993098
GTEX-OOBK-0425-SM-3LK5O	GTEx Tissue Sample Gene Expression Profiles	1.0	2.69478
SYVN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98884
GTEX-WFON-0005-SM-3NMC9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07976
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A3AG-06A-31R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-X4XY-0526-SM-46MW1	GTEx Tissue Sample Gene Expression Profiles	1.0	0.842639
hsa-miR-4520b-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
GPR176	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64395
SK-BR-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.15514
Metencephalon	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.338
CORL23	DepMap CRISPR Gene Dependency	1.0	2.75231
SHISA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07408
METTL16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82243
GTEX-XBEC-1226-SM-4AT65	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
DDX31	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.36069
CDC42EP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04493
ARL6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05959
PMC12183081-41388_2025_3375_MOESM8_ESM.xlsx-Sheet1-Table_S7_List_of_differentially_alternative_splicing_genes_in_osteosarcoma_cell_lines_after_knocking_down_the_YBX1_gene_P_0_05_Related_to_Fig_6C_YBX1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-RWSA-1326-SM-47JX9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5880-01A-11R-1592-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SP in temporal polar cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.367
FADU	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.0933
FAR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.97908
medial geniculate nuclei	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.865817
Arthritis	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.438
GTEX-OXRL-0008-SM-3NB29	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Prostate adenocarcinoma_PRAD_TCGA-XQ-A8TA-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC2218	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.00803
hsa-miR-4776-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
GTEX-Q2AH-2026-SM-2S1PX	GTEx Tissue Sample Gene Expression Profiles	1.0	0.876441
TUBG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64816
ARHGEF10L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9888
GTEX-PX3G-0326-SM-2I3EO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
HOXA10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70854
superficial layers of olfactory entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.43435
Brain	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
SNU-719	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.931013
Lung squamous cell carcinoma_LUSC_TCGA-56-7222-01A-11R-2045-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GNS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51573
GTEX-V955-0004-SM-3NMDH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.888136
UACC-812	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869988
chr16_69943417_CGCATTCCTCTTCCCCGCATTCCTCTTCCCCGCATTCCTCTTCCCT_C_b38	GTEx eQTL 2025	1.0	2.21113
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A3AH-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ONECUT3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07625
DNALI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.05625
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-6960-01A-41R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OKAJIMA	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.086
GTEX-QMR6-1926-SM-32PL9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04264
GTEX-R53T-0726-SM-48FCS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.37617
Pancreatic adenocarcinoma_PAAD_TCGA-IB-AAUP-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-VP-A875-01A-31R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-UJMC-1826-SM-3GADT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A2MI-06A-11R-A18U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-C4-A0EZ-01A-21R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
APBB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27284
H3K4me1_G1E_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
TFG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44266
Adrenocortical carcinoma_ACC_TCGA-OR-A5LD-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RWS6-2126-SM-2XCAV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.893331
GTEX-WH7G-0002-SM-4LVN9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.04157
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-5441-01A-01R-1514-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P4PP-0005-SM-2HMKX	GTEx Tissue Sample Gene Expression Profiles	1.0	0.988435
Rectum adenocarcinoma_READ_TCGA-F5-6571-01A-12R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Vascular disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.189
VZ in rostral cingulate neocortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.976888
KYSE-450	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.867461
GTEX-U8XE-0926-SM-3DB8V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.93056
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4775-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TERT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31731
VZ in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.913293
Ileocecum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.233
ZFAND2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88926
RAD21_MEL cell line_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
C1QL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.2152
external granular (germinal) layer of upper rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.16001
clear cell sarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.790902
TOP3B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.6302
u266	HPA Cell Line Gene Expression Profiles	1.0	1.22524
H3K4me3_megakaryocyte_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-Q2AH-1526-SM-48TZG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.0098
lateral tuberal nuclei	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.880455
Sarcoma_SARC_TCGA-HB-A3L4-01A-11R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SN8G-0008-SM-4DM4X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
NHLF	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-1.77229
Mesocotyl	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.978
BT20	CCLE Cell Line Gene CNV Profiles	1.0	2.97489
IHH-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-NPJ8-1626-SM-2HMIY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.841701
retina	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.083288
8MGBA	DepMap CRISPR Gene Dependency	1.0	4.85751
CALU1	DepMap CRISPR Gene Dependency	1.0	2.0495
GTEX-PSDG-0426-SM-2S1OF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
CAKI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.879354
U87MG	DepMap CRISPR Gene Dependency	1.0	2.69234
CTCF_MEL cell line_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
AMER1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18516
VZ in midcingulate neocortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.5783
GTEX-T5JW-0008-SM-4DM5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.07247
endometrium_5a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.38865
GTEX-U4B1-0226-SM-4DXU8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11704
EHD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21695
GTEX-N7MS-0008-SM-4E3JI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14858
lateral hemisphere of cerebellum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.1251
CRYBG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.00492
POLR2AphosphoS5_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-PX3G-2026-SM-48U1H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.954886
TCC-PAN2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.879354
ZDHHC19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74068
L428	DepMap CRISPR Gene Dependency	1.0	4.16735
Cardiovascular system disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.189
NCIH209	CCLE Cell Line Gene CNV Profiles	-1.0	-1.4184
GTEX-XUZC-0326-SM-4BOO8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
NEU1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5921
GTEX-S3XE-0008-SM-3NM8O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-PSDG-1026-SM-48TCV	GTEx Tissue Sample Gene Expression Profiles	1.0	1.86704
RELB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.4097
binding	GO Molecular Function Annotations 2015	1.0	null
SNU-C2B	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTCF_kidney_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCI-H441 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.759
IZ in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.42095
NHERF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.2348
H3K27me3_erythroblast_mm9_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-RVPU-0008-SM-3NM8B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
496100567_PCx_no dementia_TBI_87_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16255
Lung adenocarcinoma_LUAD_TCGA-97-8547-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-NPJ7-0008-SM-4E3JS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.14225
USF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.1573
GTEX-Q2AI-1526-SM-3GIJ3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
Pancreatic adenocarcinoma_PAAD_TCGA-LB-A8F3-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RUNX1-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MV-01A-21R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QMR6-0008-SM-447AV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.836941
GSE238005_5_v_3_c9orf72_human	RummaGEO Gene Perturbation Signatures	-1.0	null
heart_6b	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.07047
GTEX-S7SE-0326-SM-4AT5Q	GTEx Tissue Sample Gene Expression Profiles	1.0	0.908119
Ceratobranchial	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.719
GTEX-OXRO-0226-SM-3LK6F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.880383
Gastrointestinal system disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	1.329
GTEX-U412-0008-SM-4DXTE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GSE180525,GSE180528_1_v_3_tbx3_human	RummaGEO Gene Perturbation Signatures	1.0	null
INTS6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.0479
CCND1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56081
PKNOX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.56328
GTEX-QV44-0526-SM-2S1RE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.832291
CTCF_CH12.LX_mm9_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF384	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	107.408
ZNF131	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.10833
SKGT2	DepMap CRISPR Gene Dependency	1.0	3.30434
HSPA1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69775
hsa-miR-769-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.997906
disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.260538
KMS-12-PE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.801
GTEX-U3ZM-0008-SM-4DXTQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.927674
GSE118077_1_v_8_sprr5_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-XMD1-0011-R11A-SM-4AT5J	GTEx Tissue Sample Gene Expression Profiles	1.0	0.988435
hsa-miR-1915	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
hsa-miR-4640-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
TRIM33	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.35081
GTEX-UJMC-0626-SM-4IHJQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83239
GTEX-X62O-0005-SM-46MV1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08259
CA14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99036
EPLC-272H	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.879354
GTEX-XPT6-0001-SM-4B64G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
VZ in hypothalamic portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.53933
MAPK14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65236
Lung adenocarcinoma_LUAD_TCGA-50-7109-01A-11R-2039-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
male reproductive gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.24804
FHL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.63592
lung_4a	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.23351
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A3Z3-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NEIL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.02442
liver_c	HPA Tissue Sample Gene Expression Profiles	-1.0	-1.10799
NUDT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68763
NCI-H146	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.14872
Head and Neck squamous cell carcinoma_HNSC_TCGA-F7-A61V-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QEG5-0926-SM-2TC64	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.0264
PPARD	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.4327
LOX-1_OE_GDS4262_435_human_HAECT - aortic endothelial cell line - 24 Hours	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
GTEX-QESD-0008-SM-447B2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
testis_7f	HPA Tissue Sample Gene Expression Profiles	1.0	1.26203
EBF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.71149
GTEX-XXEK-0008-SM-4BRW7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.845814
BRD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55349
GSE216043_11_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-OOBJ-1826-SM-3NB1C	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23216
PMC9314667-Table_1.xlsx-Regulons-TFAP2B_TFAP2B	Rummagene Transcription Factor Associations 2026	1.0	null
TAF1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.79062
GTEX-RU1J-1926-SM-2TF6S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.99101
C6/36 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.382
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5001-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KLHL24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.40915
GTEX-S4Z8-0006-SM-3K2AQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.47234
skeletalmuscle_d	HPA Tissue Sample Gene Expression Profiles	-1.0	-0.888664
SW1463	COSMIC Cell Line Gene Mutation Profiles	1.0	null
marrow	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.265725
Lung adenocarcinoma_LUAD_TCGA-55-A4DF-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCIN87	DepMap CRISPR Gene Dependency	1.0	2.1385
Ovary	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.024
GSE121824,GSE121826_0_v_8_scaf8_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-TML8-0008-SM-4DXUI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.09945
G112	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869988
Lung adenocarcinoma_LUAD_TCGA-62-8402-01A-11R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XYKS-0426-SM-4BRW4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20554
H3K4me1_erythroblast_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-WFG8-2326-SM-3GILF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SW620	CCLE Cell Line Gene CNV Profiles	1.0	2.07942
GTEX-S33H-0726-SM-4AD6M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.86744
adrenal gland	HPA Tissue Protein Expression Profiles	1.0	0.762372
GTEX-S3XE-1526-SM-4AD5A	GTEx Tissue Sample Gene Expression Profiles	1.0	1.03641
GSE236502_2_v_3_paclitaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-B9-A69E-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BSG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45139
KP-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.37874
MYCN-27167114-CHIP-SEQ-NEUROBLASTOMA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
SEC14L5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83054
GTEX-U8XE-0126-SM-4E3I3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19369
Lung squamous cell carcinoma_LUSC_TCGA-66-2777-01A-01R-1201-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STK38L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94178
chr16_69988630_T_C_b38	GTEx eQTL 2025	1.0	9.07578
Y79	DepMap CRISPR Gene Dependency	1.0	2.61459
SNX21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.8629
GATA2	ENCODE Transcription Factor Targets	1.0	null
MYOD1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.8482
H3K4me1_G1E-ER4_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
basal ganglion	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
chr16_70000831_G_A_b38	GTEx eQTL 2025	1.0	1.97117
IRF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.9779
upper (rostral) rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.39112
heart	GTEx Tissue Gene Expression Profiles	-1.0	-1.50952
GTEX-XQ8I-1726-SM-4BOQB	GTEx Tissue Sample Gene Expression Profiles	1.0	0.895214
GTEX-OHPM-2126-SM-3LK75	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20353
GTEX-NFK9-1326-SM-3LK5I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.7134
GSE171175,GSE171181_1_v_0_e7107_human	RummaGEO Drug Perturbation Signatures	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YN-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE183335,GSE183351_1_v_0_lin28b_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-FS-A4FB-06A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-4151-01A-01R-1188-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
pleomorphic liposarcoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	1.15837
GTEX-S7SE-0011-R8A-SM-2XCDG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.00896
H3K4me1_small intestine_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GATA2_G1E-ER4_mm9_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
496100339_HIP_no dementia_TBI_79_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.15918
SH3GLB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69872
Brain Lower Grade Glioma_LGG_TCGA-DU-A7TJ-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TCF3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.9226
Body mass index	GWAS Catalog SNP-Phenotype Associations 2025	1.0	1.0301
rectum	HPA Tissue Protein Expression Profiles	1.0	0.762372
intestine	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
HSC5	DepMap CRISPR Gene Dependency	1.0	3.4839
GTEX-PX3G-2426-SM-48TZZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
SOHLH2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.3381
SEPHS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.78893
MIER2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.92521
SG in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.826195
GTEX-OIZG-1126-SM-2HMIU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.843953
GTEX-PX3G-0226-SM-3NB2C	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
GTEX-SNMC-0008-SM-4DM5A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.861627
USF1	ENCODE Transcription Factor Targets	1.0	null
496100557_TCx_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.16098
SOX3-22085726-NPCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
stomach	HPA Tissue Protein Expression Profiles	1.0	2.35402
GTEX-XUW1-1126-SM-4BONZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.25054
GMEB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12045
testis_7b	HPA Tissue Sample Gene Expression Profiles	1.0	1.27214
GTEX-RTLS-0926-SM-2TF5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.878575
COPS4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.15546
CLDN19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.29956
CDK3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55097
MONOMAC6	CCLE Cell Line Gene CNV Profiles	-1.0	-1.36043
telencephalon	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-T5JC-0008-SM-4DM6A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.922296
GSE189609_1_v_2_hax1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
ATP5MGL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33349
GTEX-QDVN-2426-SM-2S1Q4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.52825
extracellular region	LOCATE Predicted Protein Localization Annotations	1.0	null
Epidermal growth factor-like domain	InterPro Predicted Protein Domain Annotations	1.0	null
SKIC8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.79275
ZFP90	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5192
Prostate adenocarcinoma_PRAD_TCGA-QU-A6IL-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
UMUC7	DepMap CRISPR Gene Dependency	1.0	3.34083
DHRS7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60279
HUH7	CCLE Cell Line Gene CNV Profiles	-1.0	-3.11015
GTEX-PSDG-0008-SM-48TE5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.10901
EFM-192B	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.00815
Penis_Foreskin_Melanocyte_Primary_Cells_skin01	Roadmap Epigenomics Cell and Tissue Gene Expression Profiles	-1.0	-0.945455
GTEX-UPJH-0926-SM-4IHKA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2348
Liver hepatocellular carcinoma_LIHC_TCGA-FV-A495-01A-11R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TTC549	DepMap CRISPR Gene Dependency	1.0	3.85422
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-7045-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
YWHAB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78938
SUM149PT	DepMap CRISPR Gene Dependency	1.0	3.56606
GSE135350_2_v_7_dexamethasone_human	RummaGEO Drug Perturbation Signatures	1.0	null
DHCR24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.85564
cellular_component	GO Cellular Component Annotations 2015	1.0	null
myb_16205643_primary_monocytes_gof_human_gpl570_gse2816	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.66894
GTEX-SJXC-2026-SM-4DM6N	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.978748
GTEX-WFG7-0826-SM-3GIKU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-1.15569
Prostate adenocarcinoma_PRAD_TCGA-KK-A8IH-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXB9_02_15	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	-1.0	-0.61667
GTEX-REY6-0926-SM-48FDA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.15697
LBH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77006
GTEX-TMMY-1126-SM-4DXSX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.89546
H3K4me1_olfactory bulb_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
H3K4me1_ES-Bruce4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
MG-63	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.39053
C-type lectin fold	InterPro Predicted Protein Domain Annotations	1.0	null