association	dataset	threshold value	standardized value
FOSB::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.1813
MEIS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.3672
CTCF_HeLa-S3_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NRL	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.2737
COV413B	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.987179
ventrolateral prefrontal cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.70141
Leukemialymphoblastic(MOLT-4)	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.868822
Uterine Carcinosarcoma_UCS_TCGA-N8-A4PN-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
membrane	LOCATE Predicted Protein Localization Annotations	1.0	null
HT	CCLE Cell Line Gene Expression Profiles	1.0	1.57656
dorsal thalamus_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.04106
SW1353	CCLE Cell Line Gene Expression Profiles	-1.0	-2.68715
ME1	CCLE Cell Line Gene Expression Profiles	1.0	1.78488
HDAC6	ENCODE Transcription Factor Targets	1.0	null
DEL	CCLE Cell Line Gene CNV Profiles	1.0	1.99602
primary somatosensory cortex (area S1, areas 3,1,2)_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.968517
SKNFI	CCLE Cell Line Gene CNV Profiles	-1.0	-2.86967
NCI-H1734	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.891845
ZNF35	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.6506
SNU16	CCLE Cell Line Gene Expression Profiles	-1.0	-3.03913
A3/KAW	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
PrefrontalCortex	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.12001
Lung squamous cell carcinoma_LUSC_TCGA-39-5040-01A-21R-2125-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4595011-pgen.1005555.s003.xlsx-MITF_DOWN-regulated-Gene_name_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
regulation of biological process	GO Biological Process Annotations 2015	1.0	null
HCC2185	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.699115
CTCF_Caco-2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3434-01A-02R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5J1-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GATA1_erythroblast_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HCC4011	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.22478
496100622_HIP_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.23709
SNU-283	COSMIC Cell Line Gene Mutation Profiles	1.0	null
COLO800	CCLE Cell Line Gene Expression Profiles	-1.0	-1.82656
Brain Lower Grade Glioma_LGG_TCGA-DU-6399-01A-12R-1708-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H1048	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04975
Brain Lower Grade Glioma_LGG_TCGA-HT-8563-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
primary motor cortex (area M1, area 4)_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.871777
NCI-H1792	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.67889
QGP-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.10488
GSE210476_2_v_1_rutaecarpine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
hsa-miR-3163	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
BON-1 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.775
CTCF_K562_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
OKAJIMA	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.29489
NCIH292	DepMap CRISPR Gene Dependency	1.0	2.04708
eGFP-JUNB_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_GM12875_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
C4II	DepMap CRISPR Gene Dependency	1.0	2.67591
NUDUL1	CCLE Cell Line Gene Expression Profiles	1.0	1.63611
CBX3_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
hsa-miR-371-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
ZR-75-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.34381
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7CK-01A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
integral component of membrane	GO Cellular Component Annotations 2015	1.0	null
Esophagus - Gastroesophageal Junction	GTEx Tissue Gene Expression Profiles 2023	1.0	7.2018
FOS::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.4052
orbital frontal cortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.893584
Lung adenocarcinoma_LUAD_TCGA-05-4382-01A-01R-1206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Mesothelioma_MESO_TCGA-SC-A6LQ-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PC3	DepMap CRISPR Gene Dependency	1.0	3.59969
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7H7-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_K562_hg19_7	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GATA6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.1877
NCIH1869	CCLE Cell Line Gene CNV Profiles	1.0	1.62798
RERF-LC-OK	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.34066
Asthma_Epithelial Cell_GSE4302	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.45194
JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.6951
IRF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.0592
E2F4	ENCODE Transcription Factor Targets	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MY-01A-11R-A26W-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GATA3_SK-N-SH_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SF126	DepMap CRISPR Gene Dependency	1.0	3.33658
16542501-SuppTable3	GeneSigDB Published Gene Signatures	1.0	null
detection of stimulus	GO Biological Process Annotations 2015	1.0	null
PK59	CCLE Cell Line Gene CNV Profiles	-1.0	-1.73713
Sensory Perception	Reactome Pathways 2024	1.0	null
CTCF_MCF-7_hg19_8	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7XC-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PF-382	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Olfactory receptor	InterPro Predicted Protein Domain Annotations	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-S9-A89V-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SRY	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.0
hsa-miR-4698	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
GFI1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.7826
Prostate adenocarcinoma_PRAD_TCGA-J9-A8CL-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-UC-A7PD-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-4667-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
HOXD9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	49.1449
NCIH82	CCLE Cell Line Gene Expression Profiles	-1.0	-1.50491
MYC	ENCODE Transcription Factor Targets	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-EJ-7115-11A-01R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-548u	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
TBX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.5022
Acute Myeloid Leukemia_LAML_TCGA-AB-2854-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7472-01A-11R-2027-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE128634,GSE128636_4_v_3_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
NCI-H1437	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.90265
NCI-H1770	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.5822
CTCF_HEK293_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-RY-A83Z-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Tietz syndrome	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.134
KDM5A	ENCODE Transcription Factor Targets	1.0	null
CTCF_GM12865_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCIH1792	CCLE Cell Line Gene CNV Profiles	-1.0	-1.44315
CAL33	DepMap CRISPR Gene Dependency	1.0	3.72132
CTCF_GM12878_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
G96	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.44502
SNU-1040	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PPARG	JASPAR Predicted Transcription Factor Targets	1.0	null
dorsal thalamus_12 pcw_F_12960	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.06125
POU5F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.1943
Pancreatic adenocarcinoma_PAAD_TCGA-FB-A7DR-01A-21R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-548p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
hsa-miR-3670	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
hsa-miR-4700-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
Skmes	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.102
ATF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	34.3808
HCC-44	COSMIC Cell Line Gene Mutation Profiles	1.0	null
FOSL2::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.2093
EKVX	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTCF_BE2C_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCI-H1915	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.05512
hsa-miR-1323	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
NCIH2227	CCLE Cell Line Gene Expression Profiles	-1.0	-1.58562
CTCF_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC4595011-pgen.1005555.s003.xlsx-MITF_DOWN-regulated-Ensembl_gene_id_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5694-11A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CHP-212	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.15433
H3K9me3_fibroblast of lung_hg19_3	ENCODE Histone Modification Site Profiles	1.0	null
PA-TU-8902	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869352
SW1271	COSMIC Cell Line Gene CNV Profiles	1.0	2.64759
NCI-H661	COSMIC Cell Line Gene Mutation Profiles	1.0	null
TBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.3729
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A3Z3-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-WY-A85B-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H1703	COSMIC Cell Line Gene Mutation Profiles	1.0	null
IREB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.10373
NFATC1_02_22	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.08746
Brain Lower Grade Glioma_LGG_TCGA-TM-A84F-01A-11R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WM115	DepMap CRISPR Gene Dependency	1.0	3.15032
OCIAML2	DepMap CRISPR Gene Dependency	1.0	4.69117
Olfactory Signaling Pathway	Reactome Pathways 2024	1.0	null
CAL-12T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.893461
CTCF_GM12873_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-66-2789-01A-01R-0980-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_GM12873_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_HepG2_hg19_5	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HOXC11	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.3865
Acute lymphoblastic leukemia (childhood)	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.51549
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A29C-06A-21R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ERF::SREBF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.6328
primary auditory cortex (core)_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.15549
G112	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10107
Expression and translocation of olfactory receptors	Reactome Pathways 2024	1.0	null
primary somatosensory cortex (area S1, areas 3,1,2)_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.29182
EBC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.27085
DMRTC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.3368
NCIH747	CCLE Cell Line Gene Expression Profiles	-1.0	-1.99687
G120	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869352
Supraspliceosomal complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.062
NCI-H2804	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.47681
Pancreatic adenocarcinoma_PAAD_TCGA-IB-A5ST-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hippocampus (hippocampal formation)_19 pcw_F_12885	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.839857
detection of chemical stimulus involved in sensory perception of smell	GO Biological Process Annotations 2023	1.0	null
IST-MEL1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-FG-8188-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ICC2	DepMap CRISPR Gene Dependency	1.0	2.41972
Brain Lower Grade Glioma_LGG_TCGA-DH-5142-01A-01R-1470-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXB8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.5883
primary somatosensory cortex (area S1, areas 3,1,2)_4 mos_M_12296	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.2463
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-IR-A3LF-01A-21R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
primary motor cortex (area M1, area 4)_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.848573
hsa-miR-371b-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
hippocampus (hippocampal formation)_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.865482
CTCF_H1-hESC_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KYSE-150	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ESS-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-YJ-A8SW-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-64-5779-01A-01R-1628-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TMK-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NR4A1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	43.1215
posteroventral (inferior) parietal cortex_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.69423
CTCF_epithelial cell of proximal tubule_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SK-MEL-5 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.592
COR-L105	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Sarcoma_SARC_TCGA-DX-A7EI-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCMCRM2	DepMap CRISPR Gene Dependency	1.0	4.07121
OTX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.0426
GPCR downstream signaling	Reactome Pathways 2014	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A81I-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_GM12866_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_GM06990_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
COLGALT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.8327
POU2F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.6382
EZH2	ENCODE Transcription Factor Targets	1.0	null
inferolateral temporal cortex (area TEv, area 20)_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.93421
TCF7L2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.6817
LN-18	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.943711
KYSE-270	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38572
CTCF_brain microvascular endothelial cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBR1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.5293
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-GS-A9TV-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WSU-FSCCL	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.949401
POU3F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.1285
occipital neocortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.949824
biological regulation	GO Biological Process Annotations 2015	1.0	null
KYM1	DepMap CRISPR Gene Dependency	1.0	5.06589
496100320_PCx_no dementia_TBI_79_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.01503
Prostate adenocarcinoma_PRAD_TCGA-J4-A67T-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CAL148	CCLE Cell Line Gene CNV Profiles	1.0	1.36047
Prostate adenocarcinoma_PRAD_TCGA-EJ-A46D-01A-21R-A32Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
C75	DepMap CRISPR Gene Dependency	1.0	3.67419
PC3	CCLE Cell Line Gene CNV Profiles	1.0	1.66897
SMC3	ENCODE Transcription Factor Targets	1.0	null
RAD21	ENCODE Transcription Factor Targets	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2806-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KMS21BM	CCLE Cell Line Gene Expression Profiles	1.0	1.5684
U266B1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.15433
PMC12021535-CPH4-15-e70011-s001.xlsx-S21-KLF2_KLF2	Rummagene Transcription Factor Associations 2026	1.0	null
cSARS Bat SRBD_48Hour_None_GSE37827	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	2.01366
SN12C	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-FJ-A871-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-IQ-A6SH-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SOX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.7908
JIYOYE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.05317
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7H5-01B-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-8637-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
amygdaloid complex_21 yrs_F_13057	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.22717
YY1	MotifMap Predicted Transcription Factor Targets	1.0	null
KDM5A_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HCC1428	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09122
CTCF	ENCODE Transcription Factor Targets	1.0	null
detection of chemical stimulus involved in sensory perception of smell	GO Biological Process Annotations 2015	1.0	null
RUNX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.2622
Brain Lower Grade Glioma_LGG_TCGA-DU-5855-01A-11R-1708-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOSL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.9872
SRF	JASPAR Predicted Transcription Factor Targets	1.0	null
cell periphery	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
NCIN87	CCLE Cell Line Gene Expression Profiles	-1.0	-1.56775
Nose	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.335
primary visual cortex (striate cortex, area V1/17)_12 pcw_F_12835	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.06917
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A57G-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-GV-A40E-01A-12R-A23N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
olfactory receptor activity	GO Molecular Function Annotations 2023	1.0	null
CH157MN	CCLE Cell Line Gene CNV Profiles	-1.0	-1.66225
DEL	DepMap CRISPR Gene Dependency	1.0	3.78746
A-VN-1203-2004(H5N1)_Day4-10^4pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-2.201
melanoma cell line	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
KPL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.98876
GSE119978,GSE180930_0_v_8_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
OPM-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.3459
HCC515	DepMap CRISPR Gene Dependency	1.0	3.33594
RAB41	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15397
fallopian tube	GTEx Tissue Gene Expression Profiles	-1.0	-2.10021
hsa-miR-873	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A2JC-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
acute lymphoblastic leukemia (childhood)	GAD Gene-Disease Associations	1.0	null
SUPM2	CCLE Cell Line Gene Expression Profiles	-1.0	-1.74712
G protein-coupled receptor, rhodopsin-like	InterPro Predicted Protein Domain Annotations	1.0	null
SRF	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.739
NCI-H2009 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.31
primary visual cortex (striate cortex, area V1/17)_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.36076
CTCF_GM12878_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NFATC4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.0233
MEF2C	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	49.6686
TBX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.4507
LCAM1	DepMap CRISPR Gene Dependency	1.0	3.62615
184A1N4	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.746564
Head and Neck squamous cell carcinoma_HNSC_TCGA-DQ-7591-01A-11R-2081-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MELHO	CCLE Cell Line Gene CNV Profiles	-1.0	-1.51081
Melanoma cell line	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Brain Lower Grade Glioma_LGG_TCGA-HT-7689-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OS252	DepMap CRISPR Gene Dependency	1.0	3.49279
Thyroid adenoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.045
H3K27me3_GM12878_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
BT-474	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.17944
melanocyte	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
olfactory receptor activity	GO Molecular Function Annotations 2015	1.0	null
NCI-H187	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.44502
COV413A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.904676
COLO 792	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.842868
HDQP1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.34166
G130	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.996008
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A148-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4595011-pgen.1005555.s001.xlsx-MITF_DOWN-regulated-Gene_name_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
CA SKI	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.69425
REH	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GATA1	ENCODE Transcription Factor Targets	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-34-5236-01A-21R-1820-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SNU46	CCLE Cell Line Gene CNV Profiles	1.0	1.55993
orbital frontal cortex_15 yrs_M_12299	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.99286
REH cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.519
inferolateral temporal cortex (area TEv, area 20)_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.09081
COLO741	CCLE Cell Line Gene Expression Profiles	1.0	2.62287
SW1271	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTL-16	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.49094
EFM-19	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10291
Lung squamous cell carcinoma_LUSC_TCGA-21-1083-01A-01R-0692-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MAP2K1_knockdown_134_GSE31534	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	1.0	1.56227
SK-N-AS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.15061
DU4475	CCLE Cell Line Gene CNV Profiles	1.0	1.76668
primary motor cortex (area M1, area 4)_30 yrs_F_12290	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.955978
GSE102870_7_v_9_nr1h4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
CDX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.8035
iPS-20b Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	1.05731
RARA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	103.62
hsa-miR-548o	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
HSF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.3129
SCC-15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.38572
SK-MES-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.901243
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
A3KAW	DepMap CRISPR Gene Dependency	1.0	2.92097
Rectum adenocarcinoma_READ_TCGA-AG-4022-01A-01R-1736-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CiliaryGanglion	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.939294
GATA3	ENCODE Transcription Factor Targets	1.0	null
SKMEL28	CCLE Cell Line Gene Expression Profiles	1.0	3.40798
CTCF_MCF-7_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
posteroventral (inferior) parietal cortex_16 pcw_M_12287	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.55626
HS 578T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.944546
cSARS Bat SRBD_60Hour_None_GSE37827	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.26815
Prostate adenocarcinoma_PRAD_TCGA-EJ-5506-01A-01R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B2-5635-01A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_K562_hg19_5	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RPMI 8226	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.901243
MONOMAC1	CCLE Cell Line Gene Expression Profiles	1.0	1.88316
Head and Neck squamous cell carcinoma_HNSC_TCGA-UF-A7JA-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-3922-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
17823238-TableS5	GeneSigDB Published Gene Signatures	1.0	null
plasma membrane	GO Cellular Component Annotations 2015	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3427-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
prostate	GTEx Tissue Gene Expression Profiles	1.0	2.18749
U-2932	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.27827
SHI1	DepMap CRISPR Gene Dependency	1.0	3.37778
PMC3470785-NIHMS377161-supplement-3.pdf-325-ZNF575_ZNF575	Rummagene Transcription Factor Associations 2026	1.0	null
CTCF_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-NF-A4WU-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr1_247510838_T_C_b38	GTEx eQTL 2025	1.0	1.07215
GSE128634,GSE128636_1_v_3_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-592	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
UT7	CCLE Cell Line Gene Expression Profiles	1.0	1.82357
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A3HF-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DV-90	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
posterior (caudal) superior temporal cortex (area 22c)_13 pcw_M_12820	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.945142
MDAMB436	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.699183
CTCF_WERI-Rb-1_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SUDHL4	CCLE Cell Line Gene CNV Profiles	-1.0	-2.63998
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A1QB-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Rectum adenocarcinoma_READ_TCGA-AH-6643-11A-01R-1830-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.23541
GSE148657_2_v_0_cd44_human	RummaGEO Gene Perturbation Signatures	-1.0	null
mediodorsal nucleus of thalamus_21 yrs_F_13057	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.65699
NCI-H2342	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HNF4G	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.5664
Kidney Chromophobe_KICH_TCGA-KO-8404-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BNC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.2969
ZNF140	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.1158
PAX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.8071
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A1M5-01A-11R-A13Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CHAGOK1	CCLE Cell Line Gene CNV Profiles	1.0	1.53843
ZR-75-30	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.86108
JUN	JASPAR Predicted Transcription Factor Targets	1.0	null
721_B_lymphoblasts	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-0.898871
NFATC3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.0026
Prostate adenocarcinoma_PRAD_TCGA-XJ-A9DX-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC2885	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869352
TC-71	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CAOV-4	COSMIC Cell Line Gene CNV Profiles	1.0	2.64759
SOX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.7554
SF295	CCLE Cell Line Gene Expression Profiles	-1.0	-1.70616
ESRRB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.8795
TTC549	DepMap CRISPR Gene Dependency	1.0	3.88942
Prostate adenocarcinoma_PRAD_TCGA-EJ-5494-01A-01R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HCC38	CCLE Cell Line Gene CNV Profiles	1.0	1.76827
NCI-H1568	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.841192
FOXD2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	41.7727
CTCF_GM12869_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
BACH1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.6335
KATO III	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.97049
SUDHL6	CCLE Cell Line Gene Expression Profiles	1.0	2.10734
VAX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	12.819
BT-474	COSMIC Cell Line Gene CNV Profiles	1.0	2.64759
hsa-miR-874	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
NKX6-3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.4237
posterior (caudal) superior temporal cortex (area 22c)_12 pcw_F_13060	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.899462
KMS11	CCLE Cell Line Gene Expression Profiles	1.0	2.25048
SOX13	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.7581
CTCF_HEK293_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KP3	DepMap CRISPR Gene Dependency	1.0	2.08128
hsa-miR-3117-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
Brain Lower Grade Glioma_LGG_TCGA-P5-A5EY-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HOXD8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.653
KARPAS-45	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTCF_MCF-7_hg19_7	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HS729	CCLE Cell Line Gene CNV Profiles	-1.0	-1.59731
OVSAHO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.996008
hsa-miR-3130-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
CORL23	DepMap CRISPR Gene Dependency	1.0	4.43418
HCC2157	COSMIC Cell Line Gene CNV Profiles	1.0	2.64759
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-A54I-01A-21R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CAL78	CCLE Cell Line Gene CNV Profiles	-1.0	-1.45751
whole body	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
OVKATE	CCLE Cell Line Gene CNV Profiles	1.0	1.48873
integral component of membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
cell part	GO Cellular Component Annotations 2015	1.0	null
KMS-26	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.86102
plasma membrane	LOCATE Predicted Protein Localization Annotations	1.0	null
membrane	GO Cellular Component Annotations 2015	1.0	null
NCI-H1781	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.8903
PMC6063960-41598_2018_29472_MOESM5_ESM.xlsx-lightcyan_module_HF-DMRTB1_DMRTB1	Rummagene Transcription Factor Associations 2026	1.0	null
GATA3_SK-N-SH_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.998131
SREBF1	JASPAR Predicted Transcription Factor Targets	1.0	null
H1 Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	1.09681
UACC-812	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.13058
SKNO1	CCLE Cell Line Gene CNV Profiles	1.0	1.47209
SW 480	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869352
MGA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.5976
Lymphoma_burkitts(Raji)	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.57264
hsa-miR-339-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
CTCF_HeLa-S3_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCIH2196	CCLE Cell Line Gene CNV Profiles	-1.0	-1.59891
Olfactory receptor neuron	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.559
Acute Myeloid Leukemia_LAML_TCGA-AB-2904-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-670	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
detection of chemical stimulus involved in sensory perception	GO Biological Process Annotations 2023	1.0	null
HCC56	DepMap CRISPR Gene Dependency	1.0	2.98671
hsa-miR-548ac	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
NCIH322	DepMap CRISPR Gene Dependency	1.0	2.1034
CTCF_MCF-7_hg19_9	ENCODE Transcription Factor Binding Site Profiles	1.0	null
AGS	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
MCC13	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Skeletal Muscle Female	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-0.839089
mediodorsal nucleus of thalamus_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.38815
MJ	DepMap CRISPR Gene Dependency	1.0	2.39061
Lung adenocarcinoma_LUAD_TCGA-64-5775-01A-01R-1628-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5UL-06A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-875-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
BT474	CCLE Cell Line Gene CNV Profiles	1.0	2.59934
CTCF_GM12874_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
496100464_FWM_no dementia_no TBI_89_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.21279
OVSAHO	CCLE Cell Line Gene Expression Profiles	-1.0	-2.0943
KURAMOCHI	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.31834
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-4863-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H2196	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.80325
SBC-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
biological_process	GO Biological Process Annotations 2015	1.0	null
NKX6-1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.82
ZBTB17	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.2886
FOXF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.5606
inferolateral temporal cortex (area TEv, area 20)_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.35519
SKMEL5	CCLE Cell Line Gene Expression Profiles	1.0	1.94462
TEAD4_K562_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF211	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.5264
SETDB1_02_52	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	2.5025
primary somatosensory cortex (area S1, areas 3,1,2)_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.23287
epidermal cell	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ML1	CCLE Cell Line Gene Expression Profiles	-1.0	-1.7006
hsa-miR-146b-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
SIX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3005
Colon adenoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.068
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EA-A3HR-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
STAT1	JASPAR Predicted Transcription Factor Targets	1.0	null
hsa-miR-4680-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
NCI-H1793	COSMIC Cell Line Gene Mutation Profiles	1.0	null
detection of stimulus involved in sensory perception	GO Biological Process Annotations 2015	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-6933-11A-01R-1915-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JR	DepMap CRISPR Gene Dependency	1.0	2.79782
ZNF677	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.4959
MEF2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.4342
intrinsic component of membrane	GO Cellular Component Annotations 2015	1.0	null
CTCF_retinal pigment epithelial cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
cerebellar cortex_15 yrs_M_12299	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.874056
SW 1116	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04506
cerebellar cortex_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.3954
HCC1599	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	3.18628
JUN::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.4983
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5083-01A-02R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100359_PCx_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.44166
inferolateral temporal cortex (area TEv, area 20)_2 yrs_F_12979	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.29565
496100362_FWM_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.53166
184B5	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.40807
TCF7L1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	40.0156
CUX1-19635798-MULTIPLE-CANCER-TYPES-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
CTCF_GM19240_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SW684	COSMIC Cell Line Gene Mutation Profiles	1.0	null
496100394_TCx_probable Alzheimer's disease_no TBI_85_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.06685
Prostate adenocarcinoma_PRAD_TCGA-YL-A8SO-01B-31R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4882-01A-02R-1426-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr1_247491691_T_C_b38	GTEx eQTL 2025	1.0	1.90894
upper (rostral) rhombic lip_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.47135
primary visual cortex (striate cortex, area V1/17)_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.06917
MKN-45	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.97049
HCC1419	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-2.33815
TBX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.3729
g-protein coupled receptor activity	GO Molecular Function Annotations 2015	1.0	null
CAR-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.10107
CBX3	ENCODE Transcription Factor Targets	1.0	null
ME-180	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.08105
CTCF_A549_hg19_7	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_H54_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-BT-A2LA-01A-11R-A18C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-D3-A2JG-06A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MDA-MB-453	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.18169
HOXC10	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.6458
detection of chemical stimulus involved in sensory perception of smell	GO Biological Process Annotations 2025	1.0	null
D-336MG	COSMIC Cell Line Gene Mutation Profiles	1.0	null
cell part	LOCATE Predicted Protein Localization Annotations	1.0	null
Heart	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.13571
GSE134029_3_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
DBP	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.1013
posteroventral (inferior) parietal cortex_4 yrs_M_12298	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.11589
membrane part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
PK-59	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.86102
HCC193	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.29563
Skeletal Muscle Male	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-1.01273
SET2	DepMap CRISPR Gene Dependency	1.0	3.73765
primary auditory cortex (core)_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.30805
EFM19	DepMap CRISPR Gene Dependency	1.0	2.4193
DNMT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85424
U2OS	CCLE Cell Line Gene Expression Profiles	-1.0	-2.35759
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4712-11A-02R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SOX21	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.432
KMS-27	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.29145
HUNS1	DepMap CRISPR Gene Dependency	1.0	2.40909
ONS76	DepMap CRISPR Gene Dependency	1.0	2.32988
hippocampus (hippocampal formation)_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.961917
Lung adenocarcinoma_LUAD_TCGA-62-8399-01A-21R-2326-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
A-VN-1203-2004(H5N1)_Day7-10^2pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.8555
anterior (rostral) cingulate (medial prefrontal) cortex_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.24339
primary auditory cortex (core)_13 yrs_F_12831	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.29182
skin cancer cell	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.31705
Prostate adenocarcinoma_PRAD_TCGA-G9-6365-11A-01R-1789-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5KU-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A81H-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SCLY	ChEA Transcription Factor Targets	1.0	null
HCT-15	COSMIC Cell Line Gene Mutation Profiles	1.0	null
600MPE	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.358
496100466_PCx_probable Alzheimer's disease_no TBI_89_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	6.04488
cellular_component	GO Cellular Component Annotations 2015	1.0	null
CAL120	DepMap CRISPR Gene Dependency	1.0	2.75112
Liver hepatocellular carcinoma_LIHC_TCGA-G3-A7M9-01A-23R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11426526-ppat.1012555.s011.xlsx-DEG_MDDC_Jurkat_LPS_vs_MDDC_JK-Unnamed_5_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
GSE145249_1_v_3_ppm1g_human	RummaGEO Gene Perturbation Signatures	-1.0	null
hsa-miR-3928	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
CTCF_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HCC1599	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.968671
PMC11426526-ppat.1012555.s014.xlsx-DEG_DC_Jurkat_LPS_vs_DC_JK-Unnamed_5_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
P300-27058665-CHIP-SEQ-ZR-75-30CELLS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
SUM149PT	DepMap CRISPR Gene Dependency	1.0	2.49388
NCIH2347	CCLE Cell Line Gene Expression Profiles	1.0	1.46666
496100389_HIP_no dementia_TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	5.15764
SCL-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
primary somatosensory cortex (area S1, areas 3,1,2)_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.877212
intrinsic component of membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
Brain Lower Grade Glioma_LGG_TCGA-FG-5963-02A-12R-A29R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BIN67	DepMap CRISPR Gene Dependency	1.0	2.18108
ORMDL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46607
OACP4C	COSMIC Cell Line Gene CNV Profiles	1.0	2.64759
MKN45	CCLE Cell Line Gene CNV Profiles	-1.0	-1.68773
FOSL1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.1263
NALM16	DepMap CRISPR Gene Dependency	1.0	2.95489
DUXA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	36.8854
CTCF_HCT116_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZR7530	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.696117
Melanoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.258
G361	CCLE Cell Line Gene Expression Profiles	1.0	1.43628
SCC15	CCLE Cell Line Gene CNV Profiles	-1.0	-1.38926
GSE252958_1_v_0_znf469_human	RummaGEO Gene Perturbation Signatures	1.0	null
SNU685	CCLE Cell Line Gene Expression Profiles	-1.0	-1.67352
ventrolateral prefrontal cortex_36 yrs_M_12302	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.984699
CTCF_GM13977_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-4865-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
detection of chemical stimulus involved in sensory perception	GO Biological Process Annotations 2015	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4770-01A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H2198	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.64304
Lung adenocarcinoma_LUAD_TCGA-50-5931-01A-11R-1755-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
POU3F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.073
Acute Myeloid Leukemia_LAML_TCGA-AB-2995-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-KC-A7FA-01A-21R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
POU3F2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.45
Rectum adenocarcinoma_READ_TCGA-DC-6155-01A-11R-1660-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ATF4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.1061
cellular_component	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
MDAMB453	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.97958
hsa-miR-4421	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
Brain Lower Grade Glioma_LGG_TCGA-S9-A6TU-01A-12R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_MCF-7_hg19_5	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBX5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.6897
Klinefelter syndrome	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.134
FOSL1::JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.6813
OPM2	CCLE Cell Line Gene CNV Profiles	1.0	1.69544
OCI-AML3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
GSE128634,GSE128636_4_v_5_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
H3K9me3_fibroblast of lung_hg19_2	ENCODE Histone Modification Site Profiles	1.0	null
CAL-148	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.949401
ncih727	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.912
CTCF_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CD33+_Myeloid	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-0.96379
GSE196117_6_v_8_clarithromycin_human	RummaGEO Drug Perturbation Signatures	1.0	null
TP63	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.5558
MM253	DepMap CRISPR Gene Dependency	1.0	2.04734
GSE119978,GSE180930_0_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8YT-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
bone marrow	HPA Tissue Protein Expression Profiles	1.0	1.22046
amygdaloid complex_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.860033
hippocampus (hippocampal formation)_13 yrs_F_12831	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.14456
ZNF558	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	81.9679
Lung squamous cell carcinoma_LUSC_TCGA-56-8305-01A-11R-2296-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
dorsolateral prefrontal cortex_36 yrs_M_12302	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	2.16304
LP1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.53202
EZH2_T-cell acute lymphoblastic leukemia_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ISHIKAWAHERAKLIO02ER	DepMap CRISPR Gene Dependency	1.0	2.60991
A-VN-1203-2004(H5N1)_Day2-10^4pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-2.10369
HS821T	CCLE Cell Line Gene CNV Profiles	-1.0	-2.02424
COV434	DepMap CRISPR Gene Dependency	1.0	2.05521
MEWO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
MX-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.45132
Olfactory epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.411
Melanophore	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.626
SKLMS1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.67127
A-VN-1203-2004(H5N1)_Day2-10^3pfu_22074594_GSE33263	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.47474
GSE119978,GSE180930_6_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE119978,GSE180930_3_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
IRF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	62.5833
IGR37	CCLE Cell Line Gene Expression Profiles	1.0	2.42097
T84	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04584
GSE220806_0_v_3_progesterone_human	RummaGEO Drug Perturbation Signatures	1.0	null
Kidney Chromophobe_KICH_TCGA-KN-8429-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
WDR89	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.19429
CTCF_T-cell acute lymphoblastic leukemia_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TP63_01_202	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	4.93016
COLO-668	COSMIC Cell Line Gene Mutation Profiles	1.0	null
OUMS-23	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.996008
NCI-H810	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.944546
hsa-miR-371b-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
striatum_8 yrs_M_12841	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-3.70317
DOV13	CCLE Cell Line Gene CNV Profiles	-1.0	-1.62217
THP-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-VS-A8QM-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
primary somatosensory cortex (area S1, areas 3,1,2)_12 pcw_F_12960	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.01086
OVKATE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.40865
ETV2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.1778
POU3F4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.1413
GSE128634,GSE128636_2_v_0_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
animal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
HNF4A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	67.7831
sensory perception of smell	GO Biological Process Annotations 2025	1.0	null
FOSL2::JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.0502
G111	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.44575
PIK3CA_mutant_27_GDS4053	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	1.0	1.5647
SIX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.6343
SCL-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
SNU407	CCLE Cell Line Gene CNV Profiles	1.0	1.62876
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A3YQ-01A-11R-A22U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cancer	GAD High Level Gene-Disease Associations	1.0	0.293278
ESR1_KD_GDS4065_452_human_MCF7 estrogen-sensitive breast cancer cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.77819
posteroventral (inferior) parietal cortex_19 pcw_F_12885	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.1522
Brain Lower Grade Glioma_LGG_TCGA-DU-6542-01A-11R-1896-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EMC-BAC-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-EB-A5SF-01A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MSANTD3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.4443
496100557_TCx_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.76985
CTCF_GM12869_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC4269325-NIHMS634665-supplement-supp_table4.xls-H3K27me3_TRIM37_KD-Unnamed_2_AR	Rummagene Transcription Factor Associations 2026	1.0	null
CTCF_BE2C_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
LS-180	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTCF_HepG2_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TRPS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.9122
CTCF_HCT116_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_CD14-positive monocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
signaling receptor activity	GO Molecular Function Annotations 2015	1.0	null
MEL-HO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CHAGO-K-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
primary visual cortex (striate cortex, area V1/17)_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.84159
inferolateral temporal cortex (area TEv, area 20)_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.02628
HDAC6_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HMBOX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.7842
496100481_PCx_no dementia_no TBI_88_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.92739
HEL9217	DepMap CRISPR Gene Dependency	1.0	3.94255
MEL-HO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.53747
cellular_component	LOCATE Predicted Protein Localization Annotations	1.0	null
KCL-22	COSMIC Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-483-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
BARHL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	14.0316
H2AFZ	ENCODE Transcription Factor Targets	1.0	null
AU565	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE119978,GSE180930_0_v_7_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
TEAD4	ENCODE Transcription Factor Targets	1.0	null
NGP	DepMap CRISPR Gene Dependency	1.0	2.17493
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-HM-A3JJ-01A-21R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YN-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_GM06990_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
PMC4407272-elife06857s002.xlsx-501M_BRG1-MITF_ComDown-List-Ensembl_gene_id_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
MB1	DepMap CRISPR Gene Dependency	1.0	2.14895
FOS::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.5871
H3K9me3_skeletal muscle myoblast_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-DG-A2KM-01A-11R-A180-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pancreatic adenocarcinoma_PAAD_TCGA-3A-A9IC-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_13 yrs_F_12831	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.968508
Prostate adenocarcinoma_PRAD_TCGA-YL-A8S8-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H740	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE119978,GSE180930_2_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
CUX1-19635798-MULTIPLE HUMAN CANCER CELL TYPES-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
FOSL1::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.748
H4K20me1_HeLa-S3_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
KMS26	CCLE Cell Line Gene CNV Profiles	-1.0	-2.01999
U2904	DepMap CRISPR Gene Dependency	1.0	3.33075
SPIC	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.5139
NCIH1385	CCLE Cell Line Gene CNV Profiles	1.0	2.2913
hsa-miR-148a-3p	MiRTarBase microRNA Targets	1.0	null
SNU-484	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.857433
AMO-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.842868
hsa-miR-2355-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
CTCF_GM12866_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TBX19	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3669
SU-DHL-4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.74766
CTCF_HL-60_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_K562_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
MCF-7	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.894306
TBX20	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.2413
496100514_FWM_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	4.55475
CTCF_skin fibroblast_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
inferolateral temporal cortex (area TEv, area 20)_13 pcw_M_12820	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.17964
CTCF_kidney epithelial cell_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
hsa-miR-656	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
primary motor-sensory cortex (samples)_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.26723
NCIH1105	CCLE Cell Line Gene CNV Profiles	-1.0	-1.51995
Lung adenocarcinoma_LUAD_TCGA-44-6778-01A-11R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOS	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	41.0192
HL-60	COSMIC Cell Line Gene Mutation Profiles	1.0	null
mediodorsal nucleus of thalamus_8 yrs_M_12841	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.921155
ZNF143	ENCODE Transcription Factor Targets	1.0	null
D458	DepMap CRISPR Gene Dependency	1.0	3.60176
PMC4595011-pgen.1005555.s001.xlsx-MITF_DOWN-regulated-Ensembl_gene_id_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
GlobusPallidus	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.887938
CTCF_WERI-Rb-1_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-J7-8537-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BFTC-909	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.869352
MDAMB231	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.855465
GSE68925_1_v_0_fasudil_human	RummaGEO Drug Perturbation Signatures	-1.0	null
MEF2A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	53.2526
BHY	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.17813
CDX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.5376
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-5546-01A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
melanoma cell	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Olfactory transduction	KEGG Pathways 2026	1.0	null
THP1	CCLE Cell Line Gene CNV Profiles	1.0	1.91366
HOXA10	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	49.6267
CAOV4	CCLE Cell Line Gene CNV Profiles	1.0	3.2803
MM.1S	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.40865
hsa-miR-4514	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
RERFLCKJ	CCLE Cell Line Gene Expression Profiles	1.0	1.70184
Kidney renal clear cell carcinoma_KIRC_TCGA-DV-5573-01A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Adrenocortical carcinoma_ACC_TCGA-OR-A5K3-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H3K9me3_T-cell acute lymphoblastic leukemia_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
OVSAHO	CCLE Cell Line Gene CNV Profiles	1.0	1.45393
hsa-miR-4485	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
GPCR, rhodopsin-like, 7TM	InterPro Predicted Protein Domain Annotations	1.0	null
496100543_FWM_probable Alzheimer's disease_TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	3.94373
H3K9me3_fibroblast of lung_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
CTCF_NB4_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CTCF_HeLa-S3_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
FOXC1	JASPAR Predicted Transcription Factor Targets	1.0	null
NR4A2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.752
Lung adenocarcinoma_LUAD_TCGA-MP-A4TA-01A-21R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-GV-A3QI-01A-11R-A220-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RAD21_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
posteroventral (inferior) parietal cortex_12 pcw_F_13060	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.871777
amygdaloid complex_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-0.871777
GA10	CCLE Cell Line Gene Expression Profiles	1.0	1.38069
GSE226285_3_v_0_glutathione_human	RummaGEO Drug Perturbation Signatures	1.0	null
plasma membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
PSN1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.857433
NCI-H1869	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.6221
Liver hepatocellular carcinoma_LIHC_TCGA-QA-A7B7-01A-11R-A32O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.5097
ventrolateral prefrontal cortex_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.46149
RCC10RGB	COSMIC Cell Line Gene Mutation Profiles	1.0	null
BXPC-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.842015
JDP2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.1077
molecular_function	GO Molecular Function Annotations 2015	1.0	null
hsa-miR-4692	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
LS-411N	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Lung adenocarcinoma_LUAD_TCGA-64-1679-01A-21R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_MCF-7_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-CH-5788-01A-11R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Spleen volume	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.852288
orbital frontal cortex_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.25884
PMC4782046-supp_30.5.508_TableS2.xlsx-TAL1_UTX-co-bound_genes-Table_S2_List_of_TAL1_UTX_co-bound_genes_in_Jurkat_cells_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
Skin Cutaneous Melanoma_SKCM_TCGA-RP-A695-06A-11R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HSC2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.7214
NCI-H64	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE107956,GSE107957_0_v_1_ythdf2_human	RummaGEO Gene Perturbation Signatures	1.0	null
UOK101	CCLE Cell Line Gene Expression Profiles	-1.0	-1.62045
eGFP-JUND_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
A172	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.904676
BACH2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.2699
SLR26	CCLE Cell Line Gene Expression Profiles	-1.0	-1.68834
CTCF_GM19239_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE242083,GSE242098_2_v_5_med1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PGR	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.8201
CREB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.5704
Waardenburg syndrome type 2A	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.145
Head and Neck squamous cell carcinoma_HNSC_TCGA-MT-A7BN-01A-12R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ventrolateral prefrontal cortex_2 yrs_F_12979	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.38609
GSE131649_4_v_11_hemin_human	RummaGEO Drug Perturbation Signatures	1.0	null
LOUCY	COSMIC Cell Line Gene Mutation Profiles	1.0	null
CTCF_GM12874_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GATA5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.7834
NCI-H838	COSMIC Cell Line Gene Mutation Profiles	1.0	null
OMC-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-21-5782-01A-01R-1635-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC4407272-elife06857s002.xlsx-501M_BRG1-MITF_ComDown-List-Gene_name_MITF	Rummagene Transcription Factor Associations 2026	1.0	null
CTCF_A549_hg19_9	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NTERA-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.22427
PK-45H	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.08057
GSE216043_7_v_5_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
JM1	CCLE Cell Line Gene CNV Profiles	1.0	1.37722
G292CLONEA141B1	CCLE Cell Line Gene CNV Profiles	-1.0	-2.17411
HNF1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.8741
DPF2_02_14	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.16993
Prostate adenocarcinoma_PRAD_TCGA-YL-A9WI-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Signal Transduction	Reactome Pathways 2014	1.0	null
496100367_FWM_no dementia_TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	6.28651
dorsolateral prefrontal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.25822
KIJK	CCLE Cell Line Gene Expression Profiles	1.0	1.61647
TE8	CCLE Cell Line Gene Expression Profiles	-1.0	-2.32801
CTCF_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
RAD21_H1-hESC_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CardiacMyocytes	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.62041
cerebellum_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.882324
HUP-T3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.987179
Bladder Urothelial Carcinoma_BLCA_TCGA-FD-A5BT-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
496100616_FWM_no dementia_TBI_84_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.38282
mediodorsal nucleus of thalamus_4 yrs_M_12298	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.46552
CTCF_SK-N-SH_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-43-6143-01A-11R-1820-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H2AFZ_CD14-positive monocyte_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
CDK4_knockdown_133_GSE31534	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	1.0	1.4293
HCC202	CCLE Cell Line Gene CNV Profiles	1.0	1.49784
Pancreatic adenocarcinoma_PAAD_TCGA-US-A776-01A-13R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCO2	CCLE Cell Line Gene Expression Profiles	1.0	1.98555
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A3Z1-06A-11R-A239-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MOLM-13 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.763
CALU-6	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04506
CEBPG	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.7412
A-Netherlands-602-2009(H1N1)_18Hour_None_GSE40844	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.88104
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5458-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
primary visual cortex (striate cortex, area V1/17)_26 pcw_F_12949	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.861421
Lung squamous cell carcinoma_LUSC_TCGA-63-A5MN-01A-22R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NFE2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.5454
M07E	DepMap CRISPR Gene Dependency	1.0	3.43543
LOVO	DepMap CRISPR Gene Dependency	1.0	2.6467
CTCF_HGPS cell_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
G361	CCLE Cell Line Gene CNV Profiles	-1.0	-1.36776
Prostate adenocarcinoma_PRAD_TCGA-KK-A8IL-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11426526-ppat.1012555.s014.xlsx-DEG_DC_C91-PL_LPS_vs_DC_Jurkat-Unnamed_5_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
posteroventral (inferior) parietal cortex_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.96404
sensory perception of smell	GO Biological Process Annotations 2023	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-77-6842-01A-11R-1949-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
skin	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
CTCF_GM19238_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ACCMESO1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.64921
SK-MES-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5455-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KMS27	CCLE Cell Line Gene CNV Profiles	1.0	1.65306
MOLP8	CCLE Cell Line Gene Expression Profiles	1.0	1.36
Uterine Carcinosarcoma_UCS_TCGA-N5-A4RT-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lung adenocarcinoma_LUAD_TCGA-49-6743-01A-11R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KATOIII	CCLE Cell Line Gene CNV Profiles	-1.0	-2.30535
epidermis	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
cell part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
HDAC2_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
ZNF8	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	64.3796
posteroventral (inferior) parietal cortex_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.09539
NCI-H630	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GATA4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.812
hsa-miR-374b	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
SNU-81	COSMIC Cell Line Gene Mutation Profiles	1.0	null
signal transduction	GO Biological Process Annotations 2015	1.0	null
G61	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.943711
Lung adenocarcinoma_LUAD_TCGA-44-7660-01A-11R-2066-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4700-11A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CD34+	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-0.915756
molecular transducer activity	GO Molecular Function Annotations 2015	1.0	null
cerebellar cortex_4 yrs_M_12298	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.17789
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-7915-01A-11R-2204-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MYBL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.8665
amygdaloid complex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.81544
Skin Cutaneous Melanoma_SKCM_TCGA-D9-A4Z6-06A-12R-A266-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
POU2F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.3609
POU2F2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.2818
MDAMB453	CCLE Cell Line Gene CNV Profiles	1.0	1.37963
ZNF652	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	31.1318
HUH1	CCLE Cell Line Gene Expression Profiles	1.0	1.4601
cell surface receptor signaling pathway	GO Biological Process Annotations 2015	1.0	null
A2780	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.947861
SK-N-FI	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.7488
regulation of cellular process	GO Biological Process Annotations 2015	1.0	null
PAX6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.5581
Kidney Chromophobe_KICH_TCGA-KN-8429-11A-01R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
receptor activity	GO Molecular Function Annotations 2015	1.0	null
Mesothelioma_MESO_TCGA-SC-A6LP-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
integument	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
ISL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.6408
JHH6	CCLE Cell Line Gene CNV Profiles	1.0	1.4614
COR-L311	COSMIC Cell Line Gene Mutation Profiles	1.0	null
MEF2D	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.3203
U87MG	DepMap CRISPR Gene Dependency	1.0	2.50987
496100366_TCx_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	6.05518
RAD21_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-EJ-5514-01A-01R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EOMES	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.342
YAE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.5319
dorsolateral prefrontal cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	3.4231
Brain Lower Grade Glioma_LGG_TCGA-FG-5963-01A-11R-1708-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SW1271	CCLE Cell Line Gene CNV Profiles	1.0	2.25779
chr1_247511090_G_T_b38	GTEx eQTL 2025	1.0	3.36552
Brain Lower Grade Glioma_LGG_TCGA-HT-7477-01B-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.828837
SUM 1315M02	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.09415
posterior (caudal) superior temporal cortex (area 22c)_21 pcw_M_12886	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.73506
FOS::JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.7632
membrane part	GO Cellular Component Annotations 2015	1.0	null
KELLY	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.05317
E2F4_MCF 10A_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
H3K9me3_Breast vHMEC	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
Lung adenocarcinoma_LUAD_TCGA-NJ-A55R-01A-11R-A262-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-S9-A6WQ-01A-12R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DUX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.6531
PMC8586238-41467_2021_26788_MOESM6_ESM.xlsx-S2A_CDE_genes-S2A_CDE_-_genes_of_the_two_CCD_genes_RUNX2	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-374a	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
hsa-miR-4717-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
GSE178907_4_v_3_fkrp_human	RummaGEO Gene Perturbation Signatures	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4833-01A-01R-1305-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-5549-11A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TBX18	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.1248
SNU5	CCLE Cell Line Gene Expression Profiles	-1.0	-2.43444
FIP1L1_02_147	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	3.32193
GSE128634,GSE128636_4_v_0_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
NURR1	MotifMap Predicted Transcription Factor Targets	1.0	null
BCPAP	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE226285_3_v_0_nr0b1_human	RummaGEO Gene Perturbation Signatures	1.0	null
detection of chemical stimulus	GO Biological Process Annotations 2015	1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2889-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JJN-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.22478
CTCF_K562_hg19_6	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HS746T	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HCC1806	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.675778
olfactory receptor activity	GO Molecular Function Annotations 2025	1.0	null
JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.6571
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5982-11A-01R-1672-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-BI-A0VS-01A-11R-A10U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-3942-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
PPARD	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.2006
Head and Neck squamous cell carcinoma_HNSC_TCGA-QK-A6VC-01A-23R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PDCD11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36035
Liver hepatocellular carcinoma_LIHC_TCGA-G3-A7M6-01A-11R-A33R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-W2-A7HC-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hippocampus (hippocampal formation)_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.89481
MYC_MCF-7_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Kidney Chromophobe_KICH_TCGA-KO-8416-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
posteroventral (inferior) parietal cortex_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.03512
Ovary	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	1.4082
MCF 10A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.858595
HT1197	CCLE Cell Line Gene CNV Profiles	-1.0	-1.53767
bladder	GTEx Tissue Gene Expression Profiles	1.0	0.926941
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-A49A-01A-11R-A24H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PSN1	DepMap CRISPR Gene Dependency	1.0	5.10317
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-VS-A954-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_MCF-7_hg19_6	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCIH2342	CCLE Cell Line Gene CNV Profiles	1.0	1.40491
ZNF143_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
QGP1	CCLE Cell Line Gene Expression Profiles	-1.0	-1.64056
TMD8	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.27827
Brain Lower Grade Glioma_LGG_TCGA-HW-A5KM-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
H2AFZ_HeLa-S3_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NCI-H2073	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.891845
GATA2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.5204
JUND	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	56.0283
cell	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.663342
NCI-H650	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NCIH82	DepMap CRISPR Gene Dependency	1.0	2.10083
PMC11067031-pnas.2317690121.sd06.xlsx-gene_list_14_txt-Differentially_expressed_genes_between_PML_RARA_GFP_vs_C88A_PML_RARA_GFP_human_hematopoietic_cells_at_day_7_by_single_cell_RNA-seq_RARA	Rummagene Transcription Factor Associations 2026	1.0	null
OCI-AML2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.16265
CDX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.7216
signal transducer activity	GO Molecular Function Annotations 2015	1.0	null
HGC27	DepMap CRISPR Gene Dependency	1.0	2.57971
KKU100	DepMap CRISPR Gene Dependency	1.0	2.025
Mesothelioma_MESO_TCGA-TS-A7P8-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MDAMB134VI	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.865171
hsa-miR-1203	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
NCI-H2087	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HDAC2	ENCODE Transcription Factor Targets	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70E-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chr1_247530804_C_CTCCGTGGCCTAAACGGGCAGCCGAGCCCG_b38	GTEx eQTL 2025	1.0	3.15614
496100361_TCx_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	1.0	2.0746
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5469-11A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HSF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.1724
HCC2218	CCLE Cell Line Gene CNV Profiles	1.0	1.65579
MDA-MB-436	COSMIC Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-3978	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
NMCG1	CCLE Cell Line Gene Expression Profiles	-1.0	-1.57242
PHOX2B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	52.0474
CTCF_GM12873_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
POU5F1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.2413
FOXE1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	58.0836
posteroventral (inferior) parietal cortex_21 pcw_F_12365	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	1.03958
KYSE270	CCLE Cell Line Gene CNV Profiles	-1.0	-1.32543
Bladder Urothelial Carcinoma_BLCA_TCGA-DK-A3IN-01A-11R-A20F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-A74H-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KPNSI9S	CCLE Cell Line Gene CNV Profiles	1.0	1.51164
dorsolateral prefrontal cortex_8 yrs_M_12841	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.69423
PMC4782046-supp_30.5.508_TableS2.xlsx-TAL1_UTX-co-bound_genes-Unnamed_4_TAL1	Rummagene Transcription Factor Associations 2026	1.0	null
PANC 08.13	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.842015
BT474	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.756807
KMS27	CCLE Cell Line Gene Expression Profiles	1.0	1.71223
Olfactory Signaling Pathway	Reactome Pathways 2014	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A7CL-01A-11R-A32P-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H1573	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Signaling by GPCR	Reactome Pathways 2014	1.0	null
NCIH650	CCLE Cell Line Gene Expression Profiles	1.0	1.65977
TBX15	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.9805
CTCF_SK-N-SH_hg19_4	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NB1	DepMap CRISPR Gene Dependency	1.0	2.42237
TIPARP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45461
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-HM-A3JJ-11A-12R-A21T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCI-H720	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NCI-H2170	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.996008
SMC3_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KNS62	CCLE Cell Line Gene Expression Profiles	-1.0	-1.90825
g-protein coupled receptor signaling pathway	GO Biological Process Annotations 2015	1.0	null
hsa-miR-4735-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
Skin Cutaneous Melanoma_SKCM_TCGA-GN-A263-01A-11R-A18T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Uterine Carcinosarcoma_UCS_TCGA-N5-A4RD-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
dorsolateral prefrontal cortex_26 pcw_F_12949	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	-1.0	-1.92164
hsa-miR-1299	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
CUX1	ChEA Transcription Factor Targets	1.0	null
PROX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.3321
hsa-miR-376c	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.2992
HCC1143	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.08505
TP63_01_200	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	2.85148
SOX10	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.6268
HPAFII	CCLE Cell Line Gene Expression Profiles	-1.0	-1.82239
CTCF_H1-hESC_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-CH-5789-01A-11R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_A549_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
22RV1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	12.5446
NCI-H510A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.17813
MGA::EVX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.4374
LN382	CCLE Cell Line Gene CNV Profiles	-1.0	-1.5851
FOSL2::JUNB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.5352
Liver	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.08377
NB1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-5001-01A-01R-1334-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOSL1::JUN	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.1748
transmembrane signaling receptor activity	GO Molecular Function Annotations 2015	1.0	null
detection of chemical stimulus involved in sensory perception	GO Biological Process Annotations 2025	1.0	null
CTCF_GM12870_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HMC18	CCLE Cell Line Gene Expression Profiles	1.0	1.51464
NCI-H2052	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.90265
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4166-01A-02R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_GM12892_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
TOLEDO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.99625
IGR-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
KNS81	DepMap CRISPR Gene Dependency	1.0	3.44564
OACP4C	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Nasal mucosa	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.343
response to stimulus	GO Biological Process Annotations 2015	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-BB-A5HU-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11067031-pnas.2317690121.sd05.xlsx-Sheet1-Differentially_expressed_genes_between_PML_RARA_GFP_vs_Empty_vector_GFP_human_hematopoietic_cells_at_day_7_by_single_cell_RNA-seq_RARA	Rummagene Transcription Factor Associations 2026	1.0	null
inferolateral temporal cortex (area TEv, area 20)_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by Microarray	1.0	0.929532
CTCF_GM12891_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
KU812	DepMap CRISPR Gene Dependency	1.0	2.971
NCI-H2030	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.842868
Acute Myeloid Leukemia_LAML_TCGA-AB-2938-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CTCF_keratinocyte_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null