association	dataset	threshold value	standardized value
DG(18:3n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AH-1226-SM-48TZL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CEP68	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.78549
ventral lateral nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.848126
GTEX-T6MO-1226-SM-4DM5S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
dorsolateral prefrontal cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.998342
SNU1033	CCLE Cell Line Gene Mutation Profiles	1.0	null
GSE138019_1_v_2_nudt12_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Dsl1/NZR complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.931
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ATAD3B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.47611
GlobusPallidus	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.912611
p1 part of the substantia nigra compacta	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.06215
IRF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	45.5833
RCM1	DepMap CRISPR Gene Dependency	1.0	2.64776
FCHSD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23948
DG(20:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Foxo1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.5912
DG(22:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
nervous system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.697808
TDRD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.9205
DG(20:4(5Z,8Z,11Z,14Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4n3/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
JADE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70116
RB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.40629
DG(20:2(11Z,14Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE258991_5_v_0_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
CD34+	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.60996
C13orf42	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.42391
VI	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.829449
HMGB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.59602
GTEX-WH7G-0005-SM-3NMBX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5n3/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
ZNF485	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.86183
Prostate adenocarcinoma_PRAD_TCGA-EJ-A46H-01A-31R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE135030_11_v_5_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
IRAK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.51212
GTEX-WY7C-0006-SM-3NB3L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TTK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58584
nobox_18509161_newborn_ovary_lof_mouse_gpl1261_gds3254	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.706423
IFT22	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.90672
DG(18:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-OHPN-0011-R11A-SM-2I5FM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.26689
abnormal paired-pulse facilitation	MPO Gene-Phenotype Associations	1.0	null
DG(16:1n7/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
GSE234289_3_v_2_rfx6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
bronchial epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.320956
GTEX-POMQ-0526-SM-3GADD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:1n9/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
intermediate stratum of m1AL	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.04705
DG(14:1(9Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DBR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92937
SLC7A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30346
HMBS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.10596
Perturb_17044_KD_IRF4_SRP201887	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
Ebf2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	26.5322
CAOV3	CCLE Cell Line Gene Expression Profiles	-1.0	-1.92719
GTEX-QVJO-0011-R9A-SM-2S1QH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.95828
SW954	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PPARA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.35374
genetic disease	GWASdb SNP-Disease Associations	1.0	0.232736
DG(22:5(4Z,7Z,10Z,13Z,16Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TGIF2LY	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.6323
TP53-23651856-MEFS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
GSE210101,GSE210114_5_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:4n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE79663_2_v_0_tcf4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Horizontal cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.896
abnormality of leukocytes	GWASdb SNP-Phenotype Associations	1.0	0.181629
DG(16:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
presynaptic membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.614165
DANG	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-T6MO-0126-SM-4DM6X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-H4-A2HO-01A-11R-A180-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ASMT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.29244
hsa-miR-3920	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
GSE122509,GSE122513_3_v_0_ibrutinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
COX6C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.0839
DG(18:1n7/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
C16orf87	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01454
DG(22:4(7Z,10Z,13Z,16Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE203329_2_v_3_mettl5_human	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:1(13Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Exocytic vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.521
DG(22:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
RTN4IP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88166
SKUT1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-T2IS-0011-R2A-SM-32QPF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06219
superficial stratum of POH	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.37502
Medial geniculate complex, dorsal part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.57169
PMC7339600__F5	PFOCR Pathway Figure Associations 2024	1.0	null
CBX3	ENCODE Transcription Factor Targets	1.0	null
GSE186483_1_v_0_lrrk2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(15:0/0:0/18:0)	HMDB Metabolites of Enzymes	1.0	null
abnormal motor learning	MPO Gene-Phenotype Associations	1.0	null
mental depression	GWASdb SNP-Disease Associations	1.0	0.962747
SHISA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53993
Exocytic vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.145
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7253-01A-11R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(18:3n3/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/20:0)	HMDB Metabolites of Enzymes	1.0	null
NCIH1184	CCLE Cell Line Gene Mutation Profiles	1.0	null
GATA3	ENCODE Transcription Factor Targets	1.0	null
BV-173	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:1(9Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EEF1AKMT4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.73797
GSE196259_1_v_3_gcm1_human	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-4328	TargetScan Predicted Conserved microRNA Targets	1.0	0.15008
AGPAT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.39445
MELHO	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
pancreas	HPA Tissue Protein Expression Profiles	1.0	0.801417
GTEX-SUCS-0926-SM-4DM4Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE123372,GSE123373_10_v_2_mecp2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(24:1(15Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
LNCAPCLONEFGC	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(24:1(15Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(8Z,11Z,14Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-G9-6370-01A-11R-1789-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-RELB_RELB	Rummagene Transcription Factor Associations 2026	1.0	null
DG(22:2(13Z,16Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF143	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.53936
CW-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
artery disease	GWASdb SNP-Disease Associations	1.0	0.20684
DG(16:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
451LU	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(24:1n9/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
FAM111B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8345
obstructive lung disease	GWASdb SNP-Disease Associations	1.0	0.382281
GTEX-Q2AG-2926-SM-2HMJ3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.13096
motor neuron disease	GWASdb SNP-Disease Associations	1.0	0.59964
DG(18:3n6/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-HAND1_neg_targets-Gene_HAND1	Rummagene Transcription Factor Associations 2026	1.0	null
DG(18:3(9Z,12Z,15Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X261-0011-R10B-SM-4E3JT	GTEx Tissue Sample Gene Expression Profiles	1.0	0.96382
DG(20:3(5Z,8Z,11Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EZH2	ENCODE Transcription Factor Targets	1.0	null
GSE258991_1_v_0_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ZNF571	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.35478
r6 part of ventral gigangocellular reticular area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.06416
GTEX-QVUS-2926-SM-3GIJB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.59851
GTEX-WFG8-0126-SM-4LVMH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OVCAR-8	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:1n7/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-P4PQ-0226-SM-2S1NK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:1n7/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SP in caudal perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.44182
GTEX-XBED-0008-SM-47JWO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CHMP5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37451
LIPT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58598
NCI-H2081	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:1n9/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
DG(15:0/0:0/16:0)	HMDB Metabolites of Enzymes	1.0	null
APOBEC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.3055
TMEM9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.66486
DG(20:4(8Z,11Z,14Z,17Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GRB10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.6747
PARS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.40971
GTEX-Q2AI-0226-SM-48U1D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OSR1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3749
COLO741	CCLE Cell Line Gene CNV Profiles	1.0	1.70547
PMC7498599-41467_2020_18508_MOESM11_ESM.xlsx-ICM_JUN-Unnamed_2_JUN	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-NPJ7-0011-R8a-SM-2I3G2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02645
TMEM138	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.18894
GTEX-OXRO-0011-R10A-SM-2I5EH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.996319
DG(20:1n9/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GSE214335_1_v_0_sox9_human	RummaGEO Gene Perturbation Signatures	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.40522
SERPINE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49886
PDGFB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88412
GTEX-UTHO-0011-R11A-SM-3GIJE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.81982
TBX19	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.4152
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-DG-A2KJ-01A-11R-A32Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE244072_4_v_0_tfeb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(16:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
SLC35A4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08087
GTEX-RU1J-0008-SM-46MV9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
bone marrow cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.087458
Hypertrophy	CTD Gene-Disease Associations	1.0	1.10527
Synaptic_vesicle_trafficking	PANTHER Pathways	1.0	null
GSE138001_2_v_3_rorb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-U4B1-0008-SM-4DXUW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
type 2 diabetes mellitus	GWASdb SNP-Disease Associations	1.0	1.10764
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-P4PQ-0008-SM-48TDX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
tic disorder	GWASdb SNP-Disease Associations	1.0	0.654134
NCI-H2342	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-Q2AI-0426-SM-48U13	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
leukemia	GWASdb SNP-Disease Associations	1.0	0.751885
syntaxin binding	GO Molecular Function Annotations 2023	1.0	null
amygdaloid complex_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.973154
GTEX-PLZ4-0226-SM-2S1NW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC9170821-JCMM-26-3183-s001.xlsx-Neu_DAPI_ERG_VaD_vs_NC-Gene_ERG	Rummagene Transcription Factor Associations 2026	1.0	null
Intercalated amygdalar nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.10337
PCI-6A	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
GSE191138_2_v_4_fmo3_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
cellular_component	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
GTEX-X585-0011-R10A-SM-46MUY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02401
DG(18:2(9Z,12Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1(13Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PX3G-0826-SM-48TZS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
squamous cell carcinoma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.547724
TAF1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.354
GSE126127_5_v_4_prmt1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(18:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
OV90	DepMap CRISPR Gene Dependency	1.0	2.46696
enhanced paired-pulse facilitation	MGI Mouse Phenotype Associations 2023	1.0	null
GSE149035_3_v_5_hepacam_human	RummaGEO Gene Perturbation Signatures	1.0	null
COIL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22744
GSE213588_9_v_2_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
H2AFZ_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Sarcoma_SARC_TCGA-X6-A7WD-01A-21R-A355-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE133213_11_v_3_znrf3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
U937	CCLE Cell Line Gene CNV Profiles	1.0	1.47415
GTEX-T8EM-0526-SM-4DM64	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3(6Z,9Z,12Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
AMPA glutamate receptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.127
DG(24:1(15Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Rfx6	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	25.6567
DG(16:0/0:0/18:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XMK1-0008-SM-4GICF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE126463_5_v_2_arid2_human	RummaGEO Gene Perturbation Signatures	1.0	null
SCC-9	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.11212
SW756	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XLM4-2926-SM-4AT59	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24524
LXFL529	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.03829
Perturb_17046_KD_GORASP1_SRP201887	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	20.0
B4GALT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.83391
frontal pole, right, medial aspect	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.89787
Fallopian Tube	GTEx Tissue Gene Expression Profiles 2023	1.0	2.47024
DG(20:3(8Z,11Z,14Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CRTC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.42581
DANG	CCLE Cell Line Gene Expression Profiles	-1.0	-2.29116
hsa-miR-3163	TargetScan Predicted Conserved microRNA Targets	1.0	0.193083
BBS12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84468
GTEX-PSDG-1526-SM-48TCY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-484	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
CCNT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.0324
GTEX-T6MN-0011-R7A-SM-32QP5	GTEx Tissue Sample Gene Expression Profiles	1.0	0.909625
RBMY1A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.091
GTEX-X4LF-0526-SM-3NMB6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LOVO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.20106
Serotonergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.672
DG(20:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
brain	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.479312
DG(18:3(6Z,9Z,12Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-BC-4072-01B-11R-A155-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PPP2CB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5025
PYCR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65923
GSE221327_4_v_9_clpp_human	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-557	TargetScan Predicted Conserved microRNA Targets	1.0	0.766596
DG(14:1n5/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
FASN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17242
PAP-1	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.42
TTLL6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86828
intracellular part	GO Cellular Component Annotations 2015	1.0	null
GTEX-PWO3-0926-SM-2I5EY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.29487
DG(22:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H226	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09669
GSE137954_4_v_2_smyd3_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
posteromedial visual area, layer 2/3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.21696
GTEX-T2YK-0008-SM-4DM6M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HUG1N	CCLE Cell Line Gene CNV Profiles	-1.0	-1.59877
GTEX-WFG8-2326-SM-3GILF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE169205_3_v_2_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
asymmetric, glutamatergic, excitatory synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.081
ECHS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13298
Perturb_14552_KO_Abcc8_ERP018163	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7250-11A-01R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(14:1(9Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
cation binding	GO Molecular Function Annotations 2015	1.0	null
hsa-miR-1224-3p	TargetScan Predicted Conserved microRNA Targets	1.0	1.45615
Perturb_6591_KO_Zcchc8_SRP187429	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-15.4934
DG(14:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(8Z,11Z,14Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE188382_2_v_1_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PODXL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08513
HH	CCLE Cell Line Gene Mutation Profiles	1.0	null
Perianth	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.05
TET2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.54241
HNF3A	MotifMap Predicted Transcription Factor Targets	1.0	null
DG(18:1n9/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-4676-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
GTEX-R55D-0826-SM-48FEA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:1(13Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF765	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98925
substantia nigra reticulata, isthmic part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.2402
RERFLCAD2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.47406
DG(14:1(9Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
disease of mental health	GWASdb SNP-Disease Associations	1.0	0.268757
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5400-01A-01R-1503-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
abnormal cns synaptic transmission	MPO Gene-Phenotype Associations	1.0	null
ZDHHC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96565
GTEX-R55G-1626-SM-48FF4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
FBLN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.62591
GTEX-W5WG-2326-SM-3GIJH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:1n5/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1(13Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S4Z8-0006-SM-3K2AQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC10641274-mmc2.xlsx-FOXK1_Insulin-SYMBOL_FOXK1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-NPJ7-2726-SM-2I3FT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39111
DG(22:2(13Z,16Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1n5/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MTERF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33149
MDAMB134VI	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.22751
NDUFB10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52905
DG(14:0/0:0/18:0)	HMDB Metabolites of Enzymes	1.0	null
SMUG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68887
Perturb_17043_KD_GORASP1_SRP201887	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
Presynaptic cytosol	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.598
CerebellumPeduncles	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	1.66689
EP300-21415370-HL-1-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
MDA-MB-330	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
THBS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.17429
outer SZ in medial temporal-occipital cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.08233
muscle	GTEx Tissue Gene Expression Profiles	1.0	0.905248
GSE219195_4_v_5_rbm12_human	RummaGEO Gene Perturbation Signatures	1.0	null
DPPA5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81929
DG(18:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE201042_2_v_3_ptpmt1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
TYK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.89744
GSE135030_3_v_1_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(20:3n9/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
GSE147876,GSE147877_4_v_0_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
NCI-H187	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.977331
GTEX-T5JC-0011-R8A-SM-32PLM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14028
DG(20:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
TRIM17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18328
H4K20me1_mammary epithelial cell_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-WZTO-2926-SM-3NM9I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.16468
GSE242333_0_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC6928094-395_2019_765_MOESM7_ESM.xls-DEGs_AR7_vs_Pre-patterned-List_of_differentially_expressed_genes_in_AR7_vs_Pre-patterned_cells_THRA	Rummagene Transcription Factor Associations 2026	1.0	null
DARS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.59513
DG(15:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
GSE178340_5_v_2_carfilzomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Acute Myeloid Leukemia_LAML_TCGA-AB-2929-03A-01T-0735-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JVM-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
abnormality of female internal genitalia	GWASdb SNP-Phenotype Associations	1.0	0.206149
TE4	CCLE Cell Line Gene CNV Profiles	1.0	1.39874
GTEX-XUW1-0226-SM-4BOOS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-T6MN-0011-R2A-SM-32QOW	GTEx Tissue Sample Gene Expression Profiles	1.0	0.970462
BBL023172	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.71
OGA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.61438
EMC-BAC-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:1n7/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
VZ in midcingulate neocortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.878033
HCC366	CCLE Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-182	TargetScan Predicted Conserved microRNA Targets	1.0	0.348832
DG(18:3(6Z,9Z,12Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
V	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.826641
DG(20:1n9/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
H3K9me3_megakaryocyte_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
DG(20:2(11Z,14Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
isthmic liminal reticular area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.14472
ZDHHC7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78026
DG(20:2(11Z,14Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n6/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
Anxiety disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.034
DG(22:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SCRN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.25042
GTEX-OHPN-0011-R4A-SM-2I5FD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.51103
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RNOR-2326-SM-2TF4I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20438
abnormality of the genital system	GWASdb SNP-Phenotype Associations	1.0	0.188492
DG(18:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-VUSH-0008-SM-47JWK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SEMA7A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.76293
P30-OHK	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE84148,GSE96938_0_v_2_nrros_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
ZKSCAN5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33004
GSE224096_1_v_0_cocaine_human	RummaGEO Drug Perturbation Signatures	1.0	null
MERO83	DepMap CRISPR Gene Dependency	1.0	3.83908
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_ALL-SYMBOL_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
DG(18:3(9Z,12Z,15Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC9160255-41467_2022_30710_MOESM4_ESM.xlsx-AR_specific_regulated_genes-SYMBOL_AR	Rummagene Transcription Factor Associations 2026	1.0	null
r3 part of magnocellular medial vestibular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.28112
DG(20:2(11Z,14Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1n9/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE179880_4_v_5_e2f4_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
cuneus, left, striate	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.921603
DG(24:1n9/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S4P3-0006-SM-3K2AW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SNU-1040	COSMIC Cell Line Gene Mutation Profiles	1.0	null
FOXA1-21572438-LNCAP-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
NCI-H1693	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.35274
dorsal subnucleus of MG	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.3309
hypertension	GWASdb SNP-Disease Associations	1.0	0.887807
GTEX-XMD1-0011-R10A-SM-4AT4A	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02099
DG(18:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
Calyx	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.354
Presynapse	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
Presynaptic endocytic zone	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.696
(Z)-Pugnac	DeepCoverMOA Drug Mechanisms of Action	1.0	0.41
Gastrointestinal system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.302
DG(22:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X4XY-1626-SM-46MVN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of bone marrow cell morphology	GWASdb SNP-Phenotype Associations	1.0	0.220586
SIT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01791
DG(18:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE114013,GSE114014_1_v_4_itraconazole_human	RummaGEO Drug Perturbation Signatures	1.0	null
cellular process	GO Biological Process Annotations 2015	1.0	null
GSE171837_3_v_2_bortezomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Tongue cancer cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.653
496100409_FWM_no dementia_TBI_85_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.96559
DG(22:1n9/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-U8XE-0426-SM-3DB91	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
lateral septal nucleus, intermediate part, periventricular	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.45523
GTEX-OIZH-2026-SM-3NB1M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE182921_0_v_1_slit2_human	RummaGEO Gene Perturbation Signatures	1.0	null
CDK18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39105
GTEX-XOT4-0005-SM-4B64S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
morphological abnormality of the central nervous system	GWASdb SNP-Phenotype Associations	1.0	0.145853
DG(16:0/0:0/16:0)	HMDB Metabolites of Enzymes	1.0	null
HUT78	CCLE Cell Line Gene Expression Profiles	1.0	1.41105
DG(20:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_MAP_AA-GENE_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
DG(18:1(11Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XYKS-1826-SM-4E3JV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SYTL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.16502
GSE147876,GSE147877_4_v_9_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
RORA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.1978
DG(18:4(6Z,9Z,12Z,15Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC5358377-pnas.1615015114.sd02.xlsx-Sheet1-Genes_with_VDR_elements_only_control_VDR	Rummagene Transcription Factor Associations 2026	1.0	null
NCI-H1793	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-T5JW-0008-SM-4DM5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
anterior (rostral) cingulate (medial prefrontal) cortex_16 pcw_M_12287	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.92272
PMC6612641-ACEL-18-e12970-s012.xlsx-in_vitro_ns_RAPA_Grp_1_2_genes-From_Data_Sheet_3_-_the_non_RAPA_responsive_gene_list_from_group_1_TRERF1	Rummagene Transcription Factor Associations 2026	1.0	null
ALG8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64845
GTEX-RU1J-0326-SM-46MUM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of the respiratory system	GWASdb SNP-Phenotype Associations	1.0	0.107458
PMC3841787__F5	PFOCR Pathway Figure Associations 2023	1.0	null
cerebellar cortex_19 yrs_F_12832	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.25578
MEL-HO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GRIN2D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18321
CHGB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34995
layer 6 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.21202
DG(20:1n9/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
BV173	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-SSA3-0008-SM-47JWJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Acute Myeloid Leukemia_LAML_TCGA-AB-2971-03A-01T-0734-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-DZ-6131-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE158197_6_v_4_egfr_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:3(5Z,8Z,11Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
FBXL15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.88016
Brain - Spinal cord (cervical c-1)	GTEx Tissue Gene Expression Profiles 2023	1.0	1.66532
Emphysema imaging phenotypes	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.609691
superficial stratum of r6Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.39018
DNAJB11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99789
GSE149264,GSE149267_9_v_3_trp53_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
Hippocampal mossy fiber	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.164
GTEX-T5JW-1326-SM-4DM5G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Prostate adenocarcinoma_PRAD_TCGA-G9-6384-11A-01R-1858-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-TML8-0008-SM-4DXUI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NPAS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45693
GTEX-PWCY-0726-SM-48TCS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
abnormality of the cardiovascular system	GWASdb SNP-Phenotype Associations	1.0	0.116938
mood disorder	GWASdb SNP-Disease Associations	1.0	0.453546
E2F6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32315
bone marrow cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.436822
synaptic transmission, glutamatergic	GO Biological Process Annotations 2025	1.0	null
PANC0813	DepMap CRISPR Gene Dependency	1.0	2.49902
GSE193351_4_v_9_ruxolitinib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(18:1n7/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
parkinson's disease	GWASdb SNP-Disease Associations	1.0	1.28484
GSE147366_3_v_0_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Squamous cell carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.511
Brain	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
SKOV3	CCLE Cell Line Gene Expression Profiles	-1.0	-1.51956
DG(22:1n9/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GSE151119_3_v_1_hsf1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
T-24	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HPAFII	DepMap CRISPR Gene Dependency	1.0	2.07121
JHUEM2	CCLE Cell Line Gene CNV Profiles	-1.0	-1.38655
stratum pyramidale of caudal CA2	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.826001
DG(16:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE227891_5_v_3_ethanol_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
PMC7889611-41467_2021_21346_MOESM10_ESM.xlsx-High_TSA_score_correlations-Supplementary_Data_6_Genes_with_expression_that_positively_correlate_with_a_high_TSA_score_in_AIRE_and_corneocyte-like_mTECs_AIRE	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-XOTO-0011-R1B-SM-4B65C	GTEx Tissue Sample Gene Expression Profiles	1.0	0.847016
DG(20:1(11Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE258991_5_v_4_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
BID	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.08356
SNRPD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23911
GTEX-PLZ6-0008-SM-48TD5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
dorsal lateral geniculate nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.56595
DG(20:3(8Z,11Z,14Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
subbrachial nucleus, caudal part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.24998
Anti-saccade response	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.504576
ZNF432	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.53659
Inflammation	CTD Gene-Disease Associations	1.0	1.28395
arsenic trioxide_homo sapiens_gpl201_gse48441	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
VIIIB	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.878541
TRIM28	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.38454
developmental disorder of mental health	GWASdb SNP-Disease Associations	1.0	0.214919
GTEX-S3XE-1326-SM-4AD4H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
single-organism process	GO Biological Process Annotations 2015	1.0	null
EFO27	CCLE Cell Line Gene CNV Profiles	-1.0	-1.58654
exocytosis	GO Biological Process Annotations 2015	1.0	null
GTEX-VUSG-0126-SM-4KL1X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_13056_Mut|OE_Sik3E13_SRP334442	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.5954
Skin Cutaneous Melanoma_SKCM_TCGA-FR-A69P-06A-21R-A311-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BB65-RCC	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-OHPM-0008-SM-4E3IP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MOV10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.80999
DG(22:2(13Z,16Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE189683_3_v_0_rif1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-XQ8I-1726-SM-4BOQB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LRRC14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23599
GTEX-WWYW-0011-R7A-SM-3NB3H	GTEx Tissue Sample Gene Expression Profiles	1.0	0.885575
cancer	GWASdb SNP-Disease Associations	1.0	0.123569
Chromosome 15q24 deletion syndrome	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.084
GTEX-T6MN-0011-R1A-SM-32QOY	GTEx Tissue Sample Gene Expression Profiles	1.0	0.848089
Scolopidium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.035
ZSCAN16	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.9047
Perturb_1153_KD_EZH2_SRP021509	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-11.7317
bronchoalveolar system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.157966
GSE149096_4_v_3_ascl1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Zona incerta	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.692
MLN 8237	DeepCoverMOA Drug Mechanisms of Action	1.0	0.43
GTEX-QVUS-0011-R6A-SM-3GACX	GTEx Tissue Sample Gene Expression Profiles	1.0	0.843896
ZNF169	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.12441
APOBEC3F	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.12656
GTEX-T5JW-0326-SM-4DM6J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE234340_12_v_2_muc2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
HSC-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_SBP_AA-GENE_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
mediodorsal nucleus of thalamus_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.905986
parvocellular part of the r9LRt	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.00521
cerebellar cortex_3 yrs_M_12980	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.50797
DG(22:2n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
GSE169205_0_v_6_sirt5_human	RummaGEO Gene Perturbation Signatures	1.0	null
Diencephalon	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.09
DG(20:4n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
PMC6335596-mmc2.xlsx-RNA-seq_Day_3_GATA6_Het-Unnamed_13_GATA6	Rummagene Transcription Factor Associations 2026	1.0	null
STAT3-23295773-U87-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
USP44	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.92254
myb_16205643_mcf7_gof_human_gpl96_gse2815	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.595361
clathrin-coated vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.397035
GTEX-REY6-1726-SM-48FDL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
periventricular stratum of AStr	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.02487
SW1783	CCLE Cell Line Gene CNV Profiles	1.0	2.48492
GTEX-XQ8I-0926-SM-4BOOF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Occipital lobe	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.447
DG(22:5(4Z,7Z,10Z,13Z,16Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
TBCEL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.85879
neuron projection	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.063983
DG(15:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Vestibular sensory epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.679
GTEX-O5YT-0926-SM-48TDG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
WDHD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91661
PMC7430827-12864_2020_6933_MOESM4_ESM.xlsx-Sheet1-Additional_file_4_Table_S4_A_list_of_3_062_genes_containing_locus_where_only_KD_had_non-synonymous_SNPs_compared_to_other_duck_breeds_AR	Rummagene Transcription Factor Associations 2026	1.0	null
PRR22	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.8394
DU4475	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
STX-0119	DeepCoverMOA Drug Mechanisms of Action	1.0	0.3
PLK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.63463
Presynaptic density	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.325
hsa-miR-4422	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
DG(14:1n5/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
abnormality of the prostate	GWASdb SNP-Phenotype Associations	1.0	0.598959
DG(18:3(9Z,12Z,15Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
KDELR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21423
C10	DepMap CRISPR Gene Dependency	1.0	2.83683
abnormal monocyte count	GWASdb SNP-Phenotype Associations	1.0	0.67249
GTEX-P4PQ-0326-SM-2HMJ8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Fibre tract	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.324
GTEX-QLQ7-0926-SM-447BC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
amyotrophic lateral sclerosis	GWASdb SNP-Disease Associations	1.0	0.59964
PPARD-21283829-MYOFIBROBLAST-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
LRRN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04695
ANXA11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.41383
GTEX-X585-3026-SM-46MWF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.05962
DG(22:2(13Z,16Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
BICR31	DepMap CRISPR Gene Dependency	1.0	2.61039
NCI-H1930	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.978329
EFNA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.24456
hsa-miR-641	TargetScan Predicted Conserved microRNA Targets	1.0	0.714812
GSE143499_0_v_1_gata6_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-S4Z8-0426-SM-3K2AH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Brain Lower Grade Glioma_LGG_TCGA-HT-7688-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Sarcoma_SARC_TCGA-IE-A4EI-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MRPS35	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.90975
DG(18:3(6Z,9Z,12Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XLM4-0011-R3B-SM-4AT6E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.00773
DG(20:3(8Z,11Z,14Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CLBA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93985
caudal presubiculum (postsubiculum)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.71619
Adrenocortical carcinoma_ACC_TCGA-OR-A5K4-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ventrolateral prefrontal cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.902717
PK45H	CCLE Cell Line Gene Mutation Profiles	1.0	null
SOX21	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.6112
GTEX-TSE9-0011-R1A-SM-3DB7E	GTEx Tissue Sample Gene Expression Profiles	1.0	0.838379
GSE146687_2_v_5_eribulin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-P44H-1126-SM-48TBU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
WM88	DepMap CRISPR Gene Dependency	1.0	2.59473
anterior paraventricular nucleus of thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.18496
GTEX-WFG8-0008-SM-4LVN6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
mantle zone of r5Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.01573
DG(20:3n9/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
TM7SF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88507
superficial stratum of p1B	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.07223
EZH2_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-QLQW-0726-SM-447AA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
RIF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06445
DG(20:3(5Z,8Z,11Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
JHH-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-OHPN-0011-R3A-SM-2I5FC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.30019
neurodegenerative disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
stratum radiatum of caudal CA1	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.993081
attention deficit hyperactivity disorder	GWASdb SNP-Disease Associations	1.0	0.654134
DG(20:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
SOX3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.1688
Bladder	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
GTEX-T2IS-3026-SM-32QPM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35018
Kidney renal clear cell carcinoma_KIRC_TCGA-CW-6088-11A-01R-1672-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PSMB4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.62225
GTEX-N7MS-0011-R11A-SM-2HMJS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43971
DG(18:3(6Z,9Z,12Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PPARD	ChEA Transcription Factor Targets	1.0	null
NANOG-20526341-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
ZDHHC8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31269
ZW10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23988
GTEX-NPJ8-0011-R10A-SM-2YUMO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01987
DG(14:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SCG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67403
HESX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	15.3014
PAX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.17526
Nucleus sagulum	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.16069
NCIH1395	CCLE Cell Line Gene CNV Profiles	1.0	1.76951
DG(24:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEx Muscle 20-29 vs 40-49	GTEx Tissue-Specific Aging Signatures	1.0	17.1214
DG(18:3(9Z,12Z,15Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
mantle zone of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.8928
GSE169205_3_v_7_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
primary visual cortex (striate cortex, area V1/17)_4 mos_M_12890	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.858217
NUGC-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.06271
intermediate stratum of m1Lim	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.68683
Prostate adenocarcinoma_PRAD_TCGA-G9-6369-01A-21R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QDT8-0011-R4A-SM-32PKM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11577
Central amygdalar nucleus, capsular part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.20206
IMR32	CCLE Cell Line Gene Mutation Profiles	1.0	null
skeletal muscle	HPA Tissue Protein Expression Profiles	-1.0	-1.41433
GSE95077_5_v_4_amiloride_human	RummaGEO Drug Perturbation Signatures	1.0	null
ALDH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85758
hsa-miR-214	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
MITF-21258399-MELANOMA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
Lung squamous cell carcinoma_LUSC_TCGA-37-4129-01A-01R-1100-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_14112_OE_Pou2f3_SRP343255	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-1.39566
synapse organization	GO Biological Process Annotations 2023	1.0	null
Kidney - Medulla	GTEx Tissue Gene Expression Profiles 2023	1.0	4.58525
glucose	GAD Gene-Disease Associations	1.0	null
GTEX-QDT8-3026-SM-32PKB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49363
CCF-STTG1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:1(9Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Exocytic vesicle membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(20:4n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
alzheimer's disease	GWASdb SNP-Disease Associations	1.0	1.10764
Cervical ganglion	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.551
HCE-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SLC25A39	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15243
intermediate stratum of r10BM	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.51572
NDUFAF7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52454
VHL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99795
647V	CCLE Cell Line Gene CNV Profiles	1.0	1.3617
DG(20:2n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
GSE176144_0_v_1_zfc3h1_human	RummaGEO Gene Perturbation Signatures	1.0	null
GBA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48598
PER2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74954
hsa-miR-3973	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
disease of metabolism	GWASdb SNP-Disease Associations	1.0	0.212149
Synaptic vesicle pathway	WikiPathways Pathways 2024	1.0	null
DG(18:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2(11Z,14Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WL46-0011-R1A-SM-3LK6M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09662
DG(16:1(9Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WWYW-3126-SM-3NB39	GTEx Tissue Sample Gene Expression Profiles	1.0	1.403
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-7061-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QMR6-0011-R10A-SM-32PKO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18172
ERFL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41828
single organism signaling	GO Biological Process Annotations 2015	1.0	null
GSE254649_3_v_0_cstf2_human	RummaGEO Gene Perturbation Signatures	1.0	null
NCIH1573	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(9Z,12Z,15Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
NFIL3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.3308
U937	CCLE Cell Line Gene Mutation Profiles	1.0	null
GSE120370_0_v_6_thrombin_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
synaptic vesicle exocytosis	GO Biological Process Annotations 2025	1.0	null
temporal neocortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.873855
WDR5B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63597
Granular lamina of the cochlear nuclei	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.03726
DG(14:0/0:0/20:0)	HMDB Metabolites of Enzymes	1.0	null
SNARE complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.985
superficial stratum of TTe	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.41394
DG(16:1n7/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
GSE88819_3_v_10_tug1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
r9 part of the inferior olive	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.28671
PMC8905236-mmc2.xlsx-Table_S10-Table_S10_Differentially_regulated_genes_in_SPI1_high_vs_low_group_in_CGGA_GBM_dataset_SPI1	Rummagene Transcription Factor Associations 2026	1.0	null
MEL-JUSO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
viral infectious disease	GWASdb SNP-Disease Associations	1.0	0.371567
MKN-74	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.23887
Brain Lower Grade Glioma_LGG_TCGA-S9-A7IQ-01A-21R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EVSAT	CCLE Cell Line Gene Mutation Profiles	1.0	null
GATA3_SH-SY5Y_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(20:5n3/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
GSE166004_3_v_4_pld1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
ARF5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48558
Perturb_11479_KO_Ring1_SRP321271	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-2.51103
DG(24:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XAJ8-0006-SM-46MVM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-7926-01A-11R-2156-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE234340_1_v_2_muc2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE118766_1_v_0_ifng_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
SLC7A2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33131
glial cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.234302
ETS1-21867929-TH2-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
496100362_FWM_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.58536
PDS5A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78285
GSE152637_1_v_0_imiquimod_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
Pseudomonas Infection_Lung Tissue_GSE923	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-3.37116
PMC8437976-41416_2021_1470_MOESM2_ESM.xls-List_of_MAF_in_SNP_Rectum-Hugo_Symbol_MAF	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-128-3p	MiRTarBase microRNA Targets	1.0	null
DG(18:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
Stat5a::Stat5b	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	38.2707
cerebellar cortex_21 yrs_F_13057	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	2.4407
DG(22:5(7Z,10Z,13Z,16Z,19Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
TCF3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	27.4214
hypoglossal nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.96382
SMARCA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.00675
HOXA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.24202
GSE95077_1_v_0_amiloride_human	RummaGEO Drug Perturbation Signatures	-1.0	null
protein complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.040693
Gustatory areas	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.27457
DG(18:3n3/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
SKMES1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-XBED-2226-SM-47JYQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-BP-4334-01A-01R-1289-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GREB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.80087
DG(22:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ATAD3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.45112
disease of anatomical entity	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.039384
GCT	CCLE Cell Line Gene Mutation Profiles	1.0	null
Granule cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.515
H2AFZ	ENCODE Transcription Factor Targets	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-TT-A6YJ-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE218580_1_v_2_fentanyl_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
Cerebral gyrus	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.093
DG(15:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WL46-2826-SM-3LK81	GTEx Tissue Sample Gene Expression Profiles	1.0	1.6836
DG(16:1n7/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
SW 403	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.897795
AN3CA	CCLE Cell Line Gene Mutation Profiles	1.0	null
C-Reactive Protein Measurement	DisGeNET Gene-Phenotype Associations	1.0	null
vitamin c_mus musculus_gpl6246_gse32994	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GTEX-Q2AG-0011-R11A-SM-2HMKZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.81511
posteromedial visual area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.06908
DDX27	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.49676
RASL10B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67902
SSR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78645
GTEX-R55E-0008-SM-48FCG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PVOW-0008-SM-48TE8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
C2orf81	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.11998
Stat4	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	26.0432
Brain Lower Grade Glioma_LGG_TCGA-HT-7856-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Antennal lobe	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.536
r5 part of dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.21161
hippocampus (hippocampal formation)_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.15892
GTEX-WZTO-0011-R10B-SM-4E3KB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08998
NAMALWA	COSMIC Cell Line Gene Mutation Profiles	1.0	null
substantia nigra reticulata, m1 part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.33112
GTEX-X4XX-3026-SM-3NMB2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04867
DG(14:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
r6 part of dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.5809
KP-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.20529
JHU022	DepMap CRISPR Gene Dependency	1.0	2.31805
ARPP19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30207
lateral ganglionic eminence_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.855386
long qt syndrome	GWASdb SNP-Disease Associations	1.0	0.959328
GSE153836_11_v_2_fluoxetine_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
DG(24:1n9/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4n3/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
NIBR189	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.23
SEMA6C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.47228
Cerebellar granule cell to Purkinje cell synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.151
DU-145	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE203308_4_v_3_brf1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
SLC25A3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.4549
obsessive-compulsive disorder	GWASdb SNP-Disease Associations	1.0	0.654134
GTEX-RNOR-0008-SM-48FEY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Vestibular hair cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.726
LNCAP-CLONE-FGC	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
VZ in caudal midinferior temporal cortex (area TF)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.40934
superficial stratum of r1BI	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19988
GTEX-QVUS-0011-R4A-SM-3GAE7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.978633
GBX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.12535
neuron	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.786052
Perturb_2237_KO_Malat1_SRP193997	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-2.26841
SELENOM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.23882
GSE221539_1_v_3_lrrc10_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
HS737T	CCLE Cell Line Gene Expression Profiles	-1.0	-2.75723
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-GS-A9TX-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Mammalian uncoordinated homology 13, domain 2	InterPro Predicted Protein Domain Annotations	1.0	null
bone resorption disease	GWASdb SNP-Disease Associations	1.0	0.481016
FLNC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.71467
MYORG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74921
GTEX-POYW-0008-SM-48TE4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-O5YW-0526-SM-2YUMX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:2(11Z,14Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
periventricular stratum of r6Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.5821
GTEX-R45C-0008-SM-48FF2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(5Z,8Z,11Z,14Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-5117-01A-01R-1420-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
reticular nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.55535
GP5D	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Bromfenac	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.85
hsa-miR-543	TargetScan Predicted Conserved microRNA Targets	1.0	0.474009
alveolar sac	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.238706
MDA-MB-157	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.10117
AURKA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.28113
OC316	CCLE Cell Line Gene Mutation Profiles	1.0	null
lateral tuberal nuclei	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.44729
FAM200A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.32845
NCI-H2135	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.04642
DG(22:4(7Z,10Z,13Z,16Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
JHH-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
alveolar wall	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.413532
GSE89018_12_v_14_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
monogenic disease	GWASdb SNP-Disease Associations	1.0	0.257341
abnormality of extrapyramidal motor function	GWASdb SNP-Phenotype Associations	1.0	1.12492
mast cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.178263
GSE138815,GSE138817_0_v_2_kdm6a_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GLIS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68257
ZSWIM3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.57121
DG(16:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCIH1373	CCLE Cell Line Gene Mutation Profiles	1.0	null
UMUC1	CCLE Cell Line Gene Expression Profiles	-1.0	-1.51537
CA1 field, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.975283
PATL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67096
GTEX-WVLH-0011-R11A-SM-3MJFO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.99532
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Eye-endothelial cell	Tabula Sapiens Gene-Cell Associations	1.0	0.165531
DG(20:1(11Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
l45	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.52
menstrual irregularities	GWASdb SNP-Phenotype Associations	1.0	0.410331
NXPE3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30472
GSE118766_2_v_0_ifng_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-QCQG-1626-SM-48U26	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC10170086-41598_2023_34519_MOESM6_ESM.xlsx-Sheet3-The_overlapping_genes_between_significantly_co-expressed_genes_and_significantly_differentially_expressed_genes_of_BARX2_in_LIHC_BARX2	Rummagene Transcription Factor Associations 2026	1.0	null
abnormality of nervous system physiology	GWASdb SNP-Phenotype Associations	1.0	0.234377
UQCRH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49168
UBE2S	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.00151
GTEX-NL4W-0011-R10A-SM-2I3DY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02921
RCM-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
COR-L95	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
disease of anatomical entity	GWASdb SNP-Disease Associations	1.0	0.150725
Kidney Chromophobe_KICH_TCGA-KM-8442-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Martinotti cell_Brain_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
cerebellar cortex_23 yrs_M_12300	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.06367
presynaptic membrane	GO Cellular Component Annotations 2015	1.0	null
DDX39A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.5781
vitamin c_mus musculus_gpl6246_gse19377	GEO Signatures of Differentially Expressed Genes for Small Molecules	-1.0	null
Distal axon	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
CHD1_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SNU8	CCLE Cell Line Gene Mutation Profiles	1.0	null
ACN	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-T6MO-0008-SM-4DM6T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
layer II of area 35c	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.88242
Lung squamous cell carcinoma_LUSC_TCGA-22-A5C4-01A-12R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
MAPK15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65099
hsa-miR-524-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
age related macular degeneration	GWASdb SNP-Disease Associations	1.0	0.869084
DG(18:2(9Z,12Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EVX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16297
GSE193999,GSE194000_3_v_2_atf3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
cognitive performance	GAD Gene-Disease Associations	1.0	null
WIDR	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.988148
GSE252857_1_v_0_klf15_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-XUJ4-1726-SM-4BONW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cell-cell signaling	GO Biological Process Annotations 2015	1.0	null
GTEX-Q2AI-0008-SM-48U2H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZSCAN32	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8728
RNF225	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57266
CALU1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.40428
C6orf136	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.45708
CHCHD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.97439
CXCL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17658
GTEX-T6MN-2626-SM-32PMQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19106
CAND2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.67933
facial motor nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.43451
DG(24:1(15Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3447-01A-01R-1766-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
FOXD4L5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.53311
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H1838	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:1(13Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SHROOM3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86217
Parkinson Disease	DisGeNET Gene-Disease Associations	1.0	null
GTEX-QMR6-0008-SM-447AV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
KMS11	CCLE Cell Line Gene Expression Profiles	1.0	2.25277
MS751	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.57579
GSE173201_0_v_1_cisplatin_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-R55G-0008-SM-48FEX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XBED-1126-SM-48TCF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hindbrain	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.078497
DG(14:1n5/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
Basal dendrite	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.559
Mossy fiber rosette	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.855
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE196699_2_v_1_prdm16_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
hsa-miR-1271	TargetScan Predicted Conserved microRNA Targets	1.0	1.45615
GTEX-PWOO-0008-SM-48TDU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Genetic disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.165
DG(16:1(9Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
TUBG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64816
COLO775	CCLE Cell Line Gene CNV Profiles	1.0	1.58223
DG(20:1n9/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
GSE132759_4_v_2_fgfr1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:4n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
KMS27	DepMap CRISPR Gene Dependency	1.0	4.61332
GTEX-WHSE-0011-R3A-SM-3P5ZM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.13322
DNAAF10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68526
superficial stratum of r7Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.6792
GTEX-TKQ1-1326-SM-4DXU7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DB	CCLE Cell Line Gene CNV Profiles	-1.0	-1.64872
DG(18:3n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
H3K36me3_kidney_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(18:3n6/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
disease by infectious agent	GWASdb SNP-Disease Associations	1.0	0.259066
DG(22:1(13Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
plasma membrane part	GO Cellular Component Annotations 2015	1.0	null
Immune response to smallpox vaccine (IL-6)	GWAS Catalog SNP-Phenotype Associations	1.0	0.238523
ETS2	MotifMap Predicted Transcription Factor Targets	1.0	null
VIIIA, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.03292
orbital frontal cortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.51812
hsa-miR-548g	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
Glycinergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.921
cognitive disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.163938
synaptic transmission	GO Biological Process Annotations 2015	1.0	null
basal ganglia disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
GSE210101,GSE210114_2_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
UBXN2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54147
abnormality of eye movement	GWASdb SNP-Phenotype Associations	1.0	0.541565
BICR22	CCLE Cell Line Gene Expression Profiles	-1.0	-2.43642
DG(18:1(9Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1n9/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
dorsolateral prefrontal cortex_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.864191
GTEX-S7SE-0008-SM-33HB1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Head and Neck squamous cell carcinoma_HNSC_TCGA-H7-A6C5-11A-11R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
m2 part of substantia nigra compacta	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.1714
AKR7A2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.90455
DG(18:2n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Retrosplenial area, lateral agranular part, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.45687
GSE151612_4_v_7_pracinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
PA-TU-8988S	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.863068
hsa-miR-4729	TargetScan Predicted Conserved microRNA Targets	1.0	0.37496
GTEX-QEL4-1326-SM-447AD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WHSE-0011-R2A-SM-3P5ZL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08638
ASCL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.05557
Perturb_13399_KD_PBX1_SRP302267	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
Paraventricular nucleus of the thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.06385
GTEX-TSE9-3026-SM-3DB76	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24841
DG(18:4(6Z,9Z,12Z,15Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EBC1	CCLE Cell Line Gene CNV Profiles	1.0	2.06151
FGFR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03947
DG(15:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PVOW-2526-SM-2XCF7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40518
DG(24:1(15Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QDT8-0626-SM-48TYW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WVLH-0006-SM-3MJF7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Cochlear nuclei	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.08099
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-A8P1-01A-11R-A37L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
IER3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.59873
DG(18:2n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
Agranular insular area, ventral part, layer 2/3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.84431
CAL78	CCLE Cell Line Gene CNV Profiles	1.0	1.46493
Transport vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(18:4(6Z,9Z,12Z,15Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1n9/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
striatum_21 pcw_M_12886	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.884698
GTEX-QDVN-0006-SM-48U1R	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
non-neuronal cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.499223
Brain Lower Grade Glioma_LGG_TCGA-HT-7475-01A-11R-2027-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ATG3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.05753
GSE238116_3_v_2_egr1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
JVM3	CCLE Cell Line Gene Expression Profiles	1.0	1.66248
PKDCC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.03562
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
central nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
head	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.423818
layer 3 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.39589
HT-29	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.987317
DG(20:1(11Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNU638	DepMap CRISPR Gene Dependency	1.0	2.53254
GTEX-QV31-0008-SM-447AT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC11250262-41588_2024_1798_MOESM4_ESM.xlsx-ST18_665_top_menarche_genes-gene_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
SKA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32396
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Hippocampal mossy fiber to CA3 synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.256
kidney disease	GWASdb SNP-Disease Associations	1.0	0.947208
Perturb_9167_OE_miR2103p_SRP399610	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-7.26431
abnormality of the lung	GWASdb SNP-Phenotype Associations	1.0	0.520187
DG(24:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WL46-2926-SM-3LK82	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18708
STRADA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.02117
GTEX-WFG8-0006-SM-3GIKS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
S117	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:1(11Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
VMRCRCZ	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-WL46-0011-R11A-SM-3MJFT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.77817
GSE108675_3_v_0_slc1a4_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
primary auditory cortex (core)_4 mos_M_12890	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.09392
DG(18:2(9Z,12Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Munc13 homology 1	InterPro Predicted Protein Domain Annotations	1.0	null
DG(22:1n9/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
XRCC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60602
Pheochromocytoma and Paraganglioma_PCPG_TCGA-S7-A7WR-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE201042_6_v_4_ptpmt1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(20:3(5Z,8Z,11Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ERCC6L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.24832
DG(14:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QDT8-0011-R1A-SM-32PKS	GTEx Tissue Sample Gene Expression Profiles	1.0	0.8638
KE-37	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SNU-387	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.35274
external granular (germinal) layer of upper rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.67207
DG(20:4(5Z,8Z,11Z,14Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Parallel fiber to Purkinje cell synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.711
GTEX-QMR6-0011-R2A-SM-32PKV	GTEx Tissue Sample Gene Expression Profiles	1.0	1.25243
ZNF136	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.1075
cardiovascular system disease	GWASdb SNP-Disease Associations	1.0	1.10764
KYSE-50	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DDX17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05515
secretion	GO Biological Process Annotations 2015	1.0	null
TK10	COSMIC Cell Line Gene Mutation Profiles	1.0	null
EMP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.87587
GTEX-QV44-0008-SM-447AX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3n3/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
JMJD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.47791
GTEX-U8T8-0005-SM-3DB8F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TSSK6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.03578
MYO18A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34277
GTEX-XV7Q-0226-SM-4BRVL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC5668942-supp_gr.216721.116_Supplemental_Data_S2.xlsx-Artery_Tibial_IR-TE-SRCAP_SRCAP	Rummagene Transcription Factor Associations 2026	1.0	null
parataenial nucleus of thalamus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.861862
CAKI-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.50446
A549	COSMIC Cell Line Gene Mutation Profiles	1.0	null
skeletal system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055963
hsa-miR-4694-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
GAPDH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39396
DG(14:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
Restless legs syndrome	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	0.99
STAT3	ChEA Transcription Factor Targets	1.0	null
DG(22:2(13Z,16Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC8791933-41598_2022_4817_MOESM4_ESM.xlsx-PAX7_down-Unnamed_1_PAX7	Rummagene Transcription Factor Associations 2026	1.0	null
ANAPC7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07755
OE21	CCLE Cell Line Gene Mutation Profiles	1.0	null
orbital frontal cortex_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.914352
Eye-corneal keratocyte	Tabula Sapiens Gene-Cell Associations	1.0	0.115725
UNC5D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.02985
DG(22:2(13Z,16Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE147056_2_v_1_actl6b_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
ASCC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.66053
DG(18:1(9Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-N7MS-2526-SM-2D7W3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45257
Rectum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
GSE210101,GSE210114_6_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:2n6/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
VIIIB, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.4037
GTEX-QCQG-0526-SM-48U2A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WL46-0011-R2A-SM-3LK6O	GTEx Tissue Sample Gene Expression Profiles	1.0	0.885392
BHLHE23	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.9083
SGSM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59247
MC116	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.52577
IVNS1ABP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8979
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
GTEX-NPJ7-0011-R1a-SM-3GACT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2443
DG(20:2(11Z,14Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ABHD12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44875
ECHDC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38921
GTEX-PWN1-0626-SM-48TDT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-UJHI-0126-SM-4IHLP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE166004_7_v_0_pld1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
superficial stratum of the Fc	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.37456
hsa-miR-141	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
Perturb_6635_KO_SATB1_ERP024525	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-7.35684
DGKA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.26729
Central nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
DG(22:4n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
NRK cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.778
DG(22:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC10170086-41598_2023_34519_MOESM6_ESM.xlsx-Shee2-The_differentially_expressed_genes_between_the_BARX2_high_and_BARX2_low_group_of_LIHC_patients_BARX2	Rummagene Transcription Factor Associations 2026	1.0	null
DG(20:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
MRPL23	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18341
A375SKINCJ1	DepMap CRISPR Gene Dependency	1.0	4.26366
DG(22:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
NCI-H146	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
arcuate nucleus of the hypothalamus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.14558
gilles de la tourette syndrome	GWASdb SNP-Disease Associations	1.0	0.654134
Waist circumference	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.730103
Perturb_14684_KO_Prkaa1/Prkaa2_ERP006813	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.66877
DG(18:1n7/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
SEMA3G	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54402
GSE114232_8_v_11_mavs_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
VI, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.05155
GTEX-SUCS-0008-SM-4DM53	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF74	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.31935
Dermatomyositis_Muscle - Striated (Skeletal) (MMHCC)_GSE5370	GEO Signatures of Differentially Expressed Genes for Diseases	1.0	1.36988
tissues, cell types and enzyme sources	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
TNFRSF10B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8212
SHISA5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83422
GTEx Muscle 20-29 vs 50-59	GTEx Tissue-Specific Aging Signatures	1.0	23.3327
age-related macular degeneration	GWASdb SNP-Phenotype Associations	1.0	0.762459
NR1H4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.57946
Tongue	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.304
PRDM14-20953172-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
NCI-H2110	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Gustatory areas, layer 5	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.30196
DG(18:1n9/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7263-01A-11R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
establishment of localization	GO Biological Process Annotations 2015	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3465-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DPH1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98231
GTEX-RUSQ-0526-SM-2TF72	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PPT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59426
NSF	Pathway Commons Protein-Protein Interactions	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-K7-A5RG-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(16:1(9Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3925-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.55165
NCI-H146	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ZNF35	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.6202
DG(18:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_14982_KO_Setd1a_SRP330236	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	10.5328
Ventral posteromedial nucleus of the thalamus, parvicellular part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.17414
DG(16:1n7/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
TRMT2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49963
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RT-A6YC-01A-12R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
abnormal motor learning	MGI Mouse Phenotype Associations 2023	1.0	null
PMC3470785-NIHMS377161-supplement-12.pdf-1037-PHF20_PHF20	Rummagene Transcription Factor Associations 2026	1.0	null
GSE196671_6_v_8_obox4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE217115_2_v_5_alectinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-UTHO-2426-SM-4JBHD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TPSG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.79535
abnormality of the female genitalia	GWASdb SNP-Phenotype Associations	1.0	0.206149
Kidney renal clear cell carcinoma_KIRC_TCGA-B2-3923-01A-02R-1325-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEx Muscle 20-29 vs 60-69	GTEx Tissue-Specific Aging Signatures	1.0	26.8574
hippocampus (hippocampal formation)_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.861238
psychosis	GWASdb SNP-Phenotype Associations	1.0	0.558007
terete nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.20216
DG(22:5(7Z,10Z,13Z,16Z,19Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF350	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01598
MCF10DCIS.COM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.07922
Necrosis	CTD Gene-Disease Associations	1.0	1.08797
Neoplasm Metastasis	DisGeNET Gene-Phenotype Associations	1.0	null
PLBD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27447
Nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.039457
Zfp809	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	31.5429
ARL10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.76725
GTEX-PWN1-1526-SM-48TDA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Sodium channel complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.025
PMC12678582-41698_2025_1153_MOESM5_ESM.xlsx-Sheet1-Common_genes_between_OVCA420-ZNF217_and_MCF7_157_965_1122_ZNF217	Rummagene Transcription Factor Associations 2026	1.0	null
Dentate gyrus mossy fiber	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.991
CP in retrosplenial cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.83289
GTEX-WFON-0226-SM-3GIKR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
EN	COSMIC Cell Line Gene Mutation Profiles	1.0	null
IV, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.12977
Submedial nucleus of the thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.21536
DG(22:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GSE229468,GSE229471_0_v_3_znf587_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T6MN-0008-SM-4DM7H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MSTO211H	DepMap CRISPR Gene Dependency	1.0	4.10668
Presynaptic membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
GABA-A receptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.053
DG(14:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
abnormality of the male genitalia	GWASdb SNP-Phenotype Associations	1.0	0.213247
Gustatory areas, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.69739
DG(18:1(11Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-R3RS-0008-SM-48FF1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(5Z,8Z,11Z,14Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE124375_13_v_12_chd2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
superficial stratum of isBI	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.23877
DG(18:3(6Z,9Z,12Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Posterior amygdala	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.668
Dementia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.4
DG(22:1(13Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE196671_5_v_0_obox4_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
hippocampus (hippocampal formation)_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.51919
GTEX-PWOO-0326-SM-48TDB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE145915_3_v_4_pcm1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-5887-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC9882185-media-4.xlsx-Neuron_KD-gene_name_AR	Rummagene Transcription Factor Associations 2026	1.0	null
DG(14:0/0:0/15:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TMMY-1226-SM-4DXT6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
JARID1B-DAIN-22020125-ESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
neuron projection terminus	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.141091
PMC6137307-mmc2.xlsx-STAT2-IFNa-Table_S1_STAT2-IFNa_Related_to_Figures_1_4_STAT2	Rummagene Transcription Factor Associations 2026	1.0	null
GSE175787_8_v_2_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
496100514_FWM_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.70523
PMC7335061-41467_2020_17150_MOESM4_ESM.xlsx-Table_S3-LIN28B_correlates_LIN28B	Rummagene Transcription Factor Associations 2026	1.0	null
MCF12A	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.28932
SG in temporal polar cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.66549
bone marrow	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.086095
EIF4E3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94369
HCC1588	CCLE Cell Line Gene Mutation Profiles	1.0	null
PCM1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9041
DG(22:1n9/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7238-11A-01R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-DB-A4XH-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PPP5C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.29339
Myelinating Schwann cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.6
DG(16:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ALAD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41751
subcuneiform nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.28791
decitabine_homo sapiens_gpl571_gse29077	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GSE127790_10_v_3_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
RPMI8226	CCLE Cell Line Gene Expression Profiles	1.0	1.83992
GSE127790_9_v_2_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
Heart Defects, Congenital	CTD Gene-Disease Associations	1.0	1.11809
DG(22:2(13Z,16Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
pyramidal layer of caudal subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.837606
CL-34	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Perturb_3745_KO_Usp8_SRP301242	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
GTEX-PW2O-0126-SM-48TC8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
intermediate stratum of AStr	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.0001
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE145915_5_v_4_pcm1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
abnormal behavior	MPO Gene-Phenotype Associations	1.0	null
cell junction	GO Cellular Component Annotations 2015	1.0	null
DG(14:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
bone remodeling disease	GWASdb SNP-Disease Associations	1.0	0.425585
DG(14:1(9Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE205163,GSE205164_5_v_6_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(15:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
IRF1-19129219-H3396 breast cancer cells-human	ChEA Transcription Factor Binding Site Profiles	1.0	null
decitabine_homo sapiens_gpl570_gse30985	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PAQR9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51747
NCIH441	DepMap CRISPR Gene Dependency	1.0	6.34314
GTEX-WZTO-0006-SM-3NM9T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:3n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T5JC-0011-R4A-SM-32PLT	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83114
GTEX-P4QR-0426-SM-2S1NV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
P2RY2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92601
DG(20:1n9/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
single-organism cellular process	GO Biological Process Annotations 2015	1.0	null
PMC8528285-pbio.3001085.s010.xlsx-Fig_S8A-MLX_3T3_MLX	Rummagene Transcription Factor Associations 2026	1.0	null
striatum_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.0294
MDAMB361	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.35166
DG(20:3(8Z,11Z,14Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Visual cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.482
GSE236511_1_v_0_ngfr_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
disease	GWASdb SNP-Disease Associations	1.0	0.168202
DG(16:1(9Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Gliosis	CTD Gene-Disease Associations	1.0	1.11945
Kidney renal papillary cell carcinoma_KIRP_TCGA-MH-A857-01A-11R-A355-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_8451_KD_EphA2_SRP237314	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	11.0677
Agranular insular area, dorsal part, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.57572
V, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.22105
ZNF154	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65156
GTEX-RVPU-0011-R3A-SM-2XCAE	GTEx Tissue Sample Gene Expression Profiles	1.0	0.986739
DCP1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22866
NCI-H1573	COSMIC Cell Line Gene Mutation Profiles	1.0	null
regulation of biological process	GO Biological Process Annotations 2015	1.0	null
DG(22:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
496100391_FWM_no dementia_TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.72418
r8 part of inferior olive	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.44066
DG(16:1n7/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XPVG-0008-SM-4GICH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
furan	CTD Gene-Chemical Interactions	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE76425_0_v_10_lenalidomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1(15Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
OVISE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
DG(22:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SAS cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.757
DG(22:1n9/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
oocyte	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.70575
FOXA1_T47D_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(24:1(15Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
mantle zone of Hb	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.80324
EN	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-R55E-0011-R7A-SM-2TC5Z	GTEx Tissue Sample Gene Expression Profiles	1.0	0.927372
DG(22:2(13Z,16Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
viscus	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.050883
GTEX-WWYW-0011-R11A-SM-3NB38	GTEx Tissue Sample Gene Expression Profiles	1.0	1.38944
DG(16:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PIP4P1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7264
DG(20:3n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-U412-0826-SM-3DB9K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-T5JC-1226-SM-4DM7C	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XOT4-1426-SM-4B65T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCI-H2228	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE158632_2_v_1_oxyquinoline_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MYC_01_237	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	1.85935
DG(18:1(11Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PWO3-0011-R3A-SM-2I5EX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19688
Astrocyte_Hippocampus_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
DG(22:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CEBPD-21427703-3T3-L1-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-WVLH-0011-R4A-SM-3MJFS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.17206
DG(16:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-E1-A7YY-01A-11R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(24:1(15Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SOX11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.4362
Bladder Urothelial Carcinoma_BLCA_TCGA-GV-A3JV-01A-11R-A220-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_10637_KO_Sip1_SRP028877	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
DG(14:1(9Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A81R-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Transverse temporal cortex volume	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.6
RPMI-7951	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-VJYA-0626-SM-4KL1S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
UMUC11	DepMap CRISPR Gene Dependency	1.0	7.2672
Dendrite terminus	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.566
GTEX-NL3H-0011-R6a-SM-2I3G8	GTEx Tissue Sample Gene Expression Profiles	1.0	0.866124
Mitochondrial respiratory chain complex I	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.706
BNC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.9691
DG(18:4(6Z,9Z,12Z,15Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE133505_5_v_4_myf6_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(20:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2(11Z,14Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
HEC108	CCLE Cell Line Gene Mutation Profiles	1.0	null
PKIA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32443
GTEX-PVOW-2626-SM-32PL8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.78765
DG(22:2(13Z,16Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TWF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.00102
GTEX-WL46-0011-R7A-SM-3LK7X	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01076
Brain Lower Grade Glioma_LGG_TCGA-DU-8162-01A-21R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
BHT-101	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-RU72-0011-R7A-SM-2TF5U	GTEx Tissue Sample Gene Expression Profiles	1.0	0.836901
substance dependence	GWASdb SNP-Disease Associations	1.0	0.339823
hippocampus (hippocampal formation)_16 pcw_M_12879	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.59676
IGR-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-524-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.099701
T3M4	CCLE Cell Line Gene Mutation Profiles	1.0	null
REST	ENCODE Transcription Factor Targets	1.0	null
RPIA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93882
Oviduct	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
DG(20:4(5Z,8Z,11Z,14Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
caudal division of IPC (area 39)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.911529
osteoblasts	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-0.906826
SNUC2A	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_4867_KO_HES1/NEUROG3_ERP110708	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	6.86809
posterior (caudal) superior temporal cortex (area 22c)_4 mos_M_12889	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.168
cerebellar cortex_11 yrs_F_12289	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	2.72214
GTEX-WFG7-0005-SM-3GIKM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCI-H920	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.861197
DG(20:3(5Z,8Z,11Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XXEK-1126-SM-4BRUX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE175787_13_v_10_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
GSE198165,GSE198166_7_v_10_zfp266_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
SMARCD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35456
TLX1::NFIC	MotifMap Predicted Transcription Factor Targets	1.0	null
REC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.52885
DG(18:3(6Z,9Z,12Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XUYS-0005-SM-47JZ2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GCT	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(24:1n9/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
Perturb_15064_OE_Trp53_SRP345823	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-8.00027
Pars tuberalis	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.636
DG(24:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TSE9-0011-R6A-SM-3DB7L	GTEx Tissue Sample Gene Expression Profiles	1.0	0.84322
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A3AH-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HW-8319-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-UTHO-0011-R3A-SM-3GIK8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39212
ARHGAP27	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58979
DG(20:4(8Z,11Z,14Z,17Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PWO3-0011-R1A-SM-2I5EW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10164
duodenum	HPA Tissue Protein Expression Profiles	1.0	0.801417
TRIM56	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86008
MHH-PREB-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
lipid binding	GO Molecular Function Annotations 2015	1.0	null
DG(20:2(11Z,14Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
polymorphic layer of caudal subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.12138
ribavirin_homo sapiens_gpl570_gds4391	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
tissues, cell types and enzyme sources	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
ECSIT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89838
mucous cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.378372
GSE138019_1_v_5_nudt12_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-X4XX-0011-R3B-SM-46MWK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11584
GTEX-PVOW-0011-R3A-SM-32PKX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12437
GTEX-WL46-0011-R10A-SM-3MJFQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18914
GTEX-QVJO-0011-R10A-SM-2S1QJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20593
GSE231720,GSE231724_2_v_0_setd2_human	RummaGEO Gene Perturbation Signatures	1.0	null
cerebellum	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
Central linear nucleus raphe	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.31548
Death	CTD Gene-Disease Associations	1.0	1.07376
GTEX-VUSG-1526-SM-4KKZH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-1260	TargetScan Predicted Conserved microRNA Targets	1.0	1.11641
Presynaptic active zone	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
RPL41	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.36019
reticular formation of p1Lim	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.2989
GTEX-RVPV-0011-R11A-SM-2TF6F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.6844
DG(16:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LOVO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
mucosa	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.089091
NCI-H2009	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
ctnnb1_19652203_myeloma_lof_human_gpl570_gds3578	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.664199
RPMI8226	DepMap CRISPR Gene Dependency	1.0	2.94438
ARHGAP39	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.2901
B3GAT3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12046
DG(15:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
HERC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5783
GSE88819_7_v_8_tug1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Liver epithelial cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.722
GTEX-QDT8-0011-R11A-SM-32PKD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.95489
DG(20:3(8Z,11Z,14Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
HSF2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	23.9949
PMC11801220-NIHMS2038999-supplement-16.xlsx-Exc-SKOR2-gene_SKOR2	Rummagene Transcription Factor Associations 2026	1.0	null
DG(22:4n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
PAM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.24973
DG(20:4(8Z,11Z,14Z,17Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
H2AFZ_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Sarcoma_SARC_TCGA-K1-A6RT-01A-32R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-P78B-2226-SM-3P5ZZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE112714_2_v_0_ctnnb1_human	RummaGEO Gene Perturbation Signatures	1.0	null
Perturb_1310_KO_Cntnap4_SRP387040	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.07065
DG(20:1n9/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
ACKR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31968
BTN3A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58781
globus pallidus, external segment, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.42296
DG(14:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
WM2664	CCLE Cell Line Gene Mutation Profiles	1.0	null
central nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Perturb_2236_KO_Malat1_SRP193997	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-4.57142
BEX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36886
GTEX-WEY5-0006-SM-3GIKG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
central glial substance	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.6932
SKOV3	CCLE Cell Line Gene Mutation Profiles	1.0	null
STAT3-23295773-U87-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
GTEX-XMD1-0011-R11A-SM-4AT5J	GTEx Tissue Sample Gene Expression Profiles	1.0	1.56976
GSE119694_1_v_0_lifr_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
C1orf56	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.67029
PDE7A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.91809
syntaxin-1 binding	GO Molecular Function Annotations 2025	1.0	null
UQCC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.09754
DG(20:4(8Z,11Z,14Z,17Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Head	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
area postrema	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.00005
znf148_21828133_erythroblast_lof_human_gpl571_gse31092	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.010508
DG(22:5(7Z,10Z,13Z,16Z,19Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
Synaptic membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
r3 part of dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19637
GTEX-N7MS-0011-R3a-SM-33HC6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.37746
GSE92457_9_v_10_ethanol_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-S4Q7-0008-SM-3NM8A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MEIS1-26253404-OPTIC-CUPS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
IP6K1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79516
GTEX-XLM4-0011-R10A-SM-4AT5P	GTEx Tissue Sample Gene Expression Profiles	1.0	0.879941
DG(18:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ST13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.93631
DG(18:1n7/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
Disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.735
GTEX-XYKS-1526-SM-4BRUP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
C1orf52	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51266
Cognitive performance	GWAS Catalog SNP-Phenotype Associations	1.0	0.220915
Eye-retinal bipolar neuron	Tabula Sapiens Gene-Cell Associations	1.0	0.314948
GTEX-QDT8-0011-R2A-SM-32PKQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.05428
GSE92457_9_v_12_ethanol_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
TCF7L1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.4995
Neuron projection terminus	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.827
Clozapine	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.43
Tauopathy	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.232
DG(14:1(9Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
gallbladder	HPA Tissue Gene Expression Profiles	1.0	0.856481
GTEX-XMD1-2826-SM-4AT5F	GTEx Tissue Sample Gene Expression Profiles	1.0	1.27355
GSE146894_3_v_8_hira_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Cerebellar granule cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.425
Perturb_5501_Mut|KO_Hras_SRP026484	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	18.2076
GTEX-UJMC-0926-SM-4IHLK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WH7G-0008-SM-4LVNM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OVCAR-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
M07E	CCLE Cell Line Gene Mutation Profiles	1.0	null
TBX3-20139965-MESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Bipolar cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.036
TOV112D	CCLE Cell Line Gene CNV Profiles	-1.0	-1.522
parallel fiber	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.603596
Nervous System Diseases	CTD Gene-Disease Associations	1.0	1.01474
GTEX-RVPU-0011-R10A-SM-2XCAH	GTEx Tissue Sample Gene Expression Profiles	1.0	1.00735
CDK8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56723
20460173-ImmPortComprehensiveListofImmune-RelatedGenes	GeneSigDB Published Gene Signatures	1.0	null
GTEX-T2IS-0008-SM-4DM75	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1n9/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
ventral tier of thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.34011
RASSF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.02015
PLA2G3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94368
anterior pretectal nucleus, ventral superficial part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.39315
Presynaptic active zone cytoplasmic component	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
GTEX-T5JC-0011-R10A-SM-32PM2	GTEx Tissue Sample Gene Expression Profiles	1.0	0.973551
Kidney renal papillary cell carcinoma_KIRP_TCGA-BQ-7055-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
mantle zone of the Fc	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.37456
Synaptic vesicle membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
MICU2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81631
DG(20:5n3/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE145915_0_v_1_pcm1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC4082627-12864_2014_6197_MOESM8_ESM.xlsx-GATA3_only-Gene_Name_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
neoplasm	GWASdb SNP-Phenotype Associations	1.0	0.049249
GTEX-R55E-0011-R4A-SM-2TC5H	GTEx Tissue Sample Gene Expression Profiles	1.0	0.953158
GTEX-QCQG-0226-SM-48U28	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GDF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.86365
DG(14:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QDT8-0011-R10A-SM-32PKG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20692
abnormal respiratory system morphology	GWASdb SNP-Phenotype Associations	1.0	0.13564
DG(18:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MRPS18A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.51246
DG(22:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AG-0011-R4A-SM-2HMKA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04369
DG(22:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF813	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.43301
DG(16:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Neuromuscular junction	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(18:2(9Z,12Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-SJXC-0008-SM-4DM7G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-V955-2026-SM-3GAFA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE138001_0_v_3_rorb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
SYT12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.97421
DG(20:1n9/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2(13Z,16Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0e/2:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
dementia	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.226607
GTEX-XQ8I-1526-SM-4BOOH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
microbody	LOCATE Predicted Protein Localization Annotations	1.0	null
GSE205163,GSE205164_9_v_7_znf808_human	RummaGEO Gene Perturbation Signatures	1.0	null
GSE147876,GSE147877_2_v_0_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
anterograde trans-synaptic signaling	GO Biological Process Annotations 2023	1.0	null
GSE203329_0_v_1_mettl5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE158320,GSE183351_2_v_3_lin28b_human	RummaGEO Gene Perturbation Signatures	1.0	null
DG(20:4n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
atrophy/degeneration affecting the central nervous system	GWASdb SNP-Phenotype Associations	1.0	0.509391
ESO51	DepMap CRISPR Gene Dependency	1.0	2.20493
cell junction	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
DG(18:3(9Z,12Z,15Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.413
DG(18:1n9/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GSE210101,GSE210114_2_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:1(11Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Spinal nucleus of the trigeminal, oral part, rostral dorsomedial part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.05511
GSE179036_1_v_0_trim24_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(14:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
GSE214823,GSE214824_6_v_7_crtc2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-Q2AH-1026-SM-48TZI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Mesothelioma_MESO_TCGA-LK-A4NW-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Kidney renal clear cell carcinoma_KIRC_TCGA-B8-5549-11A-01R-1541-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WFG7-0526-SM-3GIKI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
V, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.910012
Agranular insular area, dorsal part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.42222
DG(18:0/0:0/18:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QMR6-0011-R1A-SM-32PKW	GTEx Tissue Sample Gene Expression Profiles	1.0	0.973372
DG(18:1n7/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AG-0008-SM-48U2K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ANKRD13A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.59421
GTEX-RU1J-0006-SM-2TF6M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
KMS-28BM	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(9Z,12Z,15Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DU145	CCLE Cell Line Gene Mutation Profiles	1.0	null
TCF4-22108803-LS180-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
DG(24:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
GSE217115_2_v_0_alectinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(20:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-507	TargetScan Predicted Conserved microRNA Targets	1.0	0.714812
NFX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91138
GSE120612_4_v_5_etoposide_human	RummaGEO Drug Perturbation Signatures	1.0	null
BT20	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.15413
DG(22:1(13Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE138815,GSE138817_3_v_1_kdm6a_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
H3K4me3_ES-E14_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
abnormality of metabolism/homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.048511
DG(22:1(13Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_821_OE_Rspo1_SRP325709	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	13.5405
DG(18:1(9Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-1280	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
DG(20:1(11Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Retrosplenial area, ventral part, layer 2	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.06458
GTEX-PWOO-2526-SM-2S1PG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7245-11A-01R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
MEWO	CCLE Cell Line Gene Mutation Profiles	1.0	null
phenotypic abnormality	GWASdb SNP-Phenotype Associations	1.0	1.04365
Crus II, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.919607
DG(24:1(15Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Cognitive performance	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.6
A3KAW	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-OXRL-0726-SM-3NM9A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Subiculum	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.792
hsa-miR-520c-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.159923
Perturb_15804_KO_Atf3_SRP350242	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	20.0
ZNF705B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.89438
immune system disease	GWASdb SNP-Disease Associations	1.0	0.099777
layer V of area 35c	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.52112
DG(20:4(8Z,11Z,14Z,17Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
QGP-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-O5YV-1826-SM-2YUNI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCIH1339	CCLE Cell Line Gene CNV Profiles	1.0	1.81184
Prostate adenocarcinoma_PRAD_TCGA-G9-6378-01A-11R-1789-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE166004_5_v_0_pld1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
S100A6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74397
HCC56	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:5n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
OVCAR8	CCLE Cell Line Gene Expression Profiles	-1.0	-1.50161
Taenia tecta, ventral part, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.8789
DG(18:3(9Z,12Z,15Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
membrane	GO Cellular Component Annotations 2015	1.0	null
DG(20:2(11Z,14Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-R55G-0326-SM-48FDM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-R3RS-1326-SM-48FE7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE164757,GSE164759_4_v_3_trametinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
KPL1	CCLE Cell Line Gene CNV Profiles	1.0	2.03899
Bladder Urothelial Carcinoma_BLCA_TCGA-KQ-A41N-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
intermediate stratum of r3Ve	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.27947
GSE88819_5_v_9_tug1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GSE201042_6_v_0_ptpmt1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
intermediate stratum of LPrP	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.41481
C10orf105	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30867
Brain Lower Grade Glioma_LGG_TCGA-FG-A713-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SPIC	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.3508
DG(20:3(5Z,8Z,11Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE95077_1_v_3_amiloride_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-PWOO-1226-SM-48TCO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
MRPL32	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37707
hsa-miR-618	TargetScan Predicted Conserved microRNA Targets	1.0	0.205675
Oral cancer cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.695
DG(20:4(5Z,8Z,11Z,14Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
cerebral cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.094178
PNMA6F	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66796
KMS28BM	CCLE Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-3689a-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.241055
LGR4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.36066
NFATC4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.6799
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain stem	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
MAGI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58319
CCNO	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13765
NCIH1651	CCLE Cell Line Gene CNV Profiles	1.0	1.63544
DG(24:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Hindbrain	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
Primary visual area, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.24634
GSE174406_2_v_1_lin28b_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
MLF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86597
HEC6	CCLE Cell Line Gene Mutation Profiles	1.0	null
IMPDH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.84758
Human - Motor Cortex - Cluster - VIP+ COL4A3+ Layer 5-6 GABAergic neuron	HuBMAP Azimuth Cell Type Annotations	1.0	null
CFL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56772
GTEX-TKQ1-0008-SM-4DXSO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MFSD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06264
JHOS2	DepMap CRISPR Gene Dependency	1.0	6.04551
CAPRIN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.06399
Lung squamous cell carcinoma_LUSC_TCGA-85-7950-01A-11R-2187-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:4n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
PPARD-21283829-MYOFIBROBLAST-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
REH	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-XXEK-0626-SM-4BRWE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
REEP6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96021
Infralimbic area, layer 2/3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.07983
DG(20:3(8Z,11Z,14Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
KYSE-510	COSMIC Cell Line Gene Mutation Profiles	1.0	null
H3K9me3_megakaryocyte_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
axon part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.238837
abnormality of the fundus	GWASdb SNP-Phenotype Associations	1.0	0.212611
DG(20:1(11Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSU	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:1(13Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MFAP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01212
Perturb_14444_KO_Mtor_SRP144775	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-1.49646
TBC1D4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.23705
r7 part of the dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.3813
gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.052536
Nanog_KD_GDS1824_134_mouse_embryonic stem cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
GTEX-U3ZM-0008-SM-4DXTQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hippocampus (hippocampal formation)_13 pcw_M_12888	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.38971
Laterodorsal thalamic nucleus	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.528
DG(20:3(8Z,11Z,14Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
MDAMB361	CCLE Cell Line Gene Mutation Profiles	1.0	null
NCIH2122	CCLE Cell Line Gene CNV Profiles	1.0	1.48143
GTEX-T2IS-0826-SM-4DM6L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
CAPAN-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.79746
GTEX-XQ3S-0626-SM-4BOOB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
superior olivary complex, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.863251
SK-OV-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3(5Z,8Z,11Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
KE97	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
deutocerebrum	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.501182
Cerebellar Purkinje cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.451
DG(22:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-P5-A5F0-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder	GTEx Tissue Gene Expression Profiles 2023	1.0	2.81682
r8 part of the paragigantocellular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19197
GTEX-WCDI-0005-SM-3NB2M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-PWOO-0826-SM-48TCL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNX30	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32164
NCIH2066	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-RM2N-0326-SM-48FD8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:1(13Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SOX2-22085726-NPCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Cholinergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.159
Poisoning	CTD Gene-Disease Associations	1.0	1.44327
GTEX-QMRM-0008-SM-447B1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1(9Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T6MO-1426-SM-4DM73	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-PWCY-0005-SM-33HBP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Infertility, Female	CTD Gene-Disease Associations	1.0	1.01549
DNAJC8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51474
NCIH446	CCLE Cell Line Gene Mutation Profiles	1.0	null
ZNF254	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36342
GTEX-T5JC-0011-R2A-SM-32PLZ	GTEx Tissue Sample Gene Expression Profiles	1.0	0.923821
SCML1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.50818
HCC1143	CCLE Cell Line Gene Mutation Profiles	1.0	null
SW 1463	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.36693
Body Mass Index	dbGAP Gene-Trait Associations	1.0	0.370768
synaptic vesicle docking	GO Biological Process Annotations 2023	1.0	null
ESRRB	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	21.5227
cytoplasm	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
cone-rod dystrophy 7	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.202
GTEX-T5JW-0426-SM-4DM7M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
INO80D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.8635
PPP1R8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23604
HOXA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21519
MEC2	CCLE Cell Line Gene Expression Profiles	1.0	2.13085
Agranular insular area, ventral part, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.48805
UAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.62178
GTEX-PWN1-0008-SM-48TEA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE228106_0_v_1_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(14:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X62O-0008-SM-46MU5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2n6/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
membrane part	GO Cellular Component Annotations 2015	1.0	null
DG(22:2(13Z,16Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X4XY-0006-SM-46MV2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
WDR77	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8158
GTEX-WFG7-0008-SM-4LMKB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC11801220-NIHMS2038999-supplement-14.xlsx-Exc-SKOR2-gene_SKOR2	Rummagene Transcription Factor Associations 2026	1.0	null
DAD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53379
DG(18:1n9/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RS4-11	COSMIC Cell Line Gene Mutation Profiles	1.0	null
KDM5A	ENCODE Transcription Factor Targets	1.0	null
DG(20:3n9/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
A2780	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ATMIN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79261
NCIH211	CCLE Cell Line Gene CNV Profiles	-1.0	-3.21049
GTEX-SUCS-1126-SM-4DM61	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE81803,GSE81912_4_v_1_fmr1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
parvocellular part of r8LRt	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.66896
intermediate stratum of Hb	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.20749
GSE112995,GSE132079_1_v_0_ezh2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
CTCF	ENCODE Transcription Factor Targets	1.0	null
Synapse	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
SOX9	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.3553
RASD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37348
TOR1AIP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45284
breast	HPA Tissue Protein Expression Profiles	-1.0	-0.890577
testis_4a	HPA Tissue Sample Gene Expression Profiles	1.0	1.14502
GTEX-WZTO-0011-R3B-SM-3NMC6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06313
GSE158458_2_v_3_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-RWS6-0008-SM-47JYV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-U3ZH-0008-SM-4DXT2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-RWS6-0326-SM-2XCAP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OAW28	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.919037
SP in primary somatosensory cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.18219
DG(14:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
UM-UC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.64169
TBX1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.5058
HUNS1	CCLE Cell Line Gene Expression Profiles	1.0	2.05274
Lymphoblast	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.823
C2orf49	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.87266
IM-95	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-X8HC-0126-SM-4E3JW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-TSE9-0011-R4A-SM-3DB7H	GTEx Tissue Sample Gene Expression Profiles	1.0	1.4296
Perturb_13742_KO_Nfib_SRP096738	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	1.58738
MAP3K3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22324
DG(18:2n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T5JW-1426-SM-4DM5Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Infundibulum	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.822
VAV1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08002
YAF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.08865
DG(24:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE158502,GSE158506_3_v_0_fat1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-TKQ2-0426-SM-4DXUO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
M14	COSMIC Cell Line Gene Mutation Profiles	1.0	null
TEF-1	MotifMap Predicted Transcription Factor Targets	1.0	null
PMC3841787__F5	PFOCR Pathway Figure Associations 2024	1.0	null
GSE99687_3_v_1_smad5_human	RummaGEO Gene Perturbation Signatures	1.0	null
cellular_component	GO Cellular Component Annotations 2015	1.0	null
HSDL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56883
GSE196699_2_v_3_prdm16_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-XMK1-0126-SM-4B65F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCI-H1581	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.05808
GTEX-S3XE-0006-SM-3K2AA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCI-H1436	COSMIC Cell Line Gene Mutation Profiles	1.0	null
bipolar disorder	GWASdb SNP-Disease Associations	1.0	0.623051
DG(20:3n9/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
Medial habenula	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.03715
GTEX-XQ8I-0726-SM-4BOPU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE135030_8_v_6_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(18:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T2IS-0011-R3A-SM-32QPB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.35592
GTEX-T6MN-0011-R10A-SM-32QP7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.16932
primary visual cortex (striate cortex, area V1/17)_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.02979
lymphopenia	GWASdb SNP-Disease Associations	1.0	0.751885
DG(20:3(8Z,11Z,14Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
HCC-15	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.863068
GSE258991_5_v_2_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-PWCY-0008-SM-48TE9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3145-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
red nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.46226
B-lymphoblast	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.823
DG(20:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RWDD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79322
GTEX-NL3H-0011-R10A-SM-2I3E9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10042
DG(16:1(9Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
TBX3-20139965-ESCS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-T2YK-0326-SM-4DM7D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
dorsal part of alar p2	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.806
GTEX-W5WG-1626-SM-4LMKG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TADA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8895
GSE110248_1_v_6_romidepsin_human	RummaGEO Drug Perturbation Signatures	1.0	null
hsa-miR-922	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
GTEX-NPJ8-2626-SM-2D7W2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.3825
KE39	CCLE Cell Line Gene CNV Profiles	-1.0	-1.37241
GSE151612_4_v_2_pracinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE113385_0_v_1_six1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
hsa-miR-3924	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
DG(16:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCIH1436	CCLE Cell Line Gene Mutation Profiles	1.0	null
bipolar affective disorder	GWASdb SNP-Phenotype Associations	1.0	0.529158
DG(18:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE171179,GSE171181_0_v_1_e7107_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(20:3(8Z,11Z,14Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
m15	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.589
PMC12754469-ab-25-0159-Supplementary-1.pdf-30-SNAPC5_SNAPC5	Rummagene Transcription Factor Associations 2026	1.0	null
TEX261	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.38809
H3K9me3_ES-Bruce4_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GTEX-XXEK-0926-SM-4BRWH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
central nervous system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.044129
establishment of localization in cell	GO Biological Process Annotations 2015	1.0	null
frontal lobe	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.439507
embryonic structure	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.06195
frontalcortex	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.06656
CJM	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-TSE9-0005-SM-4DXUF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:4(7Z,10Z,13Z,16Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RU72-0326-SM-2TF5T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
motor nucleus of trigeminal nerve, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.923143
GTEX-SNOS-0526-SM-4DM54	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MARCHF6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.01654
presynaptic active zone	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
psychomotor performance	GAD Gene-Disease Associations	1.0	null
A-427	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04004
GSE181959_1_v_2_dextran_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZC3HC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.84653
GSE164757,GSE164759_1_v_3_trametinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
Disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	0.99
Agranular insular area, dorsal part, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.01674
ZMYND11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.36324
ULK1_knockout_198_GSE60778	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-1.22015
DG(15:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PSMB10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07909
VIIAf	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.05474
icSARS-Cov_Day4_None_GSE50000	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	1.74706
abnormal eye physiology	GWASdb SNP-Phenotype Associations	1.0	0.20527
DG(18:4(6Z,9Z,12Z,15Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TBXT	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.512
EBC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.46314
A375	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE178907_4_v_3_fkrp_human	RummaGEO Gene Perturbation Signatures	1.0	null
DG(20:2n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T5JW-0226-SM-4DM7I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
fallopian tube	HPA Tissue Protein Expression Profiles	1.0	0.801417
DG(18:4(6Z,9Z,12Z,15Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_13141_KO_Ctr1_SRP165861	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.27012
ACBD6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.00683
Cell cortex	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
CCL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21692
GADD45B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.09926
CA2 field, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.41974
CW2	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC3296722-pone.0032481.s009.xlsx-Sheet_1_MSC_vs_references-Gene_Symbol_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-U3ZN-2126-SM-4DXU1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SNU-175	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-Q734-1626-SM-48U1B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
inferolateral temporal cortex (area TEv, area 20)_37 yrs_M_12303	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.895856
DG(20:3(8Z,11Z,14Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
UMUC1	CCLE Cell Line Gene CNV Profiles	1.0	2.27569
Buccal mucosa	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.358
DG(18:3n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1(15Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
specific developmental disorder	GWASdb SNP-Disease Associations	1.0	0.257559
GSE125153_1_v_0_bcl3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
H3K9me3_CD14-positive monocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
Epithalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.13333
posterior (caudal) superior temporal cortex (area 22c)_4 mos_M_12296	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.11702
DG(24:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
COLO678	DepMap CRISPR Gene Dependency	1.0	2.0004
RPS6KA5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96038
DG(16:1(9Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MDA-MB-453	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.20403
DG(20:4(8Z,11Z,14Z,17Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
blood vessel	GTEx Tissue Gene Expression Profiles	1.0	0.921956
DG(15:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-4470	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
TNFRSF8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.41798
GSE169205_0_v_1_sirt5_human	RummaGEO Gene Perturbation Signatures	1.0	null
upper (rostral) rhombic lip	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.24196
GLYATL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60813
GTEX-XV7Q-1726-SM-4BRUU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1(9Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
IZ in midlateral extrastriate cortex (area 19)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.08634
Pancreatic adenocarcinoma_PAAD_TCGA-S4-A8RP-01A-11R-A36G-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-WZTO-0011-R4A-SM-3NMC7	GTEx Tissue Sample Gene Expression Profiles	1.0	1.60589
NANOGNB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.45501
Agranular insular area, ventral part, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.67404
DG(15:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
motor neuron atrophy	GWASdb SNP-Phenotype Associations	1.0	0.509391
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
liminal reticular formation of m2	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.64496
DG(24:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-U3ZN-0926-SM-4DXTU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Menarche (age at onset)	GWAS Catalog SNP-Phenotype Associations	1.0	0.129504
SNU-283	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_MAP_AA-SYMBOL_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WI4N-0626-SM-3TW8Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
trochlear nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.19656
DG(18:1(9Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Tongue cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.261
neuron part	GO Cellular Component Annotations 2015	1.0	null
COV318	CCLE Cell Line Gene Mutation Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EK-A3GM-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE172016_2_v_5_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSTO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86354
Head and Neck squamous cell carcinoma_HNSC_TCGA-CN-5356-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chemical synaptic transmission	GO Biological Process Annotations 2025	1.0	null
SYNGR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86415
NCI-H1869	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.06388
SKMM2	DepMap CRISPR Gene Dependency	1.0	2.41087
DG(24:1(15Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
STAT4	MotifMap Predicted Transcription Factor Targets	1.0	null
Placenta	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
DG(24:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
HCC1171	CCLE Cell Line Gene Mutation Profiles	1.0	null
bone disease	GWASdb SNP-Disease Associations	1.0	0.166683
exocytic vesicle membrane	GO Cellular Component Annotations 2023	1.0	null
GTEX-WFG7-1526-SM-4LVMG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
nucleus of the inferior collicular brachium, caudal part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.08014
DG(18:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-SNOS-0626-SM-4DM5F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WHSE-0011-R11A-SM-3P5YY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39107
DG(20:2(11Z,14Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XQ8I-1926-SM-4BOOK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Whole body	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
abnormal motor neuron morphology	GWASdb SNP-Phenotype Associations	1.0	0.509391
DG(24:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
KYSE-140	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
cellular_component	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.046193
GTEX-WHSE-0011-R4A-SM-3P5ZN	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2327
PPP6R3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.22733
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-A4ZT-11A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ATP6V0E1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30667
DDX18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.73859
GSE110178_5_v_6_tranylcypromine_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
FOXD1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.2
TP53-23651856-MEF-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Synaptic vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.523
VZ in dorsolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.23736
ZR7530	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.694247
DG(24:1n9/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TE1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-PWCY-1026-SM-48TD4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XXEK-1726-SM-4BRVB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CWF19L1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06342
NCIH2171	CCLE Cell Line Gene CNV Profiles	-1.0	-1.91729
leukopenia	GWASdb SNP-Disease Associations	1.0	0.382281
H3K9me3_HepG2_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
DG(20:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
nervous system disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
DG(20:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
TP63	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.3393
JEG-3	COSMIC Cell Line Gene Mutation Profiles	1.0	null
MDAMB453	CCLE Cell Line Gene Mutation Profiles	1.0	null
Proteinuria in chronic kidney disease	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.530103
fastigial nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.982318
DG(20:1(11Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
body weight	GAD Gene-Disease Associations	1.0	null
neuromuscular junction	GO Cellular Component Annotations 2025	1.0	null
PRDM9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49608
hsa-miR-3155	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
GTEX-OIZG-0008-SM-4E3J2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE165939_2_v_1_poldip2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(14:1(9Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-4777-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.165047
GSE195568_1_v_0_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Spz1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	19.5833
mast cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.446807
GSE97278,GSE97280_2_v_3_nsd2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
claustrum, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.04619
Bhlha15	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	35.2715
Kidney Chromophobe_KICH_TCGA-KL-8332-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QDT8-0011-R3A-SM-32PKR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07068
KMH2	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC2866657-pone.0010547.s001.xls-ERG-high-GENES_DOWNREGULATED_IN_ERGhigh_ERG	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-Q2AG-0011-R3A-SM-2HMJ9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14889
BTBD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08804
GSE217378_2_v_0_lin28b_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
PMC11801220-NIHMS2038999-supplement-16.xlsx-Exc-BNC2-gene_BNC2	Rummagene Transcription Factor Associations 2026	1.0	null
ADGRA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98945
SCLY	ChEA Transcription Factor Targets	1.0	null
DG(18:1n9/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
BICR6	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-X585-0011-R4B-SM-46MVH	GTEx Tissue Sample Gene Expression Profiles	1.0	0.882894
GTEX-Q2AG-0011-R6A-SM-2HML7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.856882
GSE210580_4_v_12_rag2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
BDCA4+_DentriticCells	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.28553
GTEX-P4QT-0008-SM-48TDZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
intracellular part	LOCATE Predicted Protein Localization Annotations	1.0	null
cerebellar cortex_13 yrs_F_12831	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.48914
HNRNPUL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99017
GTEX-Q2AG-1126-SM-48U1P	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
RUNX2	ChEA Transcription Factor Targets	1.0	null
VPS26C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44212
hippocampus (hippocampal formation)_12 pcw_F_13060	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.30171
DG(18:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
MICA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75712
parkinson disease	GAD Gene-Disease Associations	1.0	null
DG(14:1n5/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
RBM18	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60138
subthalamic nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.16348
163 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.884
DG(18:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LPXN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.04365
DG(18:3(9Z,12Z,15Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
Perturb_14724_KO_Dicer_SRP082704	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-9.26346
SERPINB9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.19324
SHOX	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	13.9062
EVSA-T	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Perturb_13974_KO_SYTL3_ERP126655	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
r8 part of lateral reticular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.0199
DG(14:1n5/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
small intestine	HPA Tissue Protein Expression Profiles	1.0	0.801417
GTEX-OHPM-0526-SM-2YUMJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-OIZH-0926-SM-48TBR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE226408_1_v_0_inpp4b_human	RummaGEO Gene Perturbation Signatures	-1.0	null
amygdaloid complex_8 yrs_M_12841	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.830714
DG(18:3(9Z,12Z,15Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
cingulum bundle, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.59288
SOCS4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75971
PMC8724844-bt-30-1-98-supple2.xlsx-GO_BP-TFAP4_TFAP4	Rummagene Transcription Factor Associations 2026	1.0	null
Pallidum, dorsal region	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.27295
DG(22:2n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T6MN-0011-R11A-SM-32QOX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.91083
T47D	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-0.905259
DG(16:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-6954-01A-11R-1915-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(22:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
PDE10A_KO_GDS4542_291_mouse_striatum	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
GTEX-OIZG-1026-SM-3LK5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE183271_4_v_3_nicotinamide_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
inferior olivary complex, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-2.83314
intestinal epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.12902
Sarcoma_SARC_TCGA-DX-A23R-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:2n6/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
IRF1	ChEA Transcription Factor Targets	1.0	null
DG(18:1n7/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
nervous system phenotype	MPO Gene-Phenotype Associations	1.0	null
H3K27me3_H7_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(14:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE101239_4_v_1_valproic acid_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
DG(22:2(13Z,16Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
IPC-298	COSMIC Cell Line Gene Mutation Profiles	1.0	null
T-T	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Central amygdalar nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.20206
GTEX-RVPV-0011-R3A-SM-2TF63	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08848
asthma	GWASdb SNP-Disease Associations	1.0	0.751885
TPR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.26852
DG(14:1n5/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AH-0926-SM-48TZK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
U266B1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.76338
GSE134412_0_v_1_siah2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Medial geniculate complex	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.64309
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-7406-11A-01R-2081-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PLXNB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.674
connective tissue	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.056031
DG(15:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
ZNF827	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.75965
PMC6754502-41598_2019_50051_MOESM3_ESM.xlsx-Br_to_Fay_Thermoneutral_LPS-Gene_Symbol_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.948435
SALE	CCLE Cell Line Gene Expression Profiles	-1.0	-1.60702
DG(14:1n5/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
721_B_lymphoblasts	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	1.79367
GSE125153_1_v_3_bcl3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
RASD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.65596
GSE147613_1_v_0_cisplatin_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
SAMD4A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23147
GSE195568_3_v_0_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(16:0e/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
KARPAS-620	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.16545
MZ in rostral midinferior temporal cortex (area 36)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.889449
MDAMB231	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.01449
DG(20:4(5Z,8Z,11Z,14Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EGI-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:1(9Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-FG-7643-01A-11R-2090-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE203308_1_v_3_brf1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
OE21	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ATP11C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.18733
DG(18:1(9Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
cerebellar cortex_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.972019
dorsal cochlear nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.28288
LMX1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.7724
KE97	CCLE Cell Line Gene Expression Profiles	1.0	2.97184
DG(18:1n7/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
GSE133764_2_v_0_chd2_human	RummaGEO Gene Perturbation Signatures	1.0	null
metencephalon	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
DG(22:4n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
r10 part of basomedial reticular formation	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	3.60405
GTEX-UPK5-0008-SM-4IHJD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NCI-H929	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE171837_0_v_3_bortezomib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE158715_3_v_0_cyp1b1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
hsa-miR-4273	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
RXYLT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.92334
DG(18:2(9Z,12Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
autosomal genetic disease	GWASdb SNP-Disease Associations	1.0	0.286864
Skin Cutaneous Melanoma_SKCM_TCGA-FR-A729-06A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE198254_1_v_0_metformin_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
visual cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	1.03785
496100455_FWM_dementia_TBI_86_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.67738
ZBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94666
GTEX-RNOR-2226-SM-2TF5O	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41846
SC 560	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.28
G protein-coupled receptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.878
respiratory system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.082157
DG(20:3(5Z,8Z,11Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
cerebral hemisphere	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.087377
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
Perturb_14299_KO_Mef2c_SRP057560	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.71344
intracellular signal transduction	GO Biological Process Annotations 2015	1.0	null
HT-115	COSMIC Cell Line Gene Mutation Profiles	1.0	null
496100494_HIP_no dementia_TBI_100+_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.56255
GTEX-PW2O-0826-SM-48TC5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Pervasive developmental disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.344
GSE213588_10_v_2_trametinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Median eminence	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.897
MATN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07547
DG(20:4(5Z,8Z,11Z,14Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
D423MG	DepMap CRISPR Gene Dependency	1.0	3.01619
GSE137144_2_v_0_nlrp3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
URGCP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5021
GTEX-P4QR-0008-SM-48TE2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE234340_1_v_7_muc2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
IGROV1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-NL3H-0011-R3a-SM-2I3GL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49528
DG(20:4n3/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DAN-G	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
GSE102870_7_v_0_nr1h4_human	RummaGEO Gene Perturbation Signatures	-1.0	null
degeneration of macula and posterior pole	GWASdb SNP-Disease Associations	1.0	0.869084
subbrachial nucleus, rostral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.48814
GTEX-Q2AG-0011-R10A-SM-2HMLA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08474
Gall bladder	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
RPMI8226	CCLE Cell Line Gene CNV Profiles	1.0	1.75517
KP4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.897795
Perturb_16097_KO_Eed_SRP125082	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-8.55575
NEMP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98339
JVM2	CCLE Cell Line Gene Expression Profiles	1.0	1.77283
SNU-81	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE258991_1_v_2_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-T5JW-0005-SM-3GADE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-V1D1-2026-SM-3GAF4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GCNT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01919
DG(22:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ERICH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.13721
Neurod2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	56.8662
DG(14:1(9Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MYF5	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.6761
GSE211177,GSE211178_9_v_11_ets1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-R55C-0826-SM-48FCL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
VDR-20736230-LYMPHOBLASTOID-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
H3K9me3_G1E_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-EJ-A46I-01A-12R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(18:1(11Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q734-0326-SM-48U15	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-PSDG-1326-SM-48TD2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Cingulate cortex	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.093
growth abnormality	GWASdb SNP-Phenotype Associations	1.0	0.934145
Gastrointestinal system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.331
GTEX-XUJ4-1026-SM-4BOPB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Head and Neck squamous cell carcinoma_HNSC_TCGA-IQ-7632-01A-11R-2081-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TRPM7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84564
carbohydrate metabolism disease	GWASdb SNP-Disease Associations	1.0	0.338117
GSE210101,GSE210114_4_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(16:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
behavior/neurological phenotype	MPO Gene-Phenotype Associations	1.0	null
DG(20:1(11Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X4XX-0011-R11A-SM-46MWQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.63153
r4 part of dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.96347
inner SZ in dorsomedial frontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.00841
GSE210101,GSE210114_8_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
HOXA10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70854
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ovary	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-0.884685
NCOA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.62065
DG(14:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
GSE210580_4_v_7_rag2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-3128	TargetScan Predicted Conserved microRNA Targets	1.0	0.714812
NCI-H1770	COSMIC Cell Line Gene Mutation Profiles	1.0	null
organism form	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.059903
GJB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04732
GSE110178_4_v_7_tranylcypromine_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
TRIM6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.52194
PRMT6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.62194
DG(24:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
GSE210101,GSE210114_6_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-S7SF-0426-SM-3K2B7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE232786_1_v_0_otud1_human	RummaGEO Gene Perturbation Signatures	1.0	null
PMC4219345-1471-2121-14-52-S5.xlsx-Sheet1-Transcript_bound_to_BORIS_in_6dN_and_up-regulated_during_differentiation_CTCFL	Rummagene Transcription Factor Associations 2026	1.0	null
MIA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84117
indusium griseum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.855937
cerebellar vermis	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.867442
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
stomach	HPA Tissue Protein Expression Profiles	1.0	0.801417
OBSL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.40225
SETX	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53163
hsa-miR-3619-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
superficial stratum of r8BM	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.13211
RSRP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.07967
primary visual cortex (striate cortex, area V1/17)_11 yrs_F_12289	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.18568
WDR48	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.62608
DG(22:1(13Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XBEW-0008-SM-4AT3Y	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of lymphocytes	GWASdb SNP-Phenotype Associations	1.0	0.650754
DG(22:1(13Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE182179_5_v_4_kdsr_human	RummaGEO Gene Perturbation Signatures	-1.0	null
musculoskeletal system disease	GWASdb SNP-Disease Associations	1.0	0.094599
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_DBP_ALL-GENE_DBP	Rummagene Transcription Factor Associations 2026	1.0	null
CingulateCortex	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.902752
COR-L279	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.36693
presynaptic dense core vesicle exocytosis	GO Biological Process Annotations 2023	1.0	null
habenula (old epithalamus)	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.79912
dorsal juxtacommissural pretectal nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.2138
medial geniculate nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.40838
GTEX-QEL4-0008-SM-447AZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
spinalcordlower	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.23083
GTEX-NPJ7-0011-R11A-SM-2I3E8	GTEx Tissue Sample Gene Expression Profiles	1.0	1.53759
DG(14:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
superior olivary complex, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.10164
496100576_HIP_dementia_TBI_81_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.11325
GTEX-NPJ7-0011-R10A-SM-2I3E5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06974
DG(14:1(9Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
synapse	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-CH-5768-11A-01R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Calyx of Held	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.451
Presynaptic active zone membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.666
DG(18:1n9/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7877-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GATA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.18698
Uterine Carcinosarcoma_UCS_TCGA-NF-A4X2-01A-11R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Trunk fat mass	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.509691
DG(20:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE214596,GSE214598_1_v_0_rosiglitazone_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
CDH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32981
GTEX-RTLS-0926-SM-2TF5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-4260	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
sublayer 6b of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.42585
COLO792	CCLE Cell Line Gene Mutation Profiles	1.0	null
GSE244072_10_v_3_tfeb_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(14:1(9Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Midline group of the dorsal thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.0093
DG(14:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XUW1-0005-SM-4BOQ7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF583	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.85662
ZNF93	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7929
HUH-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.4693
DG(24:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ACIN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91029
PMC12315868-Supplemental_Data_S1.xlsx-Supplemental_Data_S1F-TP53_TP53	Rummagene Transcription Factor Associations 2026	1.0	null
DG(16:1(9Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE178340_5_v_3_carfilzomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
COLO 829	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.896858
SERTAD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74484
IMR32	DepMap CRISPR Gene Dependency	1.0	3.23582
TCTN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87351
TMEM237	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.17734
HCC1438	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-WFG8-1326-SM-4LVN3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
epithelial cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.051945
DG(22:2n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
LDB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27646
Hnf1a	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	25.9063
GTEX-QMR6-1426-SM-32PLA	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20786
GTEX-NL4W-0011-R11A-SM-2I3DW	GTEx Tissue Sample Gene Expression Profiles	1.0	1.34729
SNCG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.40024
DG(18:4n3/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S7SE-0011-R10A-SM-2XCDF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06741
pyramidal layer of taenia tecta	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.41481
r5 part of posteroventral cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.87766
DG(18:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE211126_3_v_0_hapln1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
COBL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.7293
PMC7884719-41598_2021_83348_MOESM3_ESM.xlsx-female_port-FOS_FOS	Rummagene Transcription Factor Associations 2026	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-G9-6333-11A-01R-1965-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OAW28	CCLE Cell Line Gene CNV Profiles	-1.0	-2.09464
cochlear nuclei, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.28587
NCI-H2066	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WZTO-0011-R11A-SM-4E3K9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41285
DG(14:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
synucleinopathy	GWASdb SNP-Disease Associations	1.0	1.28484
inner CP in inferolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.855736
Axon	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.845
primary visual cortex (striate cortex, area V1/17)_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.23061
GTEX-QESD-2026-SM-447BI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cell projection part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.06853
membrane part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.046971
EZH2_myotube_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
abnormality of humoral immunity	GWASdb SNP-Phenotype Associations	1.0	1.05869
PMC11285331-cd-23-0539_table_s1_suppst1.xlsx-Lost_AR_Peaks-Unnamed_19_AR	Rummagene Transcription Factor Associations 2026	1.0	null
ZBTB45	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.1659
DG(22:5n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-U8XE-2526-SM-4E3IT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PDE5A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.07916
abnormality of the genitourinary system	GWASdb SNP-Phenotype Associations	1.0	0.161125
DG(18:2(9Z,12Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SYAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.02541
cerebellar cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.303198
DG(20:3(5Z,8Z,11Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-NPJ7-0008-SM-4E3JS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NFE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.26878
periventricular nucleus, preoptic portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.943378
DG(20:3n9/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
MANF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49519
GSE217405_0_v_1_egfr_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
III, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.20249
Perturb_8539_KO_Notch2_SRP152804	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
Synaptic vesicle cycle	KEGG Pathways 2026	1.0	null
GTEX-NPJ8-0326-SM-2D7VV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of central motor function	GWASdb SNP-Phenotype Associations	1.0	1.12492
type ii diabetes mellitus	GWASdb SNP-Phenotype Associations	1.0	0.55536
hsa-miR-548c-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.419947
hsa-miR-3160-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
GSE244072_10_v_1_tfeb_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GSE126345_7_v_5_hcrt_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE63048_11_v_12_morc1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
superficial stratum of r9BM	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.2217
GTEX-QDVN-0526-SM-48TZ4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_13144_KO_Irf9_SRP188096	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
KHM1B	CCLE Cell Line Gene Expression Profiles	1.0	1.50382
HCC-56	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-XMK1-1326-SM-4B65Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-QESD-0008-SM-447B2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Turofexorate	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.67
COLO775	CCLE Cell Line Gene Expression Profiles	1.0	1.45141
DG(22:5n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H1876	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ZNF330	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17699
shortened qt interval	GWASdb SNP-Phenotype Associations	1.0	0.845086
Supplemental somatosensory area, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.94825
axon terminus	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.15234
myb_16205643_primary_monocytes_gof_human_gpl570_gse2816	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.520271
GTEX-WFG8-0626-SM-3GILJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LN215	CCLE Cell Line Gene Expression Profiles	-1.0	-1.87255
Tcf12	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	28.1017
DG(22:1(13Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T6MN-0011-R4A-SM-32QPG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.25699
hsa-miR-412	TargetScan Predicted Conserved microRNA Targets	1.0	0.107229
gallbladder	HPA Tissue Protein Expression Profiles	1.0	0.801417
POU5F1B	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.8654
SUM1315MO2	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.0557
DG(18:1(11Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-N7MT-0011-R10A-SM-2I3E1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04609
DG(20:2(11Z,14Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Immune response to smallpox vaccine (IL-6)	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.609691
DG(18:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
H3K4me1_Brain Germinal Matrix	Roadmap Epigenomics Histone Modification Site Profiles	1.0	null
Spondylosis	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.509691
intercalated amygdaloid nuclei	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.05009
lhx8_18509161_newborn_ovary_lof_mouse_gpl1261_gds3254	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	1.14039
GSE240027,GSE240030_5_v_0_atrx_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
ZNF157	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98424
supranuclear gaze palsy	GWASdb SNP-Phenotype Associations	1.0	0.541565
DG(22:5(4Z,7Z,10Z,13Z,16Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1(15Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE120370_4_v_1_thrombin_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
cerebellar cortex_30 yrs_F_12290	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.983917
DG(24:1n9/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-495	TargetScan Predicted Conserved microRNA Targets	1.0	0.517189
GSE175787_8_v_10_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
CTCF_fibroblast of lung_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
HCC-827	COSMIC Cell Line Gene Mutation Profiles	1.0	null
WM-115	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PRMT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12756
DG(22:1(13Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Spine apparatus	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.115
Perturb_13059_Mut|OE_Sik3E13_SRP334442	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-5.25616
DMRTA1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	18.6827
DG(20:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
SG in lateral temporal-occipital cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.10446
GTEX-RUSQ-0926-SM-47JWU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GMPPA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46566
DG(20:2(11Z,14Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TMZS-0006-SM-3DB8G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of cardiovascular system physiology	GWASdb SNP-Phenotype Associations	1.0	0.219378
GSE97278,GSE97280_2_v_1_nsd2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-WVLH-2926-SM-3MJG5	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2885
alveolar cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.449116
Frontotemporal dementia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.396
GSE66931,GSE73382_1_v_0_hira_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:2(13Z,16Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SP in primary visual cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.14953
DG(22:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TK-10	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.949827
DCTD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89637
cell part	LOCATE Predicted Protein Localization Annotations	1.0	null
atherosclerosis	GWASdb SNP-Disease Associations	1.0	0.775167
CTF1	MotifMap Predicted Transcription Factor Targets	1.0	null
animal	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.322414
GTEX-WFON-1726-SM-4LVMQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:1n5/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
HH	CCLE Cell Line Gene Expression Profiles	1.0	1.57979
SPTSSA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98175
sensory system disease	GWASdb SNP-Disease Associations	1.0	0.108631
PANO1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81654
Excitatory synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.498
DG(24:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
male reproductive organ cancer	GWASdb SNP-Disease Associations	1.0	0.374939
H3K9me3_G1E_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
POMGNT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91306
intracellular membrane-bounded organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.059623
DG(22:4(7Z,10Z,13Z,16Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NOSIP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58368
DG(15:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
RPMI7951	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-HAND1_neg_targets-ID_HAND1	Rummagene Transcription Factor Associations 2026	1.0	null
Stat5a	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	33.4621
GTEX-U412-0008-SM-4DXTE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
NAXE	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.85341
Human - Motor Cortex - Cluster - LAMP5+ PVRL2+ Layer 1 GABAergic neuron	HuBMAP Azimuth Cell Type Annotations	1.0	null
DG(22:1(13Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE135030_11_v_4_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GSE176008_4_v_3_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
cerebellar cortex_1 yrs_F_12830	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.89988
MLEC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60826
PMC9882185-media-4.xlsx-Neuron_KD-ID_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GSE172189_0_v_1_venetoclax_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(22:1(13Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
synaptic vesicle membrane	GO Cellular Component Annotations 2023	1.0	null
DG(22:5n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
NURR1	MotifMap Predicted Transcription Factor Targets	1.0	null
L540	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-WFON-0126-SM-4LVM9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
H3K9me3_astrocyte_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
TBX20-22080862-HEART-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
DNAAF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32494
HDLM2	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-XOTO-2926-SM-4B65G	GTEx Tissue Sample Gene Expression Profiles	1.0	1.1866
TM7SF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.76279
HCT15	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-WZTO-0011-R8A-SM-4E3II	GTEx Tissue Sample Gene Expression Profiles	1.0	0.987329
GTEX-QVJO-0008-SM-447AU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MDA-MB-436	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.866986
DG(22:5(4Z,7Z,10Z,13Z,16Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
IRX1_01_227	KnockTF Gene Expression Profiles with Transcription Factor Perturbations	1.0	2.67004
AQP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.23185
immune system cancer	GWASdb SNP-Disease Associations	1.0	0.206808
Parkinson Disease	dbGAP Gene-Trait Associations	1.0	0.60454
hsa-miR-3617	TargetScan Predicted Conserved microRNA Targets	1.0	0.632343
GSE211955_1_v_0_jmjd4_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
cognitive impairment	GWASdb SNP-Phenotype Associations	1.0	1.04365
Superior central nucleus raphe, lateral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.27947
GTEX-WVLH-3026-SM-3MJG9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.26702
DG(18:1(9Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE178113,GSE178116_0_v_1_atrx_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7695-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
amygdaloid complex_12 pcw_F_12835	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-2.05363
superficial layers of caudal presubiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.25553
DG(22:4(7Z,10Z,13Z,16Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Tectum mesencephali	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.929
Epididymis	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
Central nervous system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.43
NCI-H2196	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.42627
GTEX-P44H-0011-R10A-SM-2XCEK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20324
GSE135030_8_v_2_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Nkx3-2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	19.21
TCF4-23295773-U87-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
ATP5MC3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91323
GTEX-QV31-0626-SM-447C5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CSNK1D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52118
GTEX-R55E-0011-R6A-SM-2TC5T	GTEx Tissue Sample Gene Expression Profiles	1.0	0.930303
behavioral abnormality	GWASdb SNP-Phenotype Associations	1.0	0.238374
GSE140074_1_v_0_kif20a_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PSMD13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.59942
GSTA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.3277
GTEX-T5JC-2326-SM-32PMR	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49903
DG(20:3(5Z,8Z,11Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SW1271	CCLE Cell Line Gene Mutation Profiles	1.0	null
SUIT-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.039403
GTEX-QXCU-0008-SM-48FCH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
trochlear nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.15622
GTEX-Q734-1426-SM-48TZQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
AN3-CA	COSMIC Cell Line Gene Mutation Profiles	1.0	null
cell	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
Dense core granule	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.574
Edinger-Westphal nucleus (accessory oculomotor nucleus)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.05501
synaptic vesicle exocytosis	GO Biological Process Annotations 2023	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A67W-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
superficial stratum of m1AL	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.41751
RL95-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NPRL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.1109
NCI-H820	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.916788
CDX4	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.7343
hsa-miR-4526	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
Neuron_Brain_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
ORC6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59256
MED14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.73641
DG(18:1(11Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PRRC2C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.81937
c-MYC_KD_GDS2526_109_human_Hela cells	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	null
binding	GO Molecular Function Annotations 2015	1.0	null
forebrain	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.225144
DG(14:1(9Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-4650-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.828473
PMC6823153-NIHMS1535502-supplement-3.xlsx-LSD1_SupplData1-Supplementary_Data_1_Potential_common_target_genes_of_LSD1_and_GATA3_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
496100539_HIP_probable Alzheimer's disease_TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.28151
OCUM1	DepMap CRISPR Gene Dependency	1.0	2.01081
GSE210101,GSE210114_6_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC10771438-41598_2023_51082_MOESM1_ESM.xlsx-Day21-Supplementary_Dataset_1_List_of_genes_differentially_expressed_during_NS_PC_differentiation_between_ROR2_KD_cells_and_control_cells_AR	Rummagene Transcription Factor Associations 2026	1.0	null
SNU-C2B	COSMIC Cell Line Gene Mutation Profiles	1.0	null
OVK-18	COSMIC Cell Line Gene Mutation Profiles	1.0	null
mantle zone of VTTh	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.34011
COX15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07343
GTEX-XBEC-1526-SM-4AT68	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CMK	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WWYW-0011-R10A-SM-3NB35	GTEx Tissue Sample Gene Expression Profiles	1.0	1.1071
TE-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:1(11Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
OE33	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-PW2O-0008-SM-48TEB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MAFG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.8518
DG(22:5n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
MM1S	CCLE Cell Line Gene Expression Profiles	1.0	1.55033
DG(18:3(9Z,12Z,15Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC8755441-mmc3.xlsx-IRF1-UP-chip_IRF1	Rummagene Transcription Factor Associations 2026	1.0	null
mediodorsal nucleus of thalamus_37 pcw_M_263195015	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.896719
DG(22:2(13Z,16Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
NAB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12169
GSE124932_2_v_1_sarm1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
prostate cancer	GWASdb SNP-Phenotype Associations	1.0	0.598959
Perturb_14244_KO_IKZF1_SRP139731	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-12.0821
GSE89018_12_v_2_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
ESRP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83424
CHMP1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.74807
DG(22:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QDT8-0008-SM-48U2F	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:2(13Z,16Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TMEM87A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54673
Medial geniculate complex, ventral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.98524
Primary somatosensory area, barrel field, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.14163
membrane-bounded organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.062471
Perturb_9713_KO_Miwi/Mili/Miwi2_SRP036148	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	8.30825
striatal amygdala	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.02204
posterodorsal tegmental nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.03636
DG(20:4(8Z,11Z,14Z,17Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
AMO1	CCLE Cell Line Gene Expression Profiles	1.0	1.49122
DG(14:1(9Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T5JC-0011-R7A-SM-32PME	GTEx Tissue Sample Gene Expression Profiles	1.0	0.854905
GRIK5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49626
interpeduncular nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.57908
NCI-H2122	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.04237
GTEX-UTHO-1826-SM-3GAFE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
testis_7a	HPA Tissue Sample Gene Expression Profiles	1.0	1.13382
GTEX-UJHI-0626-SM-3DB8T	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MLH3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.72213
GSE88819_3_v_8_tug1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DDX56	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.35718
DG(20:2(11Z,14Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE178340_1_v_3_carfilzomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
medial part of the lateral habenular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.34645
D-(+)-Glucose	DeepCoverMOA Drug Mechanisms of Action	1.0	0.33
TBX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.3762
GSE254649_2_v_1_cstf2_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Metencephalon	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
medial ganglionic eminence_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.03763
GTEX-RM2N-0126-SM-48FDD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-OXRL-0326-SM-2I3F2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
nicotine dependence	GWASdb SNP-Disease Associations	1.0	0.580521
Perturb_4614_KD_Etv5_SRP231452	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	3.27882
DG(14:1n5/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
intermediate stratum of Pal	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.53887
Drug-Induced Liver Injury	CTD Gene-Disease Associations	1.0	1.55206
DG(20:1(11Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QLQW-0326-SM-447A8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:3(5Z,8Z,11Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1n9/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
SRP9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19564
KCL-22	COSMIC Cell Line Gene Mutation Profiles	1.0	null
leukocyte disease	GWASdb SNP-Disease Associations	1.0	0.331723
DG(22:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
cell communication	GO Biological Process Annotations 2015	1.0	null
Synaptic cleft	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.342
NADK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07369
GSE228106_3_v_1_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
TE-9	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CAL-120	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.861197
Uterine Carcinosarcoma_UCS_TCGA-N6-A4VG-01A-31R-A28V-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
HDGFL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.24286
DG(22:6n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
nerve	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.734323
JAK3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05473
GTEX-V955-0326-SM-4JBGV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(8Z,11Z,14Z,17Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
A375	CCLE Cell Line Gene Mutation Profiles	1.0	null
overnutrition	GWASdb SNP-Disease Associations	1.0	0.481016
DG(14:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.058208
hsa-miR-27a	TargetScan Predicted Conserved microRNA Targets	1.0	0.517189
ANAPC16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.78599
Central amygdalar nucleus, lateral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.38973
DG(16:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
A1207	CCLE Cell Line Gene CNV Profiles	1.0	1.33988
GSE138001_0_v_4_rorb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
UBAP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8467
superficial stratum of VTTh	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.40838
PMC4598026__F5	PFOCR Pathway Figure Associations 2023	1.0	null
NCI-H1703	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-QCQG-2026-SM-2S1PH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(15:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-R53T-0008-SM-48FEW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF845	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96376
Midbrain reticular nucleus, retrorubral area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.03936
GTEX-WWYW-3026-SM-3NB36	GTEx Tissue Sample Gene Expression Profiles	1.0	1.21848
GSE238116_1_v_0_egr1_human	RummaGEO Gene Perturbation Signatures	1.0	null
SARC9371	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-QLQW-0226-SM-447BJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
COTL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49699
GTEX-X8HC-1526-SM-46MWD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
496100367_FWM_no dementia_TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.28757
OC314	CCLE Cell Line Gene CNV Profiles	-1.0	-1.83345
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-HAND1_cust_neg_HAND1	Rummagene Transcription Factor Associations 2026	1.0	null
POU5F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.4419
DG(16:1n7/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
PABPN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.72263
Perturb_2167_KO_Sirt3_SRP403451	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	11.4136
DG(14:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
periventricular stratum of r10BM	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.49154
GTEX-WHWD-0005-SM-3LK7D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Neuron projection	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
GTEX-S4UY-0008-SM-3NM8H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3(9Z,12Z,15Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE147876,GSE147877_4_v_11_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
cytoplasmic part	LOCATE Predicted Protein Localization Annotations	1.0	null
Infantile parkinsonism-dystonia 2	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.204
DG(16:1n7/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GSE203308_9_v_3_brf1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GLCCI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.58724
HS229T	CCLE Cell Line Gene Expression Profiles	-1.0	-1.46335
DG(20:1(11Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(8Z,11Z,14Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Nr2e3	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.0435
ANKS6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.32524
NAA10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.14553
GTEX-NPJ8-1526-SM-2D7VU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20355
DG(18:3(9Z,12Z,15Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3686	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
hsa-miR-4470	TargetScan Predicted Conserved microRNA Targets	1.0	1.45615
DG(24:1n9/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-P78B-0008-SM-48TE1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Protein Unc-13 homologue C	InterPro Predicted Protein Domain Annotations	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XYKS-1426-SM-4BRUO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Pancreatic adenocarcinoma_PAAD_TCGA-FB-A4P6-01A-12R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
presynaptic active zone	GO Cellular Component Annotations 2015	1.0	null
GRHPR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64351
hippocampus (hippocampal formation)_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.882759
DG(14:1n5/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
FGFR3_knockdown_174_GSE41035	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-2.06389
GTEX-N7MS-0011-R4a-SM-2HMKW	GTEx Tissue Sample Gene Expression Profiles	1.0	0.891237
DMRTC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.8464
SYT7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83302
DG(20:4(5Z,8Z,11Z,14Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CNOT7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70434
DG(20:3(8Z,11Z,14Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
glia	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.230656
GSE252857_1_v_0_prednisone_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
ABHD14B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49069
DG(24:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCIH1838	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-QVUS-0011-R3A-SM-3GAFD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12597
PMC12048643-44318_2025_409_MOESM3_ESM.xlsx-regulonTargets-HNF4A_HNF4A	Rummagene Transcription Factor Associations 2026	1.0	null
DG(14:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
BPGM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.62144
MEG01	CCLE Cell Line Gene CNV Profiles	-1.0	-1.74513
SW620	COSMIC Cell Line Gene Mutation Profiles	1.0	null
abnormality of the retina	GWASdb SNP-Phenotype Associations	1.0	0.230443
DG(16:1n7/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-S5-A6DX-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-E7-A97Q-01A-11R-A38B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE135030_3_v_10_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE135030_8_v_4_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(20:2(11Z,14Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A3HZ-01A-11R-A213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(16:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
MEGF8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.74536
DG(24:1(15Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
AB80 (BRCA1)	NURSA Protein Complexes	1.0	null
PMC9669639-mmc3.xlsx-NRLonly-degs-207-Single_cell_RNA-seq_differentially_expressed_genes_between_control_versus_USH1B_NRL_cells_NRL	Rummagene Transcription Factor Associations 2026	1.0	null
Agranular insular area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.65559
ventral posterior inferior nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.39042
DG(22:5n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TSE9-0011-R10A-SM-3DB7O	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40823
GTEX-RVPU-0011-R1A-SM-2XCAI	GTEx Tissue Sample Gene Expression Profiles	1.0	0.869383
plasma membrane	GO Cellular Component Annotations 2015	1.0	null
osteoporosis	GWASdb SNP-Disease Associations	1.0	1.10764
DG(14:0/0:0/16:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1(13Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S4UY-0006-SM-3K2A7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-U412-0526-SM-3DB9I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC9537523-41467_2022_33364_MOESM7_ESM.xlsx-scores_wilcoxon_1_MONTH_ORG-EN2_n_EN2	Rummagene Transcription Factor Associations 2026	1.0	null
Septum pellucidum	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.605
ESX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64955
GTEX-X3Y1-2426-SM-3P5Z7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
inner SZ in ventrolateral prefrontal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.900316
SW626	COSMIC Cell Line Gene Mutation Profiles	1.0	null
depression	GWASdb SNP-Phenotype Associations	1.0	0.848109
snare complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.463598
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
disease of cellular proliferation	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.039286
ICC10	DepMap CRISPR Gene Dependency	1.0	2.53087
GSE196699_4_v_1_prdm16_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE135030_3_v_7_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
KE37	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-SN8G-0008-SM-4DM4X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cerebral lobe	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.118366
DG(18:3(6Z,9Z,12Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SK-UT-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:2(11Z,14Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
trachea	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-0.980767
animal	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	1.0758
GSE147876,GSE147877_2_v_9_enzalutamide_human	RummaGEO Drug Perturbation Signatures	1.0	null
KARPAS-45	COSMIC Cell Line Gene Mutation Profiles	1.0	null
496100436_FWM_no dementia_no TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-4.98489
DG(20:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-UTHO-0006-SM-3NMCC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
arteriosclerosis	GWASdb SNP-Disease Associations	1.0	0.385408
Mood disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.515
Neuron projection terminus	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
PMC7498599-41467_2020_18508_MOESM11_ESM.xlsx-ICM_JUN-Unnamed_3_JUN	Rummagene Transcription Factor Associations 2026	1.0	null
GSE147056_0_v_1_actl6b_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
transport	GO Biological Process Annotations 2015	1.0	null
DG(22:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TSE9-0008-SM-4DXT8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
mania	GWASdb SNP-Phenotype Associations	1.0	0.529158
Synaptic vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.155
hsa-miR-3663-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.843347
GTEX-X8HC-2826-SM-46MWJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1(11Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
eye disease	GWASdb SNP-Disease Associations	1.0	0.131755
hep3b2.17	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.144
GTEX-XOTO-0011-R11B-SM-4B64O	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43702
DG(24:1n9/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
LOVO	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(24:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
Neurodegenerative disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.335
DG(20:3(8Z,11Z,14Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
increased circulating phosphate level	IMPC Knockout Mouse Phenotypes	1.0	null
GSE154936_3_v_2_remdesivir_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(16:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PACADD161	DepMap CRISPR Gene Dependency	1.0	3.28431
MZ in posteror frontal cortex (motor cortex)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.33074
cellular_component	LOCATE Predicted Protein Localization Annotations	1.0	null
DG(15:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
KIF5B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80057
GTEX-XMD1-0011-R3B-SM-4AT5R	GTEx Tissue Sample Gene Expression Profiles	1.0	1.26033
stratum pyramidale of rostral CA2	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.96882
MOCS3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30584
TMEM39B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.43601
MOG-G-UVW	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-NPJ8-0011-R8a-SM-2HMLG	GTEx Tissue Sample Gene Expression Profiles	1.0	0.850219
MAP3K7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.12685
Mesothelioma_MESO_TCGA-SC-A6LM-01A-11R-A34F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Lip And Oral Cavity Carcinoma	DisGeNET Gene-Disease Associations	1.0	null
CP in midlateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.52737
hematologic cancer	GWASdb SNP-Disease Associations	1.0	0.206808
DG(20:4(5Z,8Z,11Z,14Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Entorhinal area, lateral part, layer 2a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.04579
DG(20:4(5Z,8Z,11Z,14Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Glucose	dbGAP Gene-Trait Associations	1.0	0.78745
SG in primary auditory cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.890027
DG(22:1(13Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PLCG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.1979
GTEX-V955-1126-SM-4JBH3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF106	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84613
lung disease	GWASdb SNP-Disease Associations	1.0	0.612695
GTEX-XLM4-0011-R4B-SM-4AT5C	GTEx Tissue Sample Gene Expression Profiles	1.0	1.2105
SAE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.08863
DG(16:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3545-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
DG(18:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
RREB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.6995
Synaptic vesicle lumen	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.713
IST-SL2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
cell type cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.043186
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MFE319	CCLE Cell Line Gene Mutation Profiles	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-FA-A4BB-01A-11R-A31O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE217405_0_v_1_osimertinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(22:2n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DU-4475	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:4n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
embryo	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.067147
anterior nucleus of pulvinar	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.38634
cetuximab_homo sapiens_gpl570_gse21483	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
single-organism localization	GO Biological Process Annotations 2015	1.0	null
GSE94814_2_v_0_reck_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-PWN1-2026-SM-48TD9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
brain disease	GWASdb SNP-Disease Associations	1.0	0.151772
DG(14:1(9Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE239373_0_v_1_mettl3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MARCHF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.38745
Kidney renal papillary cell carcinoma_KIRP_TCGA-A4-7915-01A-11R-2204-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:1n9/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SPARC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48658
intracellular part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
OC-314	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HOXB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.25444
GTEX-WZTO-2826-SM-3NM8P	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43575
DG(18:3n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
COLO741	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(6Z,9Z,12Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC8444148-NIHMS1529754-supplement-1529754_Tab_S2.xlsx-upregulated_in_ATF4OE_txt-RNA-seq_of_C3_ATF4_OE_and_C3_neurons_ATF4	Rummagene Transcription Factor Associations 2026	1.0	null
GLYCTK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8059
COLO 794	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.36961
GSE174418,GSE174421_0_v_1_mettl5_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-X585-0011-R3B-SM-46MVG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04786
DG(15:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsf1_00000000_tcell_lof_mouse_gpl1261_gse41005	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	-1.0	-0.056777
DG(15:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC7773934-Table_1.XLSX-Table_S2-Supplementary_Table_2_TBX22_co-expressed_genes_detailed_results_TBX22	Rummagene Transcription Factor Associations 2026	1.0	null
U266B1	CCLE Cell Line Gene Expression Profiles	1.0	1.60761
DG(15:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RUNX2-22187159-PCA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
CD56+_NKCells	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.68051
GTEX-WFON-0826-SM-4LVMI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3(9Z,12Z,15Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A7II-01A-11R-A33J-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
biological regulation	GO Biological Process Annotations 2015	1.0	null
DG(14:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE89018_6_v_14_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
hsa-miR-4477a	TargetScan Predicted Conserved microRNA Targets	1.0	0.131849
Mucosal mast cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.64
HCV JFH1_168Hour-Huh7_None_GSE29889	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	1.39616
hsa-miR-490-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.219115
GTEX-O5YW-0006-SM-3LK6E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE126127_2_v_3_prmt1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GR	MotifMap Predicted Transcription Factor Targets	1.0	null
GTEX-WFJO-0008-SM-4LVN7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-RM2N-1126-SM-48FCY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF107	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27108
DG(18:4(6Z,9Z,12Z,15Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ICC8	DepMap CRISPR Gene Dependency	1.0	2.47391
PEG10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36498
Astrocyte_Dermis_Mouse	CellMarker Gene-Cell Type Associations	1.0	null
DG(18:3(6Z,9Z,12Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ML1	CCLE Cell Line Gene Mutation Profiles	1.0	null
TCF4	ChEA Transcription Factor Targets	1.0	null
retinal disease	GWASdb SNP-Disease Associations	1.0	0.220543
Perturb_15794_KO_S1pr3/S1pr1/S1pr2_SRP234700	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-9.92589
Central nervous system disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	0.99
GSE135030_3_v_0_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
T98G	CCLE Cell Line Gene CNV Profiles	-1.0	-2.00401
GTEX-QVUS-2826-SM-3GADB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.14262
DG(20:3n9/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
PMC12186250-NIHMS2085662-supplement-3.xlsx-4111_TEAD4_peaks-Nearest_Ensembl_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
DG(16:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
GSE113005_0_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	1.0	null
DG(16:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
RABIF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07103
DG(24:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Y8E5-0006-SM-47JWQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1n9/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
IFNAR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30471
DG(16:1n7/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WEY5-1326-SM-3GILS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
dorsolateral prefrontal cortex_16 pcw_M_12287	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.928027
HEC151	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC4219345-1471-2121-14-52-S4.xlsx-BORIS_6dN-Gene_Symbol_CTCFL	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-QVJO-0011-R1A-SM-2S1QI	GTEx Tissue Sample Gene Expression Profiles	1.0	1.19944
VSNL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.2851
CILP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.68263
pyrazinamide_mus musculus_gpl6246_gse48027	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
synucleinopathy	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
DG(18:4n3/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MOLM13	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-S7SE-0011-R1A-SM-2XCDE	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23463
villus	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.225395
GSE210101,GSE210114_1_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
NCIH2286	CCLE Cell Line Gene Mutation Profiles	1.0	null
LU-135	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PMC6520398-41467_2019_10148_MOESM11_ESM.xls-FigS1a-TP53_TP53	Rummagene Transcription Factor Associations 2026	1.0	null
CENPM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.29808
CA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84846
TFAP2D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.258
abnormality of cellular immune system	GWASdb SNP-Phenotype Associations	1.0	0.181629
amyotrophic lateral sclerosis	GWASdb SNP-Phenotype Associations	1.0	0.509391
DG(18:1n7/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
r5 part of the cochlear column	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.01408
DMS153	CCLE Cell Line Gene Mutation Profiles	1.0	null
body of caudate nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.843634
GTEX-SNMC-0826-SM-4DM66	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-T2IS-0011-R11A-SM-32QPC	GTEx Tissue Sample Gene Expression Profiles	1.0	2.02234
SIX6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.92357
Substance dependence	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.167
znf217_22593193_mda_mb_231_gof_human_gpl570_gse35511	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.056722
ISL1-30127528-BE2C-HUMAN-BRAIN-NEUROBLASTOMA	ChEA Transcription Factor Targets 2022	1.0	null
Congenital myasthenic syndrome 6	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.103
CGN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.36184
TXNDC16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.1208
CORL24	CCLE Cell Line Gene Mutation Profiles	1.0	null
brain_3c	HPA Tissue Sample Gene Expression Profiles	1.0	1.34252
DG(22:1(13Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RERFLCAD1	CCLE Cell Line Gene Mutation Profiles	1.0	null
RNF4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.15428
NCI-H322M	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:2n6/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XQ8I-1126-SM-4BOO2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
colon	HPA Tissue Protein Expression Profiles	1.0	0.801417
DG(20:2(11Z,14Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNU-182	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE175787_11_v_9_rhoc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(18:2(9Z,12Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF552	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.60604
hsa-miR-452	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
mantle zone of AStr	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.02136
DG(22:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7880-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
KTN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91101
GSE210101,GSE210114_5_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
substantianigra	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	0.868512
DG(18:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE110178_4_v_3_tranylcypromine_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
Cell type cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.342
RELCH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.22309
OGFR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80339
mantle zone of r10BM	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.96272
Transport vesicle membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.239
tp63_16885358_squamous_epithelia_lof_human_gpl570_gds2088	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.183673
KMM-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04004
GTEX-P44H-0011-R4A-SM-2XCEW	GTEx Tissue Sample Gene Expression Profiles	1.0	0.93419
Terminal bouton	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.764
GTEX-XQ8I-0006-SM-4BOQ5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Metabolite levels	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.51549
TBX20-22328084-HEART-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
kidney failure	GWASdb SNP-Disease Associations	1.0	0.347113
LSM12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55621
DG(20:2n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
NF-1	MotifMap Predicted Transcription Factor Targets	1.0	null
DG(18:3(9Z,12Z,15Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Specific developmental disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.131
CCRF-CEM	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ARL4C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.56362
amygdaloid complex_13 pcw_F_12834	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.42696
GTEX-QEG5-1126-SM-33HC2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZFPM2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51232
prolonged qt interval	GWASdb SNP-Phenotype Associations	1.0	0.845086
calcium ion-regulated exocytosis of neurotransmitter	GO Biological Process Annotations 2023	1.0	null
WM793B	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-R55E-0011-R5A-SM-2TC5N	GTEx Tissue Sample Gene Expression Profiles	1.0	0.873531
DG(22:2(13Z,16Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RNOR-0011-R4A-SM-3GAD3	GTEx Tissue Sample Gene Expression Profiles	1.0	1.4581
HPBALL	CCLE Cell Line Gene Mutation Profiles	1.0	null
SuperiorCervicalGanglion	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.934872
DG(14:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
FOXB1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	34.4061
TCF24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.13271
GSE88819_3_v_4_tug1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-RU72-0011-R11A-SM-2TF6J	GTEx Tissue Sample Gene Expression Profiles	1.0	1.76104
NCI-H322T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.29942
ARG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7088
GTEX-Q2AH-1126-SM-48TZM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
lateral terminal nucleus of the accessory optic tract, ventral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.3659
DG(18:1n7/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
GRHL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.5341
MRPL47	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.5837
Prostate adenocarcinoma_PRAD_TCGA-G9-6356-11A-01R-1789-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-S7SE-0011-R4A-SM-2XCDB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.87327
DG(18:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NEUROG1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.77876
SNU1040	CCLE Cell Line Gene Mutation Profiles	1.0	null
496100484_FWM_no dementia_no TBI_86_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-4.2903
DG(24:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
Medial pretectal area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.10487
synaptic vesicle docking	GO Biological Process Annotations 2025	1.0	null
bronchus	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.086433
NELFA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41357
DG(18:1n9/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
alzheimer disease	GWASdb SNP-Phenotype Associations	1.0	0.702128
DG(14:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC7346435-12864_2020_6860_MOESM6_ESM.xlsx-H1_ZF_Oocyte_Specific-Gene_SymbolH_CREBZF	Rummagene Transcription Factor Associations 2026	1.0	null
abnormality of the posterior segment of the eye	GWASdb SNP-Phenotype Associations	1.0	0.212611
DG(15:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WHSB-0005-SM-3LK7C	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CCDC71L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.76036
GTEX-XK95-1026-SM-4GIDV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XLM4-0011-R2B-SM-4AT5Z	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18583
Feather rachis	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.967
GTEX-V955-1326-SM-4JBHR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
EJM	CCLE Cell Line Gene Mutation Profiles	1.0	null
YD8	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:1(13Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CMC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07435
T47D	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-CF-A3MF-01A-12R-A21D-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNUC5	DepMap CRISPR Gene Dependency	1.0	4.74633
GTEX-S33H-0005-SM-2XCAL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-T6MO-0626-SM-4DM6P	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CHAGO-K-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:1(9Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
seminal vesicle	HPA Tissue Protein Expression Profiles	1.0	0.801417
DG(18:4(6Z,9Z,12Z,15Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4n6/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
Synaptic Vesicle Pathway(Homo sapiens)	WikiPathways Pathways 2014	1.0	null
brain_a	HPA Tissue Sample Gene Expression Profiles	1.0	1.67406
NCI-H522	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.00735
GTEX-WFJO-0005-SM-3GIKY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE102486,GSE102490_1_v_5_setdb1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Perturb_8603_KO_Shank2_SRP072742	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.02441
abnormality of the endocrine system	GWASdb SNP-Phenotype Associations	1.0	0.163996
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-A4BK-01A-11R-A26U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Disease of cellular proliferation	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.416
HSC-39	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-PX3G-2026-SM-48U1H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Synaptic vesicle, readily releasable pool	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.715
GSE127790_13_v_2_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
acquired metabolic disease	GWASdb SNP-Disease Associations	1.0	0.321097
LXF-289	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04004
Sox7	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	19.7783
DG(24:1(15Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
STAR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16331
GSE169205_3_v_8_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE210580_5_v_7_rag2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
caudal group of intralaminar nuclei, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.954622
DG(20:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
abnormality of body weight	GWASdb SNP-Phenotype Associations	1.0	0.494133
GTEX-QCQG-0726-SM-48U1Z	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-520d-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
DG(22:4(7Z,10Z,13Z,16Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SK-N-FI	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.32
WM793	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-P44H-0008-SM-48TDW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LIM1215	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Head and neck squamous cell carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.277
DAN-G	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE171837_1_v_2_bortezomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Ptf1a	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	65.2995
SEPTIN10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34526
GTEX-R53T-0326-SM-48FEC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-QCQG-0126-SM-48U27	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XUJ4-2026-SM-4BOOW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:1(13Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-8010-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
CEBPB-24764292-MC3T3-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
gracile nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.838993
GTEX-XBED-0826-SM-47JYC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XBEW-1426-SM-4AT4J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:1(9Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
496100278_FWM_no dementia_TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.19481
FOXC2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	32.6186
DG(20:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LXF289	CCLE Cell Line Gene Mutation Profiles	1.0	null
cell projection	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.047005
GSE228106_0_v_4_paclitaxel_human	RummaGEO Drug Perturbation Signatures	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RW-A68A-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Chromium levels	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.509691
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A6H0-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055646
GTEX-U3ZN-0008-SM-4DXTL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
glucose metabolism disease	GWASdb SNP-Disease Associations	1.0	0.338117
DG(18:3n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-1278	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
TP73	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.3758
C6orf132	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.84766
GSE210101,GSE210114_5_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Ebolavirus(EBOV)_5day_Splenocytes_19683682_GSE17509	GEO Signatures of Differentially Expressed Genes for Viral Infections	-1.0	-1.94111
POU2F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.2316
hsa-miR-96	TargetScan Predicted Conserved microRNA Targets	1.0	1.45615
striatum_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.10246
abnormal internal genitalia	GWASdb SNP-Phenotype Associations	1.0	0.270784
RKO	CCLE Cell Line Gene Mutation Profiles	1.0	null
regulation of cellular process	GO Biological Process Annotations 2015	1.0	null
hsa-miR-4489	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
hippocampus (hippocampal formation)_19 pcw_F_12885	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.20376
Pancreatic adenocarcinoma_PAAD_TCGA-HZ-7924-01A-11R-2156-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC9160255-41467_2022_30710_MOESM4_ESM.xlsx-AR_specific_regulated_genes-SYMBOL_1_AR	Rummagene Transcription Factor Associations 2026	1.0	null
MCRIP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74349
NCIH1876	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(14:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
PMC11195603-jamapsychiatry-e241429-s002.xlsx-eT38_Protein_cis-instrument_MR-Unnamed_2_NR3C2	Rummagene Transcription Factor Associations 2026	1.0	null
amygdalo-striatal transition	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.02487
GSE210101,GSE210114_2_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-UTHO-0008-SM-4JBID	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:4(6Z,9Z,12Z,15Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QVUS-0011-R10A-SM-3GIK3	GTEx Tissue Sample Gene Expression Profiles	1.0	0.975567
PANC 03.27	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.918052
hsa-miR-586	TargetScan Predicted Conserved microRNA Targets	1.0	0.714812
LMX1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.4407
GTEX-X585-0011-R11B-SM-46MUZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.4336
DG(20:3(5Z,8Z,11Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
EMC10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01599
PDE10A_KO_GDS4542_292_mouse_hippocampus	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
DGCR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.51886
GORASP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.58064
TFG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44266
DG(18:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MITF-21258399-MELANOMA-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
RNF31	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.09561
cerebellar cortex_8 yrs_M_12981	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.08461
COR-L303	COSMIC Cell Line Gene Mutation Profiles	1.0	null
PPARA_agonist activation_GSE17250_475_mouse_Isolated hepatocytes	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
VEZT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39474
GTEX-U8T8-2226-SM-3DB95	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HCC1806	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.10165
GTEX-SJXC-0005-SM-2XCE7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
H3K27me3_HepG2_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE166004_3_v_6_pld1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(18:1(11Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
puberty and gonadal disorders	GWASdb SNP-Phenotype Associations	1.0	0.367064
DG(14:1n5/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
A3KAW	DepMap CRISPR Gene Dependency	1.0	3.51975
GTEX-QDVN-1126-SM-48TZ7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE153757,GSE153758_1_v_3_ftsj1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
soft tissue	HPA Tissue Protein Expression Profiles	-1.0	-1.14162
FOXA1_T47D_hg19_2	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GTEX-WL46-0011-R3A-SM-3TW8E	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04584
DG(20:4(5Z,8Z,11Z,14Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
MRPS21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93638
EJM	CCLE Cell Line Gene Expression Profiles	1.0	2.73101
GSE188570,GSE188571_5_v_2_decitabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
SLFN12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.16626
mammalian phenotype	MPO Gene-Phenotype Associations	1.0	null
RAVER2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03953
GTEX-OHPK-1726-SM-48TC4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WWYW-0011-R1A-SM-3TW8G	GTEx Tissue Sample Gene Expression Profiles	1.0	1.05031
ARRDC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7842
GTEX-XQ8I-2026-SM-4BOOL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:0/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RM2N-0008-SM-48FF3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC8528285-pbio.3001085.s010.xlsx-Fig_8C-MLX_3T3_MLX	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-T2IS-2926-SM-32QPO	GTEx Tissue Sample Gene Expression Profiles	1.0	1.72172
HSPA13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32633
DG(18:3n6/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
exocytic vesicle membrane	GO Cellular Component Annotations 2025	1.0	null
Claustrum	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.67101
DG(20:3(8Z,11Z,14Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XQ3S-0008-SM-4GIDZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HOXA5	JASPAR Predicted Transcription Factor Targets	1.0	null
KCTD17	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91449
abnormality of the urinary system	GWASdb SNP-Phenotype Associations	1.0	0.834343
H3K27me3_liver_mm9_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SW 948	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
DG(24:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
neuromuscular junction development	GO Biological Process Annotations 2023	1.0	null
central nervous system disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
Cerebellar mossy fiber	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.957
CD33+_Myeloid	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-1.24366
KINGS1	DepMap CRISPR Gene Dependency	1.0	4.19896
DG(24:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XYKS-0526-SM-4BRW2	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
FIS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47782
zfpm2_19411579_heart_lof_mouse_gpl1261_gds3659	GEO Signatures of Differentially Expressed Genes for Transcription Factor Perturbations	1.0	0.049914
DG(18:3(9Z,12Z,15Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
orbital frontal cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.847832
ion binding	GO Molecular Function Annotations 2015	1.0	null
GSE164757,GSE164759_1_v_0_trametinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
PAX6	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	45.6744
CISH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75015
occipital lobe	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.932766
PMC7181746-41467_2020_15886_MOESM8_ESM.xlsx-Patient_14_CCF-Affected_Genes_PITX1	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-3691-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
DG(18:1n9/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n9/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
LS513	CCLE Cell Line Gene Mutation Profiles	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A8HT-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
VMRC-RCZ	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE153836_14_v_1_fluoxetine_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(22:4n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
EP300-21415370-HL-1-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
RTL8C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83512
TCEAL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.71737
Anterior cingulate area, dorsal part, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.14235
GTEX-WL46-0011-R6A-SM-3LK6X	GTEx Tissue Sample Gene Expression Profiles	1.0	0.889028
brain	GTEx Tissue Gene Expression Profiles	1.0	2.18484
macular degeneration	GWASdb SNP-Disease Associations	1.0	0.869084
layer 1 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.70221
signal transduction	GO Biological Process Annotations 2015	1.0	null
HS 936.T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.03837
DG(18:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
liver	HPA Tissue Gene Expression Profiles	-1.0	-1.0624
GET1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.18734
GSE174418,GSE174421_2_v_3_mettl5_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
NIFK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.12525
DG(20:3n9/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
MRPL10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64749
intermediate stratum of isLim	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.32443
H3K9me3_HeLa-S3_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
DG(24:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Ascl2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	39.7883
GTEX-XPT6-2126-SM-4B66P	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PRKD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.24307
DG(18:2(9Z,12Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC4815041-NIHMS715090-supplement-Supplementary_Table_10.xlsx-CCF_DP_clustering-Hugo_Symbol_PITX1	Rummagene Transcription Factor Associations 2026	1.0	null
Anteromedial visual area, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.01052
TEPSIN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89934
Calcium	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
goblet cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.420004
GTEX-WEY5-0726-SM-4LMID	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MELJUSO	CCLE Cell Line Gene Mutation Profiles	1.0	null
PEO1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:2n6/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
MIS12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57969
squamous cell carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.283297
GSE203308_15_v_3_brf1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
IKZF3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.09307
496100562_FWM_no dementia_TBI_95-99_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.29882
SNU1214	CCLE Cell Line Gene CNV Profiles	1.0	1.49648
DG(20:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-N7MS-0011-R1a-SM-2HMJG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06642
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_1311_KO_Cntnap4_SRP386887	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-1.88139
Secretory vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
increased circulating creatinine level	MGI Mouse Phenotype Associations 2023	1.0	null
GTEX-T6MO-1026-SM-4DM72	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Human - Motor Cortex - Cluster - VIP+ HS3ST3A1+ Layer 3-5 GABAergic neuron	HuBMAP Azimuth Cell Type Annotations	1.0	null
DG(18:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
YY1	MotifMap Predicted Transcription Factor Targets	1.0	null
Sarcoma_SARC_TCGA-SI-AA8C-01A-11R-A38C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
alveolar cell type ii	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.719934
LYSMD3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07034
squamous epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.082883
NCI-H524	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(6Z,9Z,12Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZMYM1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.67789
DG(20:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE126345_9_v_10_hcrt_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GPR3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64885
stratum pyramidale of rostral CA3	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.981755
cytoplasmic vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.160456
Brain Lower Grade Glioma_LGG_TCGA-S9-A6WI-01A-21R-A33Z-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-QMR6-0011-R11A-SM-32PKK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.7227
UBXN8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.23355
abnormal genital system morphology	GWASdb SNP-Phenotype Associations	1.0	0.209157
intracellular	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
Taenia tecta, ventral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.75964
DG(14:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3n6/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
cerebellar cortex_15 yrs_M_12299	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.53725
PLXNB3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.47818
DG(22:5n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-8258-11A-01R-2263-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SPATA24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37321
DG(22:1(13Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Agranular insular area, dorsal part, layer 2/3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.18041
HCC1143	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-OXRN-0011-R10A-SM-2I5GC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.30398
TOV112D	DepMap CRISPR Gene Dependency	1.0	3.23912
USP7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86281
mucous gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.336336
GSE174586_0_v_1_slc4a11_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
CMK115	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE210101,GSE210114_8_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC9950457-mmc3.xlsx-GRHL2_binding_sites-RBBP8NL_GRHL2	Rummagene Transcription Factor Associations 2026	1.0	null
DG(14:1n5/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
Ascomycin	DeepCoverMOA Drug Mechanisms of Action	1.0	0.88
abnormality of the macula	GWASdb SNP-Phenotype Associations	1.0	0.762459
DG(16:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-NPJ8-0011-R4a-SM-2HML3	GTEx Tissue Sample Gene Expression Profiles	1.0	0.833982
DG(18:1(11Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
disease of anatomical entity	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
GTEX-XQ8I-1426-SM-4BOPW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(5Z,8Z,11Z,14Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TKQ2-1726-SM-4DXUP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
KLHL42	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98863
GSE210101,GSE210114_8_v_9_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Depressive disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.469
SK-CO-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Select biomarker traits	GWAS Catalog SNP-Phenotype Associations	1.0	0.220915
brain	HPA Tissue Gene Expression Profiles	1.0	1.96995
PMC9590125-40478_2022_1453_MOESM3_ESM.xlsx-NEUN_UNIQUE_DYS_GENES-OLIG2_TLE_vs_TL_log2FoldChange_1_padj_0_1_OLIG2	Rummagene Transcription Factor Associations 2026	1.0	null
DG(24:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MCC13	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE84922,GSE84924_0_v_1_sall4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(15:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Disease of anatomical entity	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.594
NCIH2141	CCLE Cell Line Gene Expression Profiles	-1.0	-1.75021
GTEX-OXRN-2426-SM-2I5EQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.23747
Alzheimer's disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.237
DG(15:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
NCIH2228	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-RN64-1826-SM-48FDV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MEL290	DepMap CRISPR Gene Dependency	1.0	3.58178
GTEX-XUZC-1026-SM-4BOPY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
oculomotor nucleus, main part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.09743
NCIH1703	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(15:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
synaptic membrane	GO Cellular Component Annotations 2015	1.0	null
hsa-miR-3677-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
GSE109285_5_v_2_glucagon_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-QVJO-1325-SM-2S1QX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.42634
Prostate adenocarcinoma_PRAD_TCGA-HC-7747-11A-01R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
chemical synaptic transmission	GO Biological Process Annotations 2023	1.0	null
DG(24:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-4282	TargetScan Predicted Conserved microRNA Targets	1.0	0.107229
DG(18:2(9Z,12Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
IHH-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-RNOR-1426-SM-48FDJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Neuronal dense core vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.229
ES-I3 Cells	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-1.12054
trans-synaptic protein complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.898
HTR7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7229
r6 part of the cochlear column	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.44505
GSE210101,GSE210114_4_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
KM-H2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF250	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.75837
CDK2AP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48942
GSE138672_0_v_1_rabgef1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:1(13Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QVJO-1426-SM-2S1QY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.1231
SART3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.14623
brain	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GRK2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58553
DG(20:2(11Z,14Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TREX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.18511
GSE224096_2_v_0_cocaine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GSE96641_5_v_0_esrp2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
MYF5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.89385
DG(18:1(11Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S3XE-1926-SM-3K2B3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CCNI	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.58838
DG(20:2(11Z,14Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
BTRC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.44794
GTEX-R53T-0426-SM-48FEM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XMD3-0006-SM-4AT5X	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
M-1	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	-1.0	-1.18316
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Tanycyte	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.963
ENTPD5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.46569
E2F7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	54.9828
biological_process	GO Biological Process Annotations 2015	1.0	null
superficial stratum of r8BL	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.05895
Bladder Urothelial Carcinoma_BLCA_TCGA-BL-A13J-01A-11R-A10U-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(18:1n7/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
abnormality of higher mental function	GWASdb SNP-Phenotype Associations	1.0	0.318077
NANOG-19829295-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
NCIH2110	CCLE Cell Line Gene Mutation Profiles	1.0	null
REC1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-WEY5-2226-SM-3GILQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSS	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:2(13Z,16Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE126345_9_v_3_hcrt_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
whole body	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
184A1N4	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.775491
DG(14:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
MAFK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05193
GTEX-T5JW-1526-SM-4DM5E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
chronic kidney failure	GWASdb SNP-Disease Associations	1.0	0.417452
Kidney Chromophobe_KICH_TCGA-KL-8323-01A-21R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
JHH1	DepMap CRISPR Gene Dependency	1.0	2.28738
GSE175787_11_v_0_rhoc_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-DK-A3IK-01A-32R-A21D-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
OCT1-27270436-CHIP-SEQ-PROSTATE-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GSE84922,GSE84924_4_v_1_sall4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
parkinsonism	GWASdb SNP-Phenotype Associations	1.0	1.12492
KLK10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.35726
DG(18:3n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ZNF729	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93301
DG(18:1(11Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Cervix - Endocervix	GTEx Tissue Gene Expression Profiles 2023	1.0	2.07819
Geniculate group, dorsal thalamus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.17805
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LU65	CCLE Cell Line Gene Mutation Profiles	1.0	null
TT	CCLE Cell Line Gene Mutation Profiles	1.0	null
abnormal learning/memory/conditioning	MPO Gene-Phenotype Associations	1.0	null
red nucleus, magnocellular part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.03356
GTEX-U4B1-0006-SM-3DB8E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(8Z,11Z,14Z,17Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE145915_0_v_2_pcm1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-XV7Q-2426-SM-4BRV8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-4503	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
Striate cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.858
m1Lim part of the midbrain reticular formation	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.68873
DG(22:4(7Z,10Z,13Z,16Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SK-N-DZ	COSMIC Cell Line Gene Mutation Profiles	1.0	null
all	GWASdb SNP-Phenotype Associations	1.0	0.121519
FOXS1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.8984
B-lymphoblastoid cell	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.823
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-SNOS-0008-SM-4DM6I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
COQ9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.43007
ventral posterior lateral nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.45345
DG(15:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DPCD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.88457
DMS53	CCLE Cell Line Gene Expression Profiles	-1.0	-1.4744
LB1047RCC	DepMap CRISPR Gene Dependency	1.0	2.32584
DG(20:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RUSQ-1826-SM-2TF6E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Bladder Urothelial Carcinoma_BLCA_TCGA-FJ-A3Z9-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SP9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34609
GABPB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82939
ESRRA	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	19.3578
rostral division of OFCi (area 11)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.12761
DG(20:3(5Z,8Z,11Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1n9/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
POU4F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	35.7395
emboliform nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.827145
GSE138001_5_v_4_rorb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
macromolecular complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.040578
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Feather calamus	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.026
DG(16:1n7/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
GSE221004_3_v_2_prdm6_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-T5JW-0126-SM-4DM6K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE109285_5_v_4_glucagon_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
Lung adenocarcinoma_LUAD_TCGA-64-1678-01A-01R-0946-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(24:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
H322T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-2.29942
TIAL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.21924
GTEX-SE5C-0006-SM-4BRW5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC6754502-41598_2019_50051_MOESM3_ESM.xlsx-Br_to_Fay_Heat_LPS-Gene_Symbol_IRF6	Rummagene Transcription Factor Associations 2026	1.0	null
DG(14:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
PMC10248509-Data_Sheet_6.CSV--GSE58294_DE-genes_AND_GSE22255_DE-Genes_NOT_Autophagy_NOT_GSE66724_DE-Genes_NR4A2	Rummagene Transcription Factor Associations 2026	1.0	null
CA4 field, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	2.11081
DG(18:0/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
MRPL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.40652
fasciola cinerea	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.37636
DG(15:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MZ7-MEL	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DNAJC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37844
Perturb_8637_KO_Arid1a_SRP312002	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	4.39512
GSE137325_3_v_0_copanlisib_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-R55F-1226-SM-2TF59	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49226
pioglitazone_mus musculus_gpl1261_gds4413	GEO Signatures of Differentially Expressed Genes for Small Molecules	-1.0	null
BMP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31355
MDAMB157	CCLE Cell Line Gene CNV Profiles	-1.0	-1.69721
GTEX-OIZG-1126-SM-2HMIU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TSE9-2926-SM-3DB77	GTEx Tissue Sample Gene Expression Profiles	1.0	1.47749
MTCL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.91853
VN1R1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.73595
TRIT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48413
substance-related disorder	GWASdb SNP-Disease Associations	1.0	0.213572
GSE120612_6_v_5_etoposide_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-QLQ7-0005-SM-2S1QP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
single-organism transport	GO Biological Process Annotations 2015	1.0	null
lung	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.085354
VANGL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48183
JVM3	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(9Z,12Z,15Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE190681_1_v_0_rtcb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Epilepsy	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.136
ES2	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:1(13Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H1105	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Prenatal Exposure Delayed Effects	CTD Gene-Disease Associations	1.0	1.08055
TTC30A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.27043
PMC3878729-1471-2148-13-273-S1.xls-Gene_List-Zfp9_ZNF25	Rummagene Transcription Factor Associations 2026	1.0	null
SRP14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21263
DG(18:4(6Z,9Z,12Z,15Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE172016_2_v_0_paclitaxel_human	RummaGEO Drug Perturbation Signatures	-1.0	null
HNF1A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	30.469
Primary visual area, layer 2/3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.0535
DG(18:1n7/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
Perturb_3466_KO_Chd4_SRP076455	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
GTEX-T8EM-0826-SM-4DM76	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ANP32E	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.4171
PAGR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.95734
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AH-0226-SM-48U1I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
THOC5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.59575
DG(20:5(5Z,8Z,11Z,14Z,17Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC7880998-41467_2021_21255_MOESM8_ESM.xlsx-Sup_Data_5_TWIST_Panel-Gene_Name_TWIST1	Rummagene Transcription Factor Associations 2026	1.0	null
CEBPZ	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31942
IL27RA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54101
Micronuclei, Chromosome-Defective	CTD Gene-Disease Associations	1.0	1.12599
DG(16:1n7/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
Nafamostat	DeepCoverMOA Drug Mechanisms of Action	1.0	0.32
HCC2108	CCLE Cell Line Gene Mutation Profiles	1.0	null
SOX10	MotifMap Predicted Transcription Factor Targets	1.0	null
MCF7	CCLE Cell Line Gene CNV Profiles	1.0	2.31383
GTEX-X5EB-0008-SM-46MU3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
increased circulating phosphate level	MGI Mouse Phenotype Associations 2023	1.0	null
GTEX-P4QS-0008-SM-48TDY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE221327_4_v_11_clpp_human	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
cerebellar purkinje cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.40366
BATF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93292
DG(24:1(15Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MKN-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.977331
Uncoordinated protein 13 (Unc-13)	InterPro Predicted Protein Domain Annotations	1.0	null
cerebellar cortex_36 yrs_M_12302	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.8179
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
cognitive disorder	GWASdb SNP-Disease Associations	1.0	1.19386
abnormal emotion/affect behavior	GWASdb SNP-Phenotype Associations	1.0	0.387986
TBX20	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.8853
neuronal dense core vesicle exocytosis	GO Biological Process Annotations 2023	1.0	null
HSF1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	24.3187
Prostate adenocarcinoma_PRAD_TCGA-HC-7740-11A-01R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(18:1(11Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Carotid body cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.512
SAT	DepMap CRISPR Gene Dependency	1.0	2.36066
EKVX	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.31733
SCAMP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01865
PAICS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.39596
CBX3_K562_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
NME2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.09511
GSE242333_0_v_2_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC7498599-41467_2020_18508_MOESM11_ESM.xlsx-ICM_JUN-Unnamed_1_JUN	Rummagene Transcription Factor Associations 2026	1.0	null
COA6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39842
IDS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01472
Body Weight	dbGAP Gene-Trait Associations	1.0	0.154657
Presynapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.182
GTEX-WY7C-0926-SM-3NB34	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Pheochromocytoma and Paraganglioma_PCPG_TCGA-QR-A70J-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
fh1	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.668
Inhibitory synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.521
Olig2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	38.7263
TSKU	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04284
SYNCRIP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65202
GSE125782_3_v_1_glutamine_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(22:1(13Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PFDN5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	6.27682
HCC515	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.31733
DG(18:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
CAKI1	CCLE Cell Line Gene CNV Profiles	-1.0	-2.30414
Esophageal squamous cell carcinoma cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.255
GPR150	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60993
HOS	COSMIC Cell Line Gene Mutation Profiles	1.0	null
496100577_FWM_probable Alzheimer's disease_TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.50203
integument	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.05658
EJM	CCLE Cell Line Gene CNV Profiles	1.0	1.43853
signaling	GO Biological Process Annotations 2015	1.0	null
HS578T	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.864743
DG(15:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PURA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57457
abnormal nervous system physiology	MPO Gene-Phenotype Associations	1.0	null
KIF3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4704
SLC52A2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49491
lymphoma	GWASdb SNP-Phenotype Associations	1.0	0.650754
Agranular insular area, ventral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.21202
PA2G4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.07652
DG(15:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-OOBJ-0826-SM-3NB2K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
CCN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.74936
IX, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.15542
layer 2 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.63429
hsa-miR-3688-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
DG(15:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
CORL95	CCLE Cell Line Gene CNV Profiles	-1.0	-1.48665
LK2	CCLE Cell Line Gene Mutation Profiles	1.0	null
ventrolateral preoptic nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.14613
coated vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.370067
Brain Lower Grade Glioma_LGG_TCGA-FG-8189-01B-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
21NT	DepMap CRISPR Gene Dependency	1.0	2.43453
AK4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20108
intracellular organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
NCIH1648	DepMap CRISPR Gene Dependency	1.0	2.49308
JHH4	CCLE Cell Line Gene Mutation Profiles	1.0	null
abnormality of blood and blood-forming tissues	GWASdb SNP-Phenotype Associations	1.0	0.128079
superficial stratum of r4Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.13556
SNU182	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TGBC11TKB	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-XYKS-2526-SM-4BOPX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
thoracic cancer	GWASdb SNP-Disease Associations	1.0	0.481016
GTEX-TKQ1-0426-SM-4DXT4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_16949_OE_GATA6/ZBED2_SRP235000	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	8.17035
inner CP in caudal midinferior temporal cortex (area TF)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.27455
TEX19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19889
Dorsal cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.35509
GTEX-U3ZM-0826-SM-4DXU6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Hippocampal mossy fiber	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.449
PCI-4B	COSMIC Cell Line Gene Mutation Profiles	1.0	null
VMRC-LCD	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.26504
Twist2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	23.8526
Perturb_12846_KO_Setd1b_SRP081141	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-12.9474
CIT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-4.03749
DG(14:1(9Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RWS6-1126-SM-47JXC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC11625982-AJH-100-10-s001.pdf-9-ETS1_ETS1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-XMD1-0011-R2B-SM-4AT5N	GTEx Tissue Sample Gene Expression Profiles	1.0	0.959477
G protein-coupled receptor dimeric complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.984
NCIH1666	DepMap CRISPR Gene Dependency	1.0	4.02116
DG(16:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RT-A6YA-01A-12R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:3n9/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
PKCTHETA-26484144-CHIP-SEQ-BREAST-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
DG(15:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
insular cortex	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.88663
DG(20:4(8Z,11Z,14Z,17Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
nervous system	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
nervous system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.040519
periventricular stratum of r4Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.96347
IV	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.87369
OPA3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.53061
GTEX-R53T-2026-SM-3GIJF	GTEx Tissue Sample Gene Expression Profiles	1.0	0.830689
abnormality of immune system physiology	GWASdb SNP-Phenotype Associations	1.0	0.185561
EYA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81224
PDX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.4981
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
WASH complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.679
PMC9160255-41467_2022_30710_MOESM4_ESM.xlsx-AR_specific_regulated_genes-ENSEMBL_AR	Rummagene Transcription Factor Associations 2026	1.0	null
CHL-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
GTEX-Q734-0008-SM-48U2I	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC12478272-mmc1.xlsx-Table_S7-Supplementary_Table_7_Proteome-wide_MR_and_sensitivity_analysis_results_using_the_brain_pQTL_dataset_from_Wingo_et_al_1_NR3C2	Rummagene Transcription Factor Associations 2026	1.0	null
OCIP5X	DepMap CRISPR Gene Dependency	1.0	2.73026
DG(14:1n5/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
H6PD_KO_GDS3195_602_mouse_Skeletal muscle - Soleus	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
DG(20:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-RU72-0011-R2A-SM-2TF6O	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09089
DG(16:1(9Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE234289_4_v_0_rfx6_human	RummaGEO Gene Perturbation Signatures	1.0	null
paraventricular nuclei, right of thalamus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.92795
DG(18:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-330-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
HH	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
KMS27	CCLE Cell Line Gene Mutation Profiles	1.0	null
cerebellar granule cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.875284
DG(18:1(9Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE89018_12_v_8_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
Mouth floor	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.92
496100355_HIP_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.92492
DG(14:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ADAMTSL4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.8055
PMC11585558-41467_2024_54547_MOESM8_ESM.xlsx-TP53_vs_WT_DEG_FFPE-gene_name_TP53	Rummagene Transcription Factor Associations 2026	1.0	null
organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.057616
external globus pallidum	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.28858
BCPAP	COSMIC Cell Line Gene Mutation Profiles	1.0	null
neurodegenerative disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.060018
abnormal neuron morphology	GWASdb SNP-Phenotype Associations	1.0	0.509391
DG(18:2(9Z,12Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PHYKPL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.79277
GTEX-XBED-0006-SM-47JXO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TUBB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77131
KDM5A_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
Stratum lucidum	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.732
HGC27	CCLE Cell Line Gene Mutation Profiles	1.0	null
neurodegenerative disease	GWASdb SNP-Disease Associations	1.0	0.520724
Exocytic vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
MTX3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.5489
DG(18:2(9Z,12Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
EHEB	CCLE Cell Line Gene Expression Profiles	1.0	1.66917
KIJK	CCLE Cell Line Gene Mutation Profiles	1.0	null
NUDT2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.68763
DG(24:1(15Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
respiratory epithelium	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.107541
H3K4me1_testis_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
SMARCC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.33783
SP in inferolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.871648
Heart-hepatocyte	Tabula Sapiens Gene-Cell Associations	1.0	8.53289
PMC6944231__F5	PFOCR Pathway Figure Associations 2023	1.0	null
GTEX-UJMC-0008-SM-4IHKK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of the nervous system	GWASdb SNP-Phenotype Associations	1.0	0.493948
GSE174735_4_v_3_il22_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
TCF4-23295773-U87-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
navicular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.95973
diabetes mellitus	GWASdb SNP-Phenotype Associations	1.0	0.288859
PCDHB6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17642
GSE212299_2_v_1_abi3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Primary somatosensory area, mouth, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.18651
bronchial disease	GWASdb SNP-Disease Associations	1.0	0.751885
P2RX4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01295
hsa-miR-877	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
Edema	CTD Gene-Disease Associations	1.0	1.21402
Synaptic vesicle	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
Distal axon	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.773
DG(20:3(8Z,11Z,14Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC7346435-12864_2020_6860_MOESM6_ESM.xlsx-H1_ZF_Oocyte_Specific-GeneH_CREBZF	Rummagene Transcription Factor Associations 2026	1.0	null
DG(16:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
testis_7e	HPA Tissue Sample Gene Expression Profiles	1.0	1.59415
Purkinje layer	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.863
GTEX-RUSQ-0626-SM-2TF5V	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HCC38	COSMIC Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-518d-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.159923
ULK1_knockout_197_GSE60778	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-2.33387
abnormal eye morphology	GWASdb SNP-Phenotype Associations	1.0	0.129942
DG(20:2n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
GABA-ergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.39
BTAF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.39635
COLO783	CCLE Cell Line Gene Mutation Profiles	1.0	null
dementia	GWASdb SNP-Disease Associations	1.0	0.425585
head	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
hsa-miR-548ac	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
CLPTM1L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.30391
DG(22:4n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
CAOV3	CCLE Cell Line Gene CNV Profiles	-1.0	-1.84796
GTEX-XYKS-0008-SM-4BRW6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:2(13Z,16Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/20:0)	HMDB Metabolites of Enzymes	1.0	null
testis	HPA Tissue Protein Expression Profiles	1.0	0.801417
GTEX-QCQG-0006-SM-2S1OW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(7Z,10Z,13Z,16Z,19Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QDVJ-1126-SM-48U1U	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC8119428-41598_2021_89734_MOESM6_ESM.xlsx-Sheet1-Candidate_PORE_genes_potentially_bound_and_regulated_by_OCT4_POU5F1	Rummagene Transcription Factor Associations 2026	1.0	null
globus pallidus, external segment, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.29763
superficial stratum of InsCx (cortical plate/marginal zone)	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.89432
whole body	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Perturb_13977_KO_H3f3a/H3f3b_ERP109384	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-12.5088
DG(24:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MFM-223	COSMIC Cell Line Gene Mutation Profiles	1.0	null
prostate	HPA Tissue Protein Expression Profiles	1.0	0.801417
S100A13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80977
PMC9306206-12915_2022_1367_MOESM6_ESM.xlsx-Table_S7_-_JIP-Gene_SMAD4	Rummagene Transcription Factor Associations 2026	1.0	null
LAP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99289
PGAP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57155
HMGB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.943
Tetanus	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.086
ZNF587B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.0568
TBX3	ChEA Transcription Factor Targets	1.0	null
GTEX-U3ZN-0726-SM-4DXT5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
nervous system disease	GWASdb SNP-Disease Associations	1.0	0.219407
Brain Lower Grade Glioma_LGG_TCGA-HT-7481-01A-11R-2027-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE186483_6_v_0_lrrk2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Organ system cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.384
Secretory vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.934
OVCAR8	CCLE Cell Line Gene Mutation Profiles	1.0	null
TMC6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.2984
VAMP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.82427
organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Foxo3	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	21.8163
Duodenum	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
REST_MCF-7_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(18:1(9Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SK-BR-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.845123
SLC39A14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64556
BONNA-12	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-NPJ8-0011-R11A-SM-2YUMS	GTEx Tissue Sample Gene Expression Profiles	1.0	1.63939
synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.750452
r4 part of cochlear sensory column	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.31234
GTEX-Q2AH-1926-SM-2S1PN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormal leukocyte count	GWASdb SNP-Phenotype Associations	1.0	0.3866
GTEX-NL4W-0011-R2a-SM-2I5GV	GTEx Tissue Sample Gene Expression Profiles	1.0	0.859283
GTEX-WHPG-1426-SM-3NMBB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE104508_0_v_1_dnmt3a_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
MDA-MB-453	COSMIC Cell Line Gene Mutation Profiles	1.0	null
VIIB, right, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.919076
smallpox	GWASdb SNP-Disease Associations	1.0	1.21019
Brain Lower Grade Glioma_LGG_TCGA-TM-A84R-01A-21R-A36H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(22:1n9/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SCL-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
RPL13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.19015
breast cancer	GWASdb SNP-Disease Associations	1.0	1.10764
GSE235701,GSE261434_0_v_3_enasidenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Kenyon cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.655
medial habenular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.06386
CAPAN-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.2409
TRMT61B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06346
NCIH1105	CCLE Cell Line Gene Mutation Profiles	1.0	null
HCC1263	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.863068
MV411	CCLE Cell Line Gene Mutation Profiles	1.0	null
HSPA2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66477
DND41	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(14:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
OSC20	DepMap CRISPR Gene Dependency	1.0	2.01153
RUNX2-22187159-PCA-HUMAN	ChEA Transcription Factor Binding Site Profiles	1.0	null
abnormality of the globe	GWASdb SNP-Phenotype Associations	1.0	0.129942
DG(18:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
FERD3L	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	33.238
MITF	ChEA Transcription Factor Targets	1.0	null
PPIF_KO_GSE23028_45_mouse_heart (8 wk)	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
GSE196671_6_v_1_obox4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:3(5Z,8Z,11Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE231648_0_v_5_lsm14b_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(18:1(9Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE85880,GSE85881_0_v_2_tretinoin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
MEA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.81546
GTEX-NFK9-1626-SM-3LK5J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
FOXK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.7147
MDA-MB-231	COSMIC Cell Line Gene Mutation Profiles	1.0	null
TIGD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01599
syntaxin binding	GO Molecular Function Annotations 2025	1.0	null
NCI-H2227	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hippocampus (hippocampal formation)_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.02072
Cerebral peduncle	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.324
GTEX-P44H-0011-R11A-SM-2XCER	GTEx Tissue Sample Gene Expression Profiles	1.0	1.90557
H3K9me3_erythroblast_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
metal ion binding	GO Molecular Function Annotations 2015	1.0	null
DG(18:1n9/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
Transport vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.091
amygdaloid complex_16 pcw_M_12837	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.75456
NCIH2452	CCLE Cell Line Gene CNV Profiles	1.0	3.2803
DG(20:5(5Z,8Z,11Z,14Z,17Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PRICKLE3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31379
NCIH1694	DepMap CRISPR Gene Dependency	1.0	3.14921
GTEX-S341-1726-SM-3K2AK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Neuroendocrine cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.405
PMC11801220-NIHMS2038999-supplement-14.xlsx-Exc-BNC2-gene_BNC2	Rummagene Transcription Factor Associations 2026	1.0	null
movement disease	GWASdb SNP-Disease Associations	1.0	0.43201
synaptic membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.284401
GTEX-XUZC-0005-SM-4BOQ8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ADISSP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.57564
Brain Lower Grade Glioma_LGG_TCGA-FG-8181-01A-11R-2256-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Tongue disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.241
PMC7181746-41467_2020_15886_MOESM8_ESM.xlsx-Patient_11_CCF-Affected_Genes_PITX1	Rummagene Transcription Factor Associations 2026	1.0	null
DG(16:1n7/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
HT115	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-XUYS-0002-SM-47JXL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
cell part	GO Cellular Component Annotations 2015	1.0	null
TFB1M	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12465
presynaptic active zone	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.372749
Stomach	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
amygdaloid complex_24 pcw_M_12288	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.37356
GTEX-SNMC-0926-SM-4DM5U	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
fertilizedegg	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	1.59669
IGROV-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Cell cortex region	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
501A	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.45627
DG(20:1(11Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PPARG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.83096
DG(22:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DCLRE1C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80273
r4 part of posteroventral cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.13471
SPRN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.90691
VIIB, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.994294
Psychotic disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.238
abnormal synaptic transmission	MPO Gene-Phenotype Associations	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CAMA1	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
prostate cancer	GWASdb SNP-Disease Associations	1.0	0.69756
GSE136653,GSE136660_1_v_0_interferon gamma_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
PHF20	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.91313
epididymis	HPA Tissue Protein Expression Profiles	1.0	0.801417
RUNDC3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.50954
DG(22:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
disease of mental health	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.047511
GTEX-QMRM-0005-SM-3NB2A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Liver hepatocellular carcinoma_LIHC_TCGA-CC-A9FV-01A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NCIH2023	CCLE Cell Line Gene CNV Profiles	-1.0	-2.23081
DG(20:1n9/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
r7 part of the posteroventral cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.67792
GW842166X	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.52
Prelimbic area, layer 2	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.17493
DG(16:1n7/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
nucleus of the inferior collicular brachium, rostral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.01426
SP in posterosuperior (dorsal) parietal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.919473
DG(18:3n3/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
MI-773	DeepCoverMOA Drug Mechanisms of Action	1.0	1.13
DG(15:0/0:0/15:0)	HMDB Metabolites of Enzymes	1.0	null
GSE151612_0_v_7_pracinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
Bone marrow endothelial cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.773
cell part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
GTEX-Q2AG-2826-SM-2HMJQ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39992
GSE111385_0_v_3_tgfbr2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-UTHO-2926-SM-3P5Z9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.30389
GSE115363_2_v_0_esrrb_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GPR25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34926
JHH1	CCLE Cell Line Gene Mutation Profiles	1.0	null
human immunodeficiency virus infectious disease	GWASdb SNP-Disease Associations	1.0	0.543366
GTEX-TML8-1526-SM-4DXUX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SAT	COSMIC Cell Line Gene Mutation Profiles	1.0	null
alzheimer's disease	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.230409
ZIC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.44636
LRRC40	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.41701
GTEX-UJHI-1126-SM-4IHLN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OVCAR8	CCLE Cell Line Gene CNV Profiles	-1.0	-2.58703
hsa-miR-519b-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.159923
Cardiovascular Diseases	dbGAP Gene-Trait Associations	1.0	0.312956
GTEX-XUYS-0008-SM-47JYZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LS1034	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.03837
inferior nucleus of pulvinar	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.10508
Supplemental somatosensory area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.69131
chr15_54278030_G_T_b38	GTEx eQTL 2025	1.0	1.29951
PATU8988T	DepMap CRISPR Gene Dependency	1.0	3.03712
Kidney renal clear cell carcinoma_KIRC_TCGA-A3-3328-01A-01R-0864-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Disease of anatomical entity	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	0.99
PMC9305137-PATH-256-297-s005.xlsx-CIC_associated_DE_genes_IDH1-W-Unnamed_1_CIC	Rummagene Transcription Factor Associations 2026	1.0	null
intracellular organelle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.054105
ES-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:1(9Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H650	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WEY5-0008-SM-4LMKC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC7884719-41598_2021_83348_MOESM3_ESM.xlsx-male_port-EGR1_1_EGR1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-WYBS-1126-SM-3NMAM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
RCM-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.988148
PMC10641274-mmc2.xlsx-FOXK1_Insulin-ENSEMBL_FOXK1	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-S7SE-0011-R11A-SM-2XCDD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.55268
DG(18:1(9Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hypoglossal nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.867389
GTEX-QDVJ-0008-SM-48U2E	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE174735_1_v_3_il22_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(18:3(9Z,12Z,15Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
neuron part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
GSE76425_1_v_10_lenalidomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
KMS18	CCLE Cell Line Gene Expression Profiles	1.0	2.4088
pontine nuclei, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.09603
synaptic vesicle membrane	GO Cellular Component Annotations 2025	1.0	null
SOCS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38532
CHD1	ENCODE Transcription Factor Targets	1.0	null
hsa-miR-128	TargetScan Predicted Conserved microRNA Targets	1.0	0.997906
LS411N	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:1(11Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3978	TargetScan Predicted Conserved microRNA Targets	1.0	0.09606
chr15_54248545_AAGCCAGGAGATTTACTTGCTTCAGACACTCTTTATTG_A_b38	GTEx eQTL 2025	1.0	1.74549
NEUROG2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30189
Prostate adenocarcinoma_PRAD_TCGA-EJ-A8FS-01A-11R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
8505C	DepMap CRISPR Gene Dependency	1.0	3.84562
GTEX-T6MN-0011-R6A-SM-32QP8	GTEx Tissue Sample Gene Expression Profiles	1.0	0.828945
DG(20:0/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
CA2 field, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.13498
ACTR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.92729
GSE199034_1_v_2_pirfenidone_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
substantia nigra, pars compacta, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.78792
DG(18:2(9Z,12Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S95S-0008-SM-4AT5M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:1(11Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(8Z,11Z,14Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-27b	TargetScan Predicted Conserved microRNA Targets	1.0	0.517189
GTEX-PSDG-1126-SM-2S1ON	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:1n9/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
Globus pallidus, external segment	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.34559
orbital frontal cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.21334
Perturb_161_KO_Kdm4a_SRP192379	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	5.75741
KDM5B	ENCODE Transcription Factor Targets	1.0	null
NR4A2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.7496
GTEX-REY6-0005-SM-2TF54	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-PX3G-0926-SM-48U12	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-QVJO-0011-R2A-SM-2S1QK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.8419
GTEX-N7MS-0926-SM-2HMIZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TCF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.0756
GRM4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.61065
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-548u	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.921135
H2AFZ_HeLa-S3_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
SNU407	CCLE Cell Line Gene Mutation Profiles	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-G3-A3CH-11A-11R-A22L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-3689e	TargetScan Predicted Conserved microRNA Targets	1.0	0.241055
PECAPJ34CLONEC12	CCLE Cell Line Gene CNV Profiles	1.0	1.34469
Hypothalamus	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.09
Kidney renal clear cell carcinoma_KIRC_TCGA-CJ-4912-01A-01R-1426-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(14:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
body mass index	GAD Gene-Disease Associations	1.0	null
SCN5A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.42733
GTEX-T5JW-0726-SM-4DM6D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC11666716-41698_2024_782_MOESM1_ESM.pdf-2-PRDM10_PRDM10	Rummagene Transcription Factor Associations 2026	1.0	null
intracellular part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.042833
DG(20:4(5Z,8Z,11Z,14Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-QVUS-0011-R8A-SM-3GAD7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.861436
CPC-N	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.52767
DG(14:1(9Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
synaptic vesicle exocytosis	SynGO Synaptic Gene Annotations	1.0	null
GSE76854,GSE90855_1_v_0_acss2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
PGP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47798
496100317_FWM_no dementia_no TBI_81_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.97278
GSE135030_8_v_5_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
PMC4598026__F5	PFOCR Pathway Figure Associations 2024	1.0	null
MZT2B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55249
superficial stratum of r5Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.87615
Primary somatosensory area, upper limb, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.11316
Kidney Chromophobe_KICH_TCGA-KN-8429-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
hsa-miR-657	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
PGAP6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.34542
ZFHX3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89328
COLO-741	COSMIC Cell Line Gene Mutation Profiles	1.0	null
immunodeficiency	GWASdb SNP-Phenotype Associations	1.0	0.46326
GTEX-UJHI-1226-SM-4IHLR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:1(9Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
telencephalon	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.082553
PMC4082627-12864_2014_6197_MOESM8_ESM.xlsx-GATA3_only-Nearest_Ensembl_GATA3	Rummagene Transcription Factor Associations 2026	1.0	null
ENO3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5281
GTEX-PW2O-0226-SM-48TC7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Nervous system disease	DISEASES Experimental Gene-Disease Association Evidence Scores 2025	1.0	0.99
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XOTO-0011-R3A-SM-4B64W	GTEx Tissue Sample Gene Expression Profiles	1.0	1.24879
OTUD4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06923
TIMM8A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03
DG(20:3(8Z,11Z,14Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-N7MS-0011-R10A-SM-2HMJK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.29061
Ivacaftor	DeepCoverMOA Drug Mechanisms of Action	1.0	0.68
DG(18:1(9Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1n7/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X638-0005-SM-47JX6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
FLCN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.52863
DG(20:2(11Z,14Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
C2orf74	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.60171
r6 part of posteroventral cochlear nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.39315
DG(18:1n9/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
H3K4me1_embryonic fibroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
nervous system	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
Mouth disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.473
FOXL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.74386
GTEX-T2IS-0011-R6A-SM-32QP2	GTEx Tissue Sample Gene Expression Profiles	1.0	0.978908
GTEX-U3ZG-0006-SM-47JWX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Astrocyte projection	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.518
abnormal glucose homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.207955
DCK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.65705
Nucleus of the brachium of the inferior colliculus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.28912
GSE175787_4_v_2_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-PWO3-1026-SM-2I5F2	GTEx Tissue Sample Gene Expression Profiles	1.0	1.40103
ATP1A3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05511
TRAF3IP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79478
KBTBD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.49344
DG(18:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCIH2009	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC12775252-18_2025_5991_MOESM3_ESM.xlsx-Sheet1-Supplementary_Table_2_Up-_and_down-regulated_genes_in_TCF7L2-depleted_EVT_compared_to_control_EVT_TCF7L2	Rummagene Transcription Factor Associations 2026	1.0	null
MIA-PACA-2	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7874-01A-11R-2403-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE166920_6_v_8_adalimumab_human	RummaGEO Drug Perturbation Signatures	1.0	null
PITPNM1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.06417
DG(20:3(8Z,11Z,14Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-Q2AI-0626-SM-48TZU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:2(11Z,14Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
mantle zone of r7Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.4461
DG(24:1(15Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE210101,GSE210114_4_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(14:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
NCI-H2030	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.15373
DG(22:4(7Z,10Z,13Z,16Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NIPSNAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.96275
Seminal vesicle	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.091
MALSU1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87227
SUM44PE	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	0.659135
AR-21915096-LNCAP-1F5-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
KMS27	CCLE Cell Line Gene Expression Profiles	1.0	1.93012
Neuropsychological Tests	DisGeNET Gene-Phenotype Associations	1.0	null
KYO1	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(16:1(9Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DV90	CCLE Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-761	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.99187
tauopathy	DISEASES Text-mining Gene-Disease Association Evidence Scores	1.0	0.228679
abnormal CNS synaptic transmission	MGI Mouse Phenotype Associations 2023	1.0	null
DG(15:0/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE199034_1_v_0_pirfenidone_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
SNRPB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56577
hsa-miR-519c-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.159923
whole body	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.323874
Primary somatosensory area, nose, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.49908
CFL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.35467
DG(20:4(8Z,11Z,14Z,17Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XOTO-0008-SM-4GICE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ML-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.64934
DG(22:0/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-3145-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.187098
OE33	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(15:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
OVCA420	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3n9/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PWOO-1326-SM-48TCJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cytoplasmic part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.046168
DG(18:1(11Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
ECPAS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7001
DG(20:2(11Z,14Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
A-Netherlands-602-2009(H1N1)_7Hour_None_GSE40844	GEO Signatures of Differentially Expressed Genes for Viral Infections	1.0	1.41887
DG(18:2(9Z,12Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Pax7	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	27.3877
RIMS4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30722
NCI-SNU-5	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-VJYA-0326-SM-3GAEX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HCC1359	CCLE Cell Line Gene Expression Profiles	-1.0	-1.51899
GTEX-S32W-1926-SM-4AD63	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XUW1-0326-SM-4BOOR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
KNS62	CCLE Cell Line Gene Mutation Profiles	1.0	null
NDUFB8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.76777
GSE135030_11_v_2_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-S4Z8-0726-SM-4GICB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
superficial stratum of CoPV	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.36543
GTEX-OOBK-0226-SM-2YUMF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_6638_KO_IKZF1_SRP139731	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-6.78506
alkaline phosphatase	GAD Gene-Disease Associations	1.0	null
GTEX-XQ3S-2526-SM-4BOOG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-RUSQ-0126-SM-47JWV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
animal	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
DG(16:1(9Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RPMI 8226	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	2.2937
KHK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.44642
DG(20:2n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
cytoplasmic membrane-bounded vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.162763
BCCIP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.90296
CDC25B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.66565
GON4L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.76766
TE-12	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
lymphoma	GWASdb SNP-Disease Associations	1.0	0.751885
inner SZ in inferolateral temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.868333
inferior olive, medial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.16381
HRT18	CCLE Cell Line Gene Mutation Profiles	1.0	null
ADIPOR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44085
DG(20:0/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Ribbon synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.714
intermediate stratum of p1Lim	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.29974
DG(18:4(6Z,9Z,12Z,15Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE135030_8_v_7_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
Monocytes	dbGAP Gene-Trait Associations	1.0	0.139771
DG(18:3(9Z,12Z,15Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
central nervous system	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.456828
DG(20:3n9/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
SG in primary somatosensory cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.22807
DG(22:4(7Z,10Z,13Z,16Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1n7/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
RBPMS	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.83885
DG(24:0/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PPIP5K1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.71387
FGFR1OP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84381
exocrine gland	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.092164
Brain Lower Grade Glioma_LGG_TCGA-HT-A5R7-01A-11R-A28M-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
r1 part of lateral pontine nuclei	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19988
ISHIKAWAHERAKLIO02ER	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(24:1(15Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CALR	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.90694
RABL3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.74282
synaptic transmission, glutamatergic	GO Biological Process Annotations 2023	1.0	null
Mosquito bite size	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.569897
DG(24:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
RKO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
placenta	HPA Tissue Protein Expression Profiles	1.0	0.801417
OSBP	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.43868
diacylglycerol binding	GO Molecular Function Annotations 2015	1.0	null
DG(18:3(6Z,9Z,12Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LPS853	DepMap CRISPR Gene Dependency	1.0	2.16376
DG(16:1(9Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
tissues, cell types and enzyme sources	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.317679
EP300	ChEA Transcription Factor Targets	1.0	null
NAP1L2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.04074
DG(14:0/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-W5WG-0008-SM-4KL25	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
FOXI1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	16.9136
abnormality of carbohydrate metabolism/homeostasis	GWASdb SNP-Phenotype Associations	1.0	0.190715
GTEX-R55C-0526-SM-3GIKA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(15:0/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-8107-01A-13R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(14:1n5/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
subthalamic nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.02753
DG(20:4(8Z,11Z,14Z,17Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-UTHO-3026-SM-3GAFB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45149
GTEX-RN64-1026-SM-48FDX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1(9Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WHSE-0011-R1A-SM-3P5ZK	GTEx Tissue Sample Gene Expression Profiles	1.0	0.905988
PC-3	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.896858
DG(24:1n9/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
Synaptic ribbon	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.023
Menarche (age at onset)	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.552288
DG(22:2(13Z,16Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE110178_1_v_6_tranylcypromine_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
DCP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.31563
DG(16:0/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DDX11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.36613
DG(20:4(5Z,8Z,11Z,14Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1(15Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hippocampus (hippocampal formation)_12 pcw_F_12835	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.938018
Primary somatosensory area, barrel field, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.1943
DG(20:0/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC9941047-41591_2022_2163_MOESM3_ESM.xlsx-ST12-Unnamed_1_KLF6	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-QLQ7-0008-SM-447AW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Taenia tecta, ventral part, layer 2	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.82712
DG(15:0/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-U8T8-0008-SM-4DXSP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:4(6Z,9Z,12Z,15Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
spinal cord	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.060371
NCIH2052	DepMap CRISPR Gene Dependency	1.0	4.07557
COLO-783	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-RUSQ-2026-SM-4GIAK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GRINA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52737
496100416_FWM_dementia_TBI_90-94_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.06496
NR4A1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	28.9217
abnormality of male internal genitalia	GWASdb SNP-Phenotype Associations	1.0	0.598959
DG(20:2(11Z,14Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-TSE9-0011-R7A-SM-3DB7P	GTEx Tissue Sample Gene Expression Profiles	1.0	0.829577
paraventricular nuclei, left of thalamus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.07987
DG(22:4(7Z,10Z,13Z,16Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
brain stem	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
anxiety disorder	GWASdb SNP-Disease Associations	1.0	0.317317
hsa-miR-217	TargetScan Predicted Conserved microRNA Targets	1.0	0.32519
DG(20:1n9/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
ECC12	CCLE Cell Line Gene Expression Profiles	-1.0	-1.47394
DG(22:1n9/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
nutrition disease	GWASdb SNP-Disease Associations	1.0	0.425585
GSE89018_11_v_14_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(18:2n6/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
OBI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.80368
ventral posterior medial nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.32846
ZNF75A	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	62.4204
superficial stratum of Hb	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.005
CL34	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-PWCY-1426-SM-48TCT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-QVJO-0011-R4A-SM-2S1QL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12331
arteriosclerotic cardiovascular disease	GWASdb SNP-Disease Associations	1.0	0.45197
OSC-20	COSMIC Cell Line Gene Mutation Profiles	1.0	null
OVTOKO	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.42627
DG(14:1n5/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
Lymphoid Neoplasm Diffuse Large B-cell Lymphoma_DLBC_TCGA-G8-6907-01A-11R-2213-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
membrane-bounded vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.161484
DG(14:1(9Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
HCC1599	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-P4PP-0008-SM-48TDV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-N7MT-1226-SM-2D7W4	GTEx Tissue Sample Gene Expression Profiles	1.0	1.43703
pontine nuclei, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.19306
ovary	HPA Tissue Protein Expression Profiles	-1.0	-3.14854
GABA receptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.212
JJN3	CCLE Cell Line Gene Expression Profiles	1.0	1.69585
FADS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.09092
Cingulate gyrus	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.093
Terminal bouton	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(20:3(5Z,8Z,11Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Plasma membrane region	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
GTEX-QDT8-0011-R7A-SM-32PKF	GTEx Tissue Sample Gene Expression Profiles	1.0	0.887779
GTEX-XGQ4-1326-SM-4GIDU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LC1SQ	DepMap CRISPR Gene Dependency	1.0	2.6971
DG(22:1n9/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
PMC11195603-jamapsychiatry-e241429-s002.xlsx-eT38_Protein_cis-instrument_MR-eTable_38_Cis-instrument_Mendelian_randomizaion_screen_of_1_901_cortical_proteins_on_lifetime_smoking_behavior_NR3C2	Rummagene Transcription Factor Associations 2026	1.0	null
H3K9me3_G1E_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
GSE153757,GSE153758_0_v_2_ftsj1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-WHSE-2926-SM-3NMBG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.41799
DG(16:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LU-65	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-QDVN-0008-SM-48U2D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-NPJ8-0011-R2a-SM-2TC6M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04325
G59	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.48251
vesicle-mediated transport	GO Biological Process Annotations 2015	1.0	null
TPBGL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.26607
DG(18:3n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
enhanced paired-pulse facilitation	MPO Gene-Phenotype Associations	1.0	null
ZSCAN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21747
Kidney renal papillary cell carcinoma_KIRP_TCGA-GL-A9DE-11A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
RUBCN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.17434
KBTBD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.94541
posteromedial visual area, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.56686
GPC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49058
RNF26	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.27562
LRP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.41948
WM88	CCLE Cell Line Gene Mutation Profiles	1.0	null
Sarcoma_SARC_TCGA-MO-A47P-01A-11R-A24X-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC11285331-cd-23-0539_table_s1_suppst1.xlsx-Lost_AR_Peaks-Unnamed_20_AR	Rummagene Transcription Factor Associations 2026	1.0	null
GSE188870,GSE188871_4_v_2_kat7_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
C11orf98	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.43586
DG(18:3(6Z,9Z,12Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1(13Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
IM95	DepMap CRISPR Gene Dependency	1.0	4.2317
TPP2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54361
DG(20:3n9/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
HCC2885	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.35274
AKT1_OE_GDS2308_508_mouse_heart	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
DG(15:0/0:0/20:0)	HMDB Metabolites of Enzymes	1.0	null
BT-549	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.2409
NCI-H441	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-XMK1-0226-SM-4B65D	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_13076_KO_Atmin_SRP062722	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
PET100	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.10244
DG(14:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
IRF1-19129219-H3396-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GSE135030_3_v_9_fludarabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-RWSA-1426-SM-47JXA	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
synapse part	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.237908
GTEX-SUCS-1426-SM-4DM5W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
LXF-289	COSMIC Cell Line Gene Mutation Profiles	1.0	null
BMI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.51158
LRRCC1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89738
respiratory system disease	GWASdb SNP-Disease Associations	1.0	0.319097
496100543_FWM_probable Alzheimer's disease_TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-4.06506
PTGR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03855
FOXP3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	14.9051
RCN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20589
PCNA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.42042
MDAMB436	CCLE Cell Line Gene Expression Profiles	-1.0	-1.59908
DG(20:2n6/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
BL5786 (WRAP53)	NURSA Protein Complexes	1.0	null
DG(20:1(11Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
MNT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.39309
DG(20:1n9/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
DERL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0726
DG(20:4(8Z,11Z,14Z,17Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC11058205-42003_2024_6202_MOESM5_ESM.xlsx-Data2c_CEBPA_ChIP-Unnamed_9_CEBPA	Rummagene Transcription Factor Associations 2026	1.0	null
DG(18:1n9/0:0/22:1n9)	HMDB Metabolites of Enzymes	1.0	null
GSE88819_7_v_9_tug1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LENG9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.37492
B3GNT9	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.79999
C2 domain	InterPro Predicted Protein Domain Annotations	1.0	null
GSE210101,GSE210114_0_v_3_urod_human	RummaGEO Gene Perturbation Signatures	1.0	null
NCI-H1651	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.23535
PMC9886955-41420_2023_1325_MOESM12_ESM.xlsx-H6_14AvsH6_NC-Unnamed_2_HMX1	Rummagene Transcription Factor Associations 2026	1.0	null
Synaptic membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.757
SNU5	CCLE Cell Line Gene Mutation Profiles	1.0	null
plasma membrane	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
secretion by cell	GO Biological Process Annotations 2015	1.0	null
GSE217115_3_v_0_alectinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
anterograde trans-synaptic signaling	GO Biological Process Annotations 2025	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-7745-11A-01R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
striatum_37 pcw_M_263195015	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.829994
r7 part of cochlear column	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.4461
Sarcoma_SARC_TCGA-DX-A3U9-01A-11R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
cytoplasm	GO Cellular Component Annotations 2015	1.0	null
DG(20:4n3/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
VZ in hypothalamic portion	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.970489
DG(14:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RAB21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.53997
GSE202310_1_v_0_ube3d_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
ZNF649	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.04479
PRDM12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.03948
DG(16:1n7/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-NL3H-0011-R11A-SM-2I3E6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.76828
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CACNB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86941
RERFLCAI	CCLE Cell Line Gene Mutation Profiles	1.0	null
NCI-H630	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:2n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
CPEB4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.32933
KANSL1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01482
FZD1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.56835
SLAIN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.69929
DG(20:1(11Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-POYW-1326-SM-48TCG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PMC8995879-Table_1.xlsx-exome_variants_MAF_0_01-Gencode_34_hugoSymbol_MAF	Rummagene Transcription Factor Associations 2026	1.0	null
WM115	CCLE Cell Line Gene Mutation Profiles	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-VS-A8EJ-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-OXRP-0926-SM-48TC1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE145476_2_v_3_hopx_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
CTV-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
ZNF443	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.61291
limitans nucleus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	2.03283
ATP2B1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.50634
GTEX-RTLS-0008-SM-48FET	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(16:1n7/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/20:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
alimentary canal	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.05249
AGAP5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.6201
RH18	CCLE Cell Line Gene CNV Profiles	-1.0	-1.43107
TSHZ2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.75582
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-EX-A3L1-01A-11R-A32Y-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(14:1(9Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE126463_5_v_2_pomalidomide_human	RummaGEO Drug Perturbation Signatures	1.0	null
r10 basal plate	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.4042
DG(20:4n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
HS746T	DepMap CRISPR Gene Dependency	1.0	5.17204
abnormal ekg	GWASdb SNP-Phenotype Associations	1.0	0.338885
Cognitive disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.731
brain	TISSUES Experimental Tissue Protein Expression Evidence Scores	1.0	0.766457
HSC2	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-RNOR-1226-SM-48FDQ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Fetal Kidney	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	-1.0	-1.20531
IGFLR1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.7619
DG(16:1(9Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Peripheral Nervous System Diseases	CTD Gene-Disease Associations	1.0	2.88009
HEBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08017
FDXACB1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.14479
DG(24:1n9/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Head and Neck squamous cell carcinoma_HNSC_TCGA-D6-A6EP-01A-11R-A31N-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Inferior olivary complex	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.10239
layer IIIb of caudal entorhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.04534
Foxl2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	19.454
inferior olivary complex, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.66945
Kidney renal papillary cell carcinoma_KIRP_TCGA-P4-A5ED-11A-11R-A28H-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE206270_2_v_0_lsm14b_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DDR1_knockdown_169_GSE39207	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-1.396
SOX11-22085726-ESNS-MOUSE	ChEA Transcription Factor Targets 2022	1.0	null
Zic3	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	28.0258
OVCA420	DepMap CRISPR Gene Dependency	1.0	2.53718
MON1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.24841
GTEX-V1D1-0226-SM-4JBHG	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DNASE2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.29043
PMC9590125-40478_2022_1453_MOESM3_ESM.xlsx-OLIG2_UNIQUE_DYS_GENES-OLIG2_TLE_vs_TL_log2FoldChange_1_padj_0_1_OLIG2	Rummagene Transcription Factor Associations 2026	1.0	null
GSE120612_7_v_5_etoposide_human	RummaGEO Drug Perturbation Signatures	1.0	null
COA4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.55386
OVK18	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(24:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PWO3-0011-R8A-SM-2I5GD	GTEx Tissue Sample Gene Expression Profiles	1.0	1.34966
DG(16:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
EBC1	DepMap CRISPR Gene Dependency	1.0	7.08699
WHRN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99069
GTEX-PSDG-0326-SM-48TCP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE211286_1_v_3_tcf12_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
KMS34	CCLE Cell Line Gene Mutation Profiles	1.0	null
NCIH146	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:3(8Z,11Z,14Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-PX3G-0008-SM-48U2L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-3689f	TargetScan Predicted Conserved microRNA Targets	1.0	0.199275
GTEX-OOBJ-1026-SM-3NB2L	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(14:1n5/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-338-5p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.809003
GTEX-P4PP-1026-SM-3NM9O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-S4Q7-0426-SM-3K2BJ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Genetic Predisposition to Disease	HuGE Navigator Gene-Phenotype Associations	1.0	null
DG(20:0/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
intergeniculate leaflet	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.49943
hsa-miR-3155b	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
GSE198165,GSE198166_7_v_3_zfp266_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
r10 part of gigantocellular reticular area	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.43933
posterior (caudal) superior temporal cortex (area 22c)_26 pcw_F_12949	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.30171
SCRT2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	20.1627
hematopoietic system disease	GWASdb SNP-Disease Associations	1.0	0.775167
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-A6DL-01A-21R-A30B-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Bronchoalveolar stem cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.703
HEC251	CCLE Cell Line Gene Mutation Profiles	1.0	null
CDA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55352
PATU8902	DepMap CRISPR Gene Dependency	1.0	3.19498
GSE127790_6_v_3_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-OHPN-0226-SM-48TBV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
facial motor nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.11205
Post-traumatic stress disorder	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.522185
DND-41	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-RM2N-1926-SM-48FCU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Perturb_5503_OE_Hras_SRP026484	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	17.0039
DMS153	CCLE Cell Line Gene Expression Profiles	-1.0	-2.14537
GSE147366_3_v_4_med13_human	RummaGEO Gene Perturbation Signatures	-1.0	null
IRF7	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.2405
Gut microbiota (bacterial taxa, hurdle binary method)	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.669897
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SP in perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.34745
Exocyst	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.062
Brain Lower Grade Glioma_LGG_TCGA-DU-7309-01A-11R-2090-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
ALYREF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.40898
hsa-miR-105	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
GTEX-SJXC-1226-SM-4DM78	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTPBP4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31355
Midbrain	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.324
SPEG	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.74728
DG(16:1(9Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Calcium-dependent secretion activator	InterPro Predicted Protein Domain Annotations	1.0	null
CFPAC-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.923619
DG(18:2n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE125862_2_v_1_dexamethasone_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-NL3G-0008-SM-4E3JX	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZSWIM8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.46811
DG(20:3(8Z,11Z,14Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Lateral terminal nucleus of the accessory optic tract	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.48026
GTEX-W5X1-0826-SM-3GILN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
periventricular stratum of PalSe	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.45793
DG(14:1(9Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Zic1::Zic2	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	28.5094
Lung squamous cell carcinoma_LUSC_TCGA-66-2753-01A-01R-0980-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-SNMC-0008-SM-4DM5A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Prefrontal cortex	TISSUES Experimental Tissue Protein Expression Evidence Scores 2025	1.0	1.339
LS-411N	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(22:1n9/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-V955-1826-SM-4JBIL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Sarcoma_SARC_TCGA-KD-A5QT-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TMEM221	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.31419
CAMA-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
RUSF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.62171
Entorhinal area, medial part, ventral zone, layer 3	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.09595
DG(24:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
GSE205163,GSE205164_2_v_0_znf808_human	RummaGEO Gene Perturbation Signatures	-1.0	null
E2F8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.97546
GSE119498_0_v_7_setd5_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(18:2n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
BL588 (RCHY1)	NURSA Protein Complexes	1.0	null
Brain disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.428
medial mammillary nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.996773
GSE178340_7_v_2_carfilzomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
BT-483	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(24:1(15Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2(13Z,16Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Tumor Progression	DisGeNET Gene-Phenotype Associations	1.0	null
DG(22:2(13Z,16Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XUW1-1726-SM-4BOOZ	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-O5YV-1026-SM-3LK72	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XBED-0226-SM-47JY8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
PECAPJ15	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
granule cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.691676
brain_3b	HPA Tissue Sample Gene Expression Profiles	1.0	1.0818
RL	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-T5JC-0005-SM-4DM7B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Kidney renal clear cell carcinoma_KIRC_TCGA-AK-3433-01A-02R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Rectum adenocarcinoma_READ_TCGA-EI-6508-01A-11R-1736-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(22:1n9/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
Parasubiculum, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.20806
Schizophrenia	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.244
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE126463_4_v_3_pomalidomide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
ATXN7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.3297
U266B1	CCLE Cell Line Gene CNV Profiles	1.0	1.4644
ZNF227	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21118
RAD23B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77434
JHUEM7	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-V955-1026-SM-4JBHO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:0/0:0/20:3n9)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE94814_2_v_3_reck_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(20:2(11Z,14Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SOX2-19829295-ESCS-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
DG(24:1(15Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1n5/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
Superior cervical ganglion	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.564
BABAM1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.96271
Brain Lower Grade Glioma_LGG_TCGA-TM-A7CF-01A-11R-A32Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE217115_2_v_4_alectinib_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
Huntington's Disease_CNS - Brain - Striatum (MMHCC)_GSE5786	GEO Signatures of Differentially Expressed Genes for Diseases	-1.0	-1.54675
GTEX-WHSE-3026-SM-3P5ZH	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12161
DG(20:4(5Z,8Z,11Z,14Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CA1 field, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.907232
NCIH2106	CCLE Cell Line Gene Mutation Profiles	1.0	null
SW684	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WFG7-0426-SM-4LMK5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ventral subnucleus of MG	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.74612
PMC10657376-41467_2023_43213_MOESM7_ESM.xlsx-DaNs_EBF1-Unnamed_6_EBF1	Rummagene Transcription Factor Associations 2026	1.0	null
Interstitial nucleus of Cajal	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.02345
SYF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.47305
plasma membrane part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.048545
DG(18:3(6Z,9Z,12Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
obesity	GWASdb SNP-Disease Associations	1.0	1.10764
GTEX-R55C-0005-SM-3GAE9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-QDVJ-0826-SM-48U1S	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
neuromuscular junction	GO Cellular Component Annotations 2023	1.0	null
increased circulating creatinine level	IMPC Knockout Mouse Phenotypes	1.0	null
GSE133087_1_v_2_metformin_human	RummaGEO Drug Perturbation Signatures	1.0	null
substance-related disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.056
GSE81803,GSE81912_0_v_1_fmr1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
CAPAN1	CCLE Cell Line Gene CNV Profiles	1.0	1.73374
mantle zone of r4Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.31149
GTEX-XOTO-3026-SM-4B65M	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12608
DG(22:4(7Z,10Z,13Z,16Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
496100596_FWM_dementia_TBI_89_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.69304
RNF20	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.63713
GSE94814_1_v_0_reck_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-XLM4-0008-SM-4AT4W	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
OSER1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.30401
DG(22:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H2126	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-T6MN-2526-SM-32PMN	GTEx Tissue Sample Gene Expression Profiles	1.0	1.17292
DG(20:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(6Z,9Z,12Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
HBA1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.54714
DG(20:0/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XBED-0003-SM-47JWP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE209533_0_v_1_disulfiram_human	RummaGEO Drug Perturbation Signatures	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-HC-7745-01A-11R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
heart conduction disease	GWASdb SNP-Disease Associations	1.0	0.959328
UMC-11	COSMIC Cell Line Gene Mutation Profiles	1.0	null
NCI-H446	COSMIC Cell Line Gene Mutation Profiles	1.0	null
POLR2C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45794
GTEX-S33H-1226-SM-4AD69	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:2(11Z,14Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-OIZI-1326-SM-3NB1B	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-NL4W-0011-R4a-SM-2I5GZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.08063
alcohol dependence	GWASdb SNP-Disease Associations	1.0	0.52866
Celiac Disease	HuGE Navigator Gene-Phenotype Associations	1.0	null
PMC8494348-pone.0257161.s002.xlsx-only_D20_-_OXT_NOT_ext-Gene_Name_NR4A2	Rummagene Transcription Factor Associations 2026	1.0	null
DG(14:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE126345_4_v_5_hcrt_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
SLU7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.10788
III, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	1.51521
FOXA2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.4023
GSE249714_0_v_1_anxa1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
KDM5B_H1-hESC_hg19_1	ENCODE Transcription Factor Binding Site Profiles	1.0	null
GSE152734,GSE152735_2_v_0_pbrm1_human	RummaGEO Gene Perturbation Signatures	1.0	null
NCI-H2135	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WFJO-0426-SM-4LVM7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
HCC1500	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.04004
GSE221004_3_v_0_prdm6_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Lacrimal gland acinar cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.532
GSE193999,GSE194000_4_v_0_atf3_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
JM1	CCLE Cell Line Gene CNV Profiles	-1.0	-1.34106
DG(20:4(5Z,8Z,11Z,14Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hippocampus (hippocampal formation)_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.4935
Dopaminergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.031
DG(24:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S7SF-0006-SM-3K2B6	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE176008_8_v_3_azacitidine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
tobacco use disorder	GAD Gene-Disease Associations	1.0	null
brain stem	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.070852
Neurotoxicity Syndromes	CTD Gene-Disease Associations	1.0	1.42321
Multiple synapse bouton	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.692
inferior colliculus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.847272
H3K9me3_erythroblast_mm9_3	ENCODE Histone Modification Site Profiles	1.0	null
OVMIU	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SKNFI	CCLE Cell Line Gene CNV Profiles	1.0	1.33583
DG(22:4(7Z,10Z,13Z,16Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RAJI	CCLE Cell Line Gene Mutation Profiles	1.0	null
PEAK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.0507
19286929-SuppTable2q	GeneSigDB Published Gene Signatures	1.0	null
GTEX-REY6-1226-SM-48FDR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cerebellar cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.991491
GSE244072_4_v_6_tfeb_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(22:4(7Z,10Z,13Z,16Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.331
FOXD4L4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.47183
DG(18:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X4XX-0011-R4B-SM-46MWL	GTEx Tissue Sample Gene Expression Profiles	1.0	0.893847
DG(16:1(9Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-REY6-2126-SM-48FD9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cerebellar cortex_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.49683
CSPG4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.83569
outer SZ in posteroinferior (ventral) parietal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.853535
synaptic vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.472011
DG(20:1(11Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-CS-6669-01A-11R-1896-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LAN-6	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-U4B1-0526-SM-4DXTK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:4(8Z,11Z,14Z,17Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE158632_3_v_4_oxyquinoline_human	RummaGEO Drug Perturbation Signatures	1.0	null
cerebellum	BioGPS Mouse Cell Type and Tissue Gene Expression Profiles	1.0	0.964139
MFE-319	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DNASE1L3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.57017
hsa-miR-4659b-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.099701
GSE175787_4_v_10_rhoc_human	RummaGEO Gene Perturbation Signatures	1.0	null
PMC7181746-41467_2020_15886_MOESM8_ESM.xlsx-Patient_8_CCF-Affected_Genes_PITX1	Rummagene Transcription Factor Associations 2026	1.0	null
GSE210580_0_v_1_rag2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Vesicle membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
smooth muscle	HPA Tissue Protein Expression Profiles	-1.0	-1.41433
Familial hemophagocytic lymphohistiocytosis 3	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.079
hippocampus (hippocampal formation)_12 pcw_F_12960	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.45646
Lymphocytes	dbGAP Gene-Trait Associations	1.0	0.119659
Huntington's Disease_CNS - Brain - Striatum (MMHCC)_GSE3583	GEO Signatures of Differentially Expressed Genes for Diseases	1.0	1.11521
LS-513	COSMIC Cell Line Gene Mutation Profiles	1.0	null
neuron part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.233459
vesicle	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.339639
GSE125219,GSE125221_3_v_0_arid1a_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-WVLH-0011-R10A-SM-3MJFM	GTEx Tissue Sample Gene Expression Profiles	1.0	1.18392
SLC7A10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.77075
Mural cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.951
WDR73	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.26411
GNB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.99301
GSE174522_1_v_0_spp1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
trastuzumab_homo sapiens_gpl570_gse15043	GEO Signatures of Differentially Expressed Genes for Small Molecules	-1.0	null
disease of cellular proliferation	GWASdb SNP-Disease Associations	1.0	0.120438
dorsolateral prefrontal cortex_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.00558
GTEX-PVOW-0011-R5A-SM-32PL7	GTEx Tissue Sample Gene Expression Profiles	1.0	0.921691
GTEX-XLM4-3026-SM-4AT6L	GTEx Tissue Sample Gene Expression Profiles	1.0	1.02586
DG(20:4(8Z,11Z,14Z,17Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
FOXD2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27199
BICR31	CCLE Cell Line Gene Expression Profiles	-1.0	-1.87539
DG(18:1(9Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Presynaptic active zone	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.922
GSE126345_11_v_5_hcrt_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(16:1(9Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
KPL-1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.50697
PMC8528285-pbio.3001085.s010.xlsx-Fig_S8E-GENE_LIST_UPLOADED_TO_ENRICHR_MNT_KO_3T3_ONLY_2084_GENES_MNT	Rummagene Transcription Factor Associations 2026	1.0	null
NLGN3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.34681
hsa-miR-3660	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
GTEX-TMMY-0126-SM-4DXTP	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
TAF5L	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.03037
DG(22:4n6/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
AKAP17A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64976
gallbladder_5b	HPA Tissue Sample Gene Expression Profiles	1.0	0.876346
hsa-miR-4659a-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.099701
NUDT11	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27309
GATA2	JASPAR Predicted Transcription Factor Targets	1.0	null
DG(18:2n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XUZC-0426-SM-4BOPE	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Primary somatosensory area, nose	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.25821
Pheochromocytoma and Paraganglioma_PCPG_TCGA-RM-A68W-01A-11R-A35K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
sublayer 6a of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.32913
SF268	DepMap CRISPR Gene Dependency	1.0	2.57077
MCF10F	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	-1.0	-1.36636
TMEFF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5636
Human - Motor Cortex - Cross-Species Cluster - Lamp5+ GABAergic neuron_1	HuBMAP Azimuth Cell Type Annotations	1.0	null
hsa-miR-1260b	TargetScan Predicted Conserved microRNA Targets	1.0	1.11641
Lef1	JASPAR Predicted Mouse Transcription Factor Targets 2025	1.0	28.9593
SW962	COSMIC Cell Line Gene Mutation Profiles	1.0	null
A2780	CCLE Cell Line Gene Mutation Profiles	1.0	null
EMC8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.6493
layer 5 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.48605
PATU8988T	CCLE Cell Line Gene CNV Profiles	-1.0	-1.54497
Hippocampal cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.586
orbital frontal cortex_17 pcw_F_12880	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.21493
DG(16:0/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RCH-ACV	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1n9/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-P5-A5EY-01A-11R-A27Q-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-PSDG-0008-SM-48TE5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
globus pallidus, internal segment, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.74142
NB6	DepMap CRISPR Gene Dependency	1.0	2.8154
Brain Lower Grade Glioma_LGG_TCGA-HT-7610-01A-21R-2090-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PMC8766486-42003_2021_2990_MOESM3_ESM.xlsx-ST18-Supplementary_Data_18_Gene_burden_for_deletions_by_subtype_ST18	Rummagene Transcription Factor Associations 2026	1.0	null
DPYSL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.61494
GSE178907_5_v_3_fkrp_human	RummaGEO Gene Perturbation Signatures	1.0	null
Liver hepatocellular carcinoma_LIHC_TCGA-G3-A7M9-01A-23R-A352-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
COLO-792	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-Q2AG-0011-R7A-SM-2HMJP	GTEx Tissue Sample Gene Expression Profiles	1.0	0.923978
SPSB2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07183
GSE93674_2_v_3_ezh2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
cardiovascular diseases	GAD Gene-Disease Associations	1.0	null
Age At Menarche	DisGeNET Gene-Phenotype Associations	1.0	null
Spautin-1	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.55
SEC24A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87207
GTEX-PWCY-0226-SM-48TD8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:1(11Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NFRKB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44868
intermediate stratum of m2Lim	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.47761
Monogenic disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.072
GTEX-T2IS-2226-SM-4DM65	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SW948	CCLE Cell Line Gene Expression Profiles	-1.0	-1.53418
DG(18:3(6Z,9Z,12Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
LY2584702	DeepCoverMOA Drug Mechanisms of Action	-1.0	-0.55
Membrane stack	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.104
Neuromuscular junction	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.631
AFAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80874
doxorubicin_homo sapiens_gpl570_gse46493	GEO Signatures of Differentially Expressed Genes for Small Molecules	1.0	null
GSE104508_0_v_3_dnmt3a_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
HAL-01	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-SUCS-0526-SM-4DM56	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(15:0/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
Glutamatergic synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.712
DG(20:1(11Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
MAFG::NFE2L1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	22.0229
MDS - Myelodysplastic syndrome_Bone marrow stem cell_GSE4619	GEO Signatures of Differentially Expressed Genes for Diseases	1.0	1.81089
GTEX-WHSB-0326-SM-3LK6K	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-W5WG-1126-SM-4LMK4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Skin Cutaneous Melanoma_SKCM_TCGA-EE-A2GP-06A-11R-A18S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Alkaline Phosphatase	dbGAP Gene-Trait Associations	1.0	0.50084
DG(18:4n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
PMC8528285-pbio.3001085.s010.xlsx-Fig_S8C-GENE_LIST_UPLOADED_TO_ENRICHR_MAX_KO_3T3_DE_NOVO_69_GENES_MAX	Rummagene Transcription Factor Associations 2026	1.0	null
GTEX-WFON-1426-SM-4LVMT	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SW480	CCLE Cell Line Gene Mutation Profiles	1.0	null
JAK2_knockout_79_GSE26188	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-1.72887
DG(20:1n9/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
periventricular stratum of r7Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.38081
MRK-NU-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:3(6Z,9Z,12Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
CRK	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.05471
Skeletal Muscle Female	Roadmap Epigenomics Cell and Tissue DNA Methylation Profiles	1.0	1.00305
presynapse	SynGO Synaptic Gene Annotations	1.0	null
eye and adnexa disease	GWASdb SNP-Disease Associations	1.0	0.131755
DG(18:2(9Z,12Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-DU-A7TG-01A-21R-A34R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Autism spectrum disorder	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.326
Cytoplasmic vesicle membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
Cytoplasmic region	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(20:3(8Z,11Z,14Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
layer 1 of OCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.22032
TCF3/E2A-22897851-JUKARTE6-1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-TMMY-1326-SM-4DXU9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3(6Z,9Z,12Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(9Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-8019-01A-21R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
NDRG4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.03107
GSE89018_10_v_8_cry2_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-WHSE-0011-R7A-SM-3P5YZ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.01526
DG(24:0/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
KHM-1B	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.846866
DG(15:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
striatum_16 pcw_M_12287	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.8404
Axon terminus	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
DG(22:2(13Z,16Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PACS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.06337
GTEX-T5JC-0011-R1A-SM-32PM6	GTEx Tissue Sample Gene Expression Profiles	1.0	1.07406
DG(14:0/0:0/14:0)	HMDB Metabolites of Enzymes	1.0	null
r2 part of median raphe nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.45657
KYSE510	CCLE Cell Line Gene Mutation Profiles	1.0	null
hsa-miR-4762-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.13535
TBX3-20139965-MESC-MOUSE	ChEA Transcription Factor Binding Site Profiles	1.0	null
DG(22:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1n7/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
SNU349	CCLE Cell Line Gene Mutation Profiles	1.0	null
SP in midinferior temporal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.964877
DG(15:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TRIP10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.84277
FOXA1	ENCODE Transcription Factor Targets	1.0	null
GTEX-R55E-0011-R1A-SM-2TC6N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.34707
R2TP complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.824
PELI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.72011
DG(20:2n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	InterPro Predicted Protein Domain Annotations	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-7470-01A-12R-2090-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Oral squamous cell carcinoma cell line	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.158
GSE195568_2_v_0_palbociclib_human	RummaGEO Drug Perturbation Signatures	1.0	null
Sarcoma_SARC_TCGA-DX-A48L-01A-11R-A30C-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GLO1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89491
ZNF324B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38162
primary somatosensory cortex (area S1, areas 3,1,2)_10 mos_M_12977	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.853316
hypertension	GWASdb SNP-Phenotype Associations	1.0	0.779456
Perturb_13091_KO_Atmin_SRP062722	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
GSE210580_4_v_1_rag2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
suboptic nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.07732
superficial stratum of PcPV	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.3956
DG(18:2n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
SCC-9 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.032
THTPA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.6788
PMC12186250-NIHMS2085662-supplement-3.xlsx-4111_TEAD4_peaks-Gene_Name_TEAD4	Rummagene Transcription Factor Associations 2026	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
subthalamic nucleus, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.50981
DG(14:0/0:0/14:1n5)	HMDB Metabolites of Enzymes	1.0	null
BLZ-945	DeepCoverMOA Drug Mechanisms of Action	1.0	0.45
TLE1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.38978
Tuberomammillary nucleus, ventral part	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.0124
PMC6137307-mmc2.xlsx-IRF9-IFNa-Table_S1_IRF9-IFNa_Related_to_Figure_1_IRF9	Rummagene Transcription Factor Associations 2026	1.0	null
HUH7	CCLE Cell Line Gene CNV Profiles	-1.0	-1.42918
Alcohol dependence	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.004
UROD	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.77299
CASTOR2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01382
DG(20:3(5Z,8Z,11Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PA-TU-8988T	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.897795
GTEX-NPJ7-0011-R4a-SM-2I3GJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.57509
DG(22:4(7Z,10Z,13Z,16Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Nerve Degeneration	CTD Gene-Disease Associations	1.0	1.14336
GTEX-UPIC-0005-SM-3GACV	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
ZNF391	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.33456
GTEX-T6MO-0726-SM-4DM58	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DYRK1B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.67181
corpus callosum	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.7706
ZNF578	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.01317
ZNF677	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	29.0519
UBN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66564
DG(20:3(8Z,11Z,14Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Prostate adenocarcinoma_PRAD_TCGA-CH-5743-01A-21R-1580-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GSE129241_3_v_0_valproic acid_human	RummaGEO Drug Perturbation Signatures	-1.0	null
macular degeneration	GWASdb SNP-Phenotype Associations	1.0	0.762459
Kidney renal clear cell carcinoma_KIRC_TCGA-CZ-5989-11A-01R-1672-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-XQ3S-1726-SM-4BOOD	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hippocampus (hippocampal formation)_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.886489
DG(18:1(9Z)/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2(11Z,14Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
496100277_FWM_no dementia_no TBI_90-94_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.55133
DG(20:5(5Z,8Z,11Z,14Z,17Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.886654
DG(20:4(8Z,11Z,14Z,17Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE210580_0_v_12_rag2_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(18:1n7/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
KMS-28PE	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene Mutation Profiles	1.0	null
RBBP6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.77478
PRPS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.82946
FOXP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.90057
HOP-62	COSMIC Cell Line Gene Mutation Profiles	1.0	null
FAM104B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93448
MOLT-4	COSMIC Cell Line Gene Mutation Profiles	1.0	null
HCC-366	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3(8Z,11Z,14Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
KP1N	DepMap CRISPR Gene Dependency	1.0	4.95728
GSE109285_3_v_2_glucagon_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-OOBJ-0926-SM-48TDO	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
EN2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.81174
DG(20:3(8Z,11Z,14Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PDK1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48878
pineal_night	BioGPS Human Cell Type and Tissue Gene Expression Profiles	-1.0	-0.917431
inferolateral temporal cortex (area TEv, area 20)_4 mos_M_12889	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.18811
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-XAJ8-0626-SM-47JY4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
SKCO1	CCLE Cell Line Gene Mutation Profiles	1.0	null
GSE114992,GSE114993_4_v_2_irf5_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
YSCCC	DepMap CRISPR Gene Dependency	1.0	2.49125
PMC7997806-41397_2020_194_MOESM2_ESM.xlsx-MAGMA_GENE_SBP_AA-SYMBOL_TEAD1	Rummagene Transcription Factor Associations 2026	1.0	null
Axon terminus	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.842
ZNF710	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.7631
DG(18:0/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNU81	DepMap CRISPR Gene Dependency	1.0	4.69266
GTEX-N7MT-0011-R4a-SM-2I3G9	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10077
LP1	CCLE Cell Line Gene Expression Profiles	1.0	1.37254
DG(18:2n6/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
cell periphery	COMPARTMENTS Curated Protein Localization Evidence Scores	1.0	0.098109
DG(18:0/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE207863_0_v_1_hdac5_human	RummaGEO Gene Perturbation Signatures	1.0	null
MC116	CCLE Cell Line Gene Expression Profiles	1.0	1.78854
DG(18:3(9Z,12Z,15Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2n6/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
GSE114013,GSE114014_0_v_4_itraconazole_human	RummaGEO Drug Perturbation Signatures	1.0	null
Prelimbic area, layer 1	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.71727
Lateral posterior nucleus	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.895
RARB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.25133
bone marrow	HPA Tissue Gene Expression Profiles	-1.0	-1.0624
HT-144	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(14:1(9Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
vascular disease	GWASdb SNP-Disease Associations	1.0	0.156084
NOMO2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.41362
MDAMB435S	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-RTLS-1326-SM-46MUN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
RL952	CCLE Cell Line Gene Mutation Profiles	1.0	null
BDCM	CCLE Cell Line Gene Expression Profiles	1.0	1.49273
alveolus	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.240216
PACADD165	DepMap CRISPR Gene Dependency	1.0	2.14188
medial part of r10B	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.96347
DG(20:3n6/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
EFCAB6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.00577
Head and Neck squamous cell carcinoma_HNSC_TCGA-BA-4074-01A-01R-1436-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
DG(20:3n6/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1n7/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
Synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	2.228
SZ in posterior parahippocampal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.54248
TRAF6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.32787
HCC2998	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-XUZC-0926-SM-4BOQF	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:2(13Z,16Z)/16:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
ventricular (matrix) zone of pons	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-2.16427
SNU245	CCLE Cell Line Gene Mutation Profiles	1.0	null
Perturb_15538_KO_Setd2/Ezh2_SRP220248	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
GTEX-TSE9-0011-R9A-SM-3DB7Q	GTEx Tissue Sample Gene Expression Profiles	1.0	0.829861
Head and Neck squamous cell carcinoma_HNSC_TCGA-CV-6960-11A-01R-2016-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
localization	GO Biological Process Annotations 2015	1.0	null
MZT2A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.38439
GTEX-QCQG-0626-SM-48U21	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE218580_1_v_5_fentanyl_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
rhombomere 11	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.80398
granular layer of rostral dentate gyrus	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.37655
Brain Lower Grade Glioma_LGG_TCGA-HT-8113-01A-11R-2404-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
dorsal part of JcP	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.11391
GTEX-R55E-2526-SM-2TC6H	GTEx Tissue Sample Gene Expression Profiles	1.0	1.10434
Kidney Chromophobe_KICH_TCGA-KL-8325-01A-11R-2315-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
GTEX-RWS6-0726-SM-47JXI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
EB2	CCLE Cell Line Gene Expression Profiles	1.0	1.39141
PDE6G	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.08147
hsa-miR-520d-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.103424
GTEX-R55E-0006-SM-2TC5G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
MDAMB157	Heiser et al., PNAS, 2011 Cell Line Gene Expression Profiles	1.0	1.62645
GTEX-P4QT-2426-SM-3NMCL	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:3(5Z,8Z,11Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2(11Z,14Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PAXBP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.3085
GTEX-TSE9-2526-SM-4DXUS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE189859,GSE189861_1_v_2_idh1_human	RummaGEO Gene Perturbation Signatures	-1.0	null
Disease of mental health	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.769
DG(20:2n6/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
GTEX-S7SE-0011-R2A-SM-2XCDC	GTEx Tissue Sample Gene Expression Profiles	1.0	0.960481
E2F3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.4228
COLO-818	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.48169
Gustatory areas, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.01157
Nervous system disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.483
testis_7f	HPA Tissue Sample Gene Expression Profiles	1.0	1.31402
periventricular stratum of r3Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19669
SNU81	CCLE Cell Line Gene Mutation Profiles	1.0	null
GSE228430_1_v_3_fabp5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-S7PM-0008-SM-3NM9Q	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2n6/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
Presynaptic membrane	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.921
neuroblast	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.114531
Primary somatosensory area, nose, layer 6a	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.22251
CBLL2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.55711
PMC7339600__F5	PFOCR Pathway Figure Associations 2023	1.0	null
posterior (caudal) superior temporal cortex (area 22c)_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.916749
occipital neocortex_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-0.941871
HCT-15	COSMIC Cell Line Gene Mutation Profiles	1.0	null
SW620	CCLE Cell Line Gene Mutation Profiles	1.0	null
monocytes	GAD Gene-Disease Associations	1.0	null
Severe insulin-resistant type 2 diabetes	GWAS Catalog SNP-Phenotype Associations 2025	1.0	0.539794
GTEX-Q2AH-0008-SM-48U2J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of the immune system	GWASdb SNP-Phenotype Associations	1.0	0.186582
GTEX-RU72-2926-SM-2TF66	GTEx Tissue Sample Gene Expression Profiles	1.0	1.50204
DG(18:1(11Z)/20:5(5Z,8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MAK16	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52089
INTS2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.66669
SG in dorsomedial parietal cortex (area 7m)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.01334
Perturb_4473_KO_Prdm12_SRP304476	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.56022
DG(18:1(11Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Agranular insular area, ventral part, layer 5	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.01157
medial subhabenular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.34031
PANC0813	CCLE Cell Line Gene Mutation Profiles	1.0	null
hindbrain	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
intestine	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.055762
SNU175	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(16:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Crus II, left, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.852518
axon	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.177439
DG(18:3(6Z,9Z,12Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE202284,GSE202289_3_v_4_bmal1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
gastrointestinal tract	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.053795
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
MMP23B	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.66683
MAP2K1_knockdown_134_GSE31534	GEO Signatures of Differentially Expressed Genes for Kinase Perturbations	-1.0	-1.56656
GSE196540,GSE196542_4_v_3_dnmt3a_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
IM95	CCLE Cell Line Gene Mutation Profiles	1.0	null
Amyotrophic lateral sclerosis	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.365
COLO 741	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.31733
synapse part	GO Cellular Component Annotations 2015	1.0	null
GTEX-P78B-1326-SM-3P611	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
Oral cavity cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.687
DG(18:1n9/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
r10 portion of the hypoglossal motor nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.48091
PSMF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27159
GSE127790_4_v_3_zcchc8_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Myotonia congenita	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.099
DG(22:4(7Z,10Z,13Z,16Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-W5X1-2826-SM-3GILM	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
H3K9me3_erythroblast_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
DG(20:2(11Z,14Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DMS 79	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.30382
GSE122509,GSE122513_2_v_0_ibrutinib_human	RummaGEO Drug Perturbation Signatures	1.0	null
hsa-miR-4291	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
GSE128634,GSE128636_2_v_0_foxo1_human	RummaGEO Gene Perturbation Signatures	1.0	null
ZNF707	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.8799
POU4F1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	42.2044
MEC1	CCLE Cell Line Gene Expression Profiles	1.0	1.44189
GTEX-S3XE-0008-SM-3NM8O	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
cerebellum	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.092984
PTOV1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36958
abnormality of nervous system morphology	GWASdb SNP-Phenotype Associations	1.0	0.128533
FRAT1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.64051
tauopathy	GWASdb SNP-Disease Associations	1.0	1.10764
C5orf15	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12092
WASHC4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93155
GTEX-X261-0011-R11A-SM-4E3JY	GTEx Tissue Sample Gene Expression Profiles	1.0	1.54371
C32TG	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.923619
GSE144481,GSE144483_0_v_1_runx1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GTEX-WVLH-0011-R2A-SM-3MJFJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.25745
syntaxin-1 binding	GO Molecular Function Annotations 2023	1.0	null
GTEX-X585-0011-R8A-SM-46MUX	GTEx Tissue Sample Gene Expression Profiles	1.0	1.12963
KMS21BM	CCLE Cell Line Gene CNV Profiles	1.0	1.6645
DG(20:4(8Z,11Z,14Z,17Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2(13Z,16Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE178340_1_v_2_carfilzomib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-XGQ4-0126-SM-4AT4H	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
urinary system disease	GWASdb SNP-Disease Associations	1.0	0.309003
retinal degeneration	GWASdb SNP-Disease Associations	1.0	0.347293
SP in midlateral extrastriate cortex (area 19)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	1.10432
DG(22:1n9/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/16:1n7)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
lymphocytes	GAD Gene-Disease Associations	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
layer 4 of InsCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.25014
KMS26	CCLE Cell Line Gene Expression Profiles	1.0	1.94493
A3-KAW	COSMIC Cell Line Gene Mutation Profiles	1.0	null
TP53	ChEA Transcription Factor Targets	1.0	null
KCTD19	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.10601
DG(18:2(9Z,12Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-203	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
PMC8185471-mmc7.xlsx-DEGs-SOX15_peaks-Day_6_SOX15-_-_upregulated_and_downregulated_genes_nearby_SOX15_CUT_Tag_top_10k_peaks_Related_to_Figure6_SOX15	Rummagene Transcription Factor Associations 2026	1.0	null
MYC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.97165
H3K9me3_megakaryocyte_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
DG(20:3(5Z,8Z,11Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
HCA-7	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.897
CEP72	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05569
DG(18:1(9Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE166004_3_v_2_pld1_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
GSE129287_0_v_1_cd200_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
MRPL20	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.8438
GSE151412_2_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	1.0	null
LGMN	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55346
GSE227592_8_v_1_adar_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:3(5Z,8Z,11Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3(5Z,8Z,11Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-548d-3p	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.880544
DG(20:2(11Z,14Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE210383_0_v_1_trim71_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-R55E-0011-R11A-SM-2TC6I	GTEx Tissue Sample Gene Expression Profiles	1.0	1.83904
CA4 field, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	2.0517
DG(20:0/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1n5/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
Bladder Urothelial Carcinoma_BLCA_TCGA-FT-A3EE-01A-11R-A206-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_12906_KO_IKZF1_SRP139731	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	-20.0
DG(18:4(6Z,9Z,12Z,15Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:2(9Z,12Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
OUMS-23	COSMIC Cell Line Gene Mutation Profiles	1.0	null
Developmental disorder of mental health	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.369
lateral ganglionic eminence_9 pcw_M_12833	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.04211
RT4	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.09669
DG(14:1(9Z)/22:4(7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5n3/0:0/22:6n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X88G-0006-SM-47JX5	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Parallel fiber	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.959
GTEX-X88G-0008-SM-47JWN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE134693_0_v_1_msr1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
p1 part of the substantia nigra reticulata	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.21003
parabigeminal nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.72252
DG(20:3(8Z,11Z,14Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Brain Lower Grade Glioma_LGG_TCGA-HT-A616-01A-11R-A29R-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
PE/CA-PJ15	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GSE221539_1_v_0_lrrc10_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
posteroventral (inferior) parietal cortex_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	0.826522
TMP269	DeepCoverMOA Drug Mechanisms of Action	1.0	0.34
GSE161170,GSE161268_1_v_3_med1_human	RummaGEO Gene Perturbation Signatures	1.0	null
SC5D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44441
GTEX-X88G-0226-SM-4GIE4	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:0/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
CENPU	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.05935
cingulum bundle, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.09992
ACCS	CCLE Cell Line Gene Mutation Profiles	1.0	null
PMC8302638-41467_2021_24677_MOESM4_ESM.xlsx-S1_LMS_SNV-Supplementary_Data_1_Most_Recurrent_Non-Synonymous_Point_Mutations_in_LMS_TP63	Rummagene Transcription Factor Associations 2026	1.0	null
TTYH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.82137
end stage renal failure	GWASdb SNP-Disease Associations	1.0	0.58076
ZXDA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.34383
DG(20:0/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
NSMAF	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.70665
hsa-miR-4642	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.20993
MTMR12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75577
metencephalon	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.089855
MAN2C1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.49433
KCL22	CCLE Cell Line Gene Mutation Profiles	1.0	null
HN	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.897795
neuropil	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.50275
CIC	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.75025
PMC6944231__F5	PFOCR Pathway Figure Associations 2024	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1n9/0:0/20:5n3)	HMDB Metabolites of Enzymes	1.0	null
ATPAF2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.22595
intermediate stratum of JcPD	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.11316
lateral hemisphere of cerebellum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.861206
DG(14:1n5/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
GSE128099,GSE128159_3_v_2_gemcitabine_human	RummaGEO Drug Perturbation Signatures	1.0	null
GTEX-QMR6-0011-R4A-SM-32PKU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.20969
cytoplasm	LOCATE Predicted Protein Localization Annotations	1.0	null
DG(24:1(15Z)/18:3(9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2(13Z,16Z)/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3n3/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
C7orf50	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.54262
DG(18:1(9Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-P44H-2426-SM-2XCEJ	GTEx Tissue Sample Gene Expression Profiles	1.0	1.63976
TRIM52	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.00067
GSE133764_1_v_0_chd2_human	RummaGEO Gene Perturbation Signatures	1.0	null
GTEX-WHSE-0011-R6A-SM-3P5ZP	GTEx Tissue Sample Gene Expression Profiles	1.0	0.967491
DG(18:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-216a	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.7397
AGS	COSMIC Cell Line Gene Mutation Profiles	1.0	null
BCL6-25482012-CML-JURL-MK1-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
abnormality of the eye	GWASdb SNP-Phenotype Associations	1.0	0.157052
GSE123689_1_v_0_cbx8_human	RummaGEO Gene Perturbation Signatures	-1.0	null
VIM	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20435
diabetes mellitus	GWASdb SNP-Disease Associations	1.0	0.376937
ABHD8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.90799
REST_PFSK-1_hg19_3	ENCODE Transcription Factor Binding Site Profiles	1.0	null
DG(15:0/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
Head and neck carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.264
DG(14:0/0:0/24:0)	HMDB Metabolites of Enzymes	1.0	null
MEWO	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:1(9Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_328_KD_GDF15_SRP201220	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	1.64217
GTEX-QCQG-0008-SM-48U2G	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE210101,GSE210114_1_v_3_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
PMC6335596-mmc2.xlsx-RNA-seq_Day_3_GATA6_Het-Genes_significantly_differentially_expressed_between_H9_and_GATA6_4ins_at_day_3_in_RNA-seq_GATA6	Rummagene Transcription Factor Associations 2026	1.0	null
DG(18:3(6Z,9Z,12Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-WXYG-0005-SM-3NB3M	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Brain Lower Grade Glioma_LGG_TCGA-HT-7607-01A-11R-2090-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
SULT2A1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87832
GSE173201_2_v_3_cisplatin_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-TSE9-0011-R11A-SM-3DB7N	GTEx Tissue Sample Gene Expression Profiles	1.0	1.62782
GTEX-T5JC-2426-SM-3NMDB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.04199
GTEX-NFK9-0006-SM-3GACS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:2(13Z,16Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SPP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.48728
Crus I, left, lateral hemisphere	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	0.86075
HCT-116	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(20:3(8Z,11Z,14Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hematological neoplasm	GWASdb SNP-Phenotype Associations	1.0	0.173709
C5orf24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.4347
GSE158632_2_v_0_oxyquinoline_human	RummaGEO Drug Perturbation Signatures	-1.0	null
prostate neoplasm	GWASdb SNP-Phenotype Associations	1.0	0.598959
Prostate adenocarcinoma_PRAD_TCGA-HC-7737-11A-02R-2118-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
parkinson's disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
GTEX-WZTO-0011-R6B-SM-4E3J6	GTEx Tissue Sample Gene Expression Profiles	1.0	0.838664
lower respiratory tract disease	GWASdb SNP-Disease Associations	1.0	0.343126
GSE101112_0_v_4_j147_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
hsa-miR-548z	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
RCC2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.87317
Pheochromocytoma and Paraganglioma_PCPG_TCGA-WB-A818-01A-11R-A35L-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_13741_KO_Nfia_SRP096738	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	2.32034
periventricular stratum of r5Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.21267
GTEX-WFJO-0626-SM-4LVMC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
abnormality of cells of the monocyte/macrophage lineage	GWASdb SNP-Phenotype Associations	1.0	0.3866
ZNF862	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.118
GTEX-QCQG-0426-SM-48U29	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Acute Myeloid Leukemia_LAML_TCGA-AB-3008-03A-01T-0736-13	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
TPRX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.42388
DG(15:0/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:1(13Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Human - Motor Cortex - Cluster - SST+ KLHL1+ Layer 5-6 GABAergic neuron	HuBMAP Azimuth Cell Type Annotations	1.0	null
testis_7d	HPA Tissue Sample Gene Expression Profiles	1.0	1.3346
molecular layer of caudal subiculum	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.916939
NCIH1623	CCLE Cell Line Gene CNV Profiles	1.0	1.91933
SMIM13	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12479
GSE126345_2_v_5_hcrt_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
RNASEH2C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.37473
SNX2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.27103
DG(18:2(9Z,12Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
abnormality of body height	GWASdb SNP-Phenotype Associations	1.0	0.809986
PITX2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.432
GSE158458_2_v_1_sorafenib_human	RummaGEO Drug Perturbation Signatures	-1.0	null
hsa-miR-3182	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
dorsal thalamus_8 pcw_M_13058	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	-1.0	-1.79382
GTEX-T5JC-0011-R11A-SM-32PMB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.6607
GTEX-TKQ2-0006-SM-33HBH	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE169205_3_v_5_sirt5_human	RummaGEO Gene Perturbation Signatures	-1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
progressive supranuclear palsy	GWASdb SNP-Disease Associations	1.0	0.636995
COR-L88	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.3048
Cerebellum	TISSUES Curated Tissue Protein Expression Evidence Scores 2025	1.0	4.0
medial nucleus of pulvinar	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.91852
RTL8A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.12712
DG(20:1(11Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-R55G-1026-SM-48FDI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-WEY5-1026-SM-4LMK9	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
lateral part of the lateral habenular nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.00643
hsa-miR-3689b	TargetScan Predicted Conserved microRNA Targets	1.0	0.241055
Alkaline Phosphatase Measurement	DisGeNET Gene-Phenotype Associations	1.0	null
cerebellar cortex_3 yrs_F_12836	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.00324
496100608_FWM_no dementia_no TBI_78_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.41114
AIDA	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.44125
PANC0327	CCLE Cell Line Gene Expression Profiles	-1.0	-2.05585
CERS5	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.20788
DG(22:4(7Z,10Z,13Z,16Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-UTHO-0011-R4A-SM-3GIJP	GTEx Tissue Sample Gene Expression Profiles	1.0	1.33464
GTEX-XXEK-0008-SM-4BRW7	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/18:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1n9/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
ventral pallidum	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.27377
MBTPS1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.45213
MYBL2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	25.3962
outer SZ in posterior parahippocampal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.834083
synapse part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.490539
DG(20:5(5Z,8Z,11Z,14Z,17Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
abnormality of the menstrual cycle	GWASdb SNP-Phenotype Associations	1.0	0.969142
Adrenocortical carcinoma_ACC_TCGA-OR-A5LR-01A-11R-A29S-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
G protein-coupled GABA receptor complex	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.094
RUNX3	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	17.5087
GTEX-R55E-1326-SM-48FCR	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:2n6/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
DG(14:1(9Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SNU-C1	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.2409
DG(22:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
parasubicular cortex (parasubiculum)	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-1.93103
DG(15:0/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
SCAPER	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.34021
DG(22:5(4Z,7Z,10Z,13Z,16Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:1n9/0:0/22:5n3)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/18:1n9)	HMDB Metabolites of Enzymes	1.0	null
TM31	CCLE Cell Line Gene CNV Profiles	1.0	1.35522
DG(14:1n5/0:0/18:3n6)	HMDB Metabolites of Enzymes	1.0	null
DG(18:4n3/0:0/18:4n3)	HMDB Metabolites of Enzymes	1.0	null
Weight Loss	CTD Gene-Disease Associations	1.0	1.09332
EFR3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.53318
GTEX-S7SE-2526-SM-2XCDL	GTEx Tissue Sample Gene Expression Profiles	1.0	1.39957
reproductive organ cancer	GWASdb SNP-Disease Associations	1.0	0.221393
Photoreceptor ribbon synapse	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	1.631
DG(14:0/0:0/22:5n6)	HMDB Metabolites of Enzymes	1.0	null
496100554_FWM_no dementia_no TBI_78_F	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-3.51368
LRP12	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.55914
connective tissue disease	GWASdb SNP-Disease Associations	1.0	0.131584
Amacrine cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.894
GSE210101,GSE210114_1_v_10_urod_human	RummaGEO Gene Perturbation Signatures	-1.0	null
NCIH2126	CCLE Cell Line Gene Mutation Profiles	1.0	null
H3K4me1_cortical plate_mm9_1	ENCODE Histone Modification Site Profiles	1.0	null
Motor neuron disease	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.435
DG(22:0/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
GSE63048_11_v_8_morc1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
DG(18:1(11Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
hsa-miR-526a	TargetScan Predicted Conserved microRNA Targets	1.0	0.159923
bmmc cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.517678
DG(16:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(15:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:3(9Z,12Z,15Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
BACH2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.6649
DG(20:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SPRY2	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52003
FEM1C	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.21318
Primary somatosensory area, mouth, layer 6b	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.71227
cell part	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.045661
DG(16:0/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
DG(22:2(13Z,16Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:3n6/0:0/20:3n6)	HMDB Metabolites of Enzymes	1.0	null
H3K4me1_heart_mm9_2	ENCODE Histone Modification Site Profiles	1.0	null
DG(22:1n9/0:0/18:2n6)	HMDB Metabolites of Enzymes	1.0	null
central nervous system disease	GWASdb SNP-Disease Associations	1.0	0.32635
GTEX-NL3H-0011-R2a-SM-2I3GG	GTEx Tissue Sample Gene Expression Profiles	1.0	1.06675
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-C5-A8YT-01A-11R-A37O-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
mantle zone of r6Co	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.44453
GTEX-QVUS-0008-SM-447AY	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(20:1(11Z)/20:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
inferolateral temporal cortex (area TEv, area 20)_40 yrs_F_12304	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.18163
Kidney renal papillary cell carcinoma_KIRP_TCGA-F9-A7Q0-01A-11R-A36F-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Distal dendrite	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.718
DG(14:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n7/0:0/20:2n6)	HMDB Metabolites of Enzymes	1.0	null
Kidney Diseases	CTD Gene-Disease Associations	1.0	1.11151
GTEX-QMR6-1326-SM-32PLB	GTEx Tissue Sample Gene Expression Profiles	1.0	1.50147
GTEX-X4XX-0011-R10B-SM-46MWO	GTEx Tissue Sample Gene Expression Profiles	1.0	0.969726
hsa-miR-4679	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.40969
DG(22:4(7Z,10Z,13Z,16Z)/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MOLP-2	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.988148
membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
SZ in subgenual cingulate cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.843687
T-bar	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.992
III, right, paravermis	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	2.16234
U-937	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	1.21324
CiliaryGanglion	BioGPS Human Cell Type and Tissue Gene Expression Profiles	1.0	0.969122
A3KAW	CCLE Cell Line Gene Expression Profiles	1.0	1.35383
periventricular stratum of Hb	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-2.05273
HSPBAP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.23845
FOXN4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.86141
H4K20me1_HeLa-S3_hg19_1	ENCODE Histone Modification Site Profiles	1.0	null
GSTP1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-2.87093
HCT116	CCLE Cell Line Gene Mutation Profiles	1.0	null
oral squamous cell carcinoma cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores	1.0	0.75495
GSE108675_2_v_1_slc1a4_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Cytokine Measurement	DisGeNET Gene-Phenotype Associations	1.0	null
GSE120370_4_v_3_thrombin_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
NCI-H526	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(16:0/0:0/18:1n7)	HMDB Metabolites of Enzymes	1.0	null
Lung-pulmonary ionocyte	Tabula Sapiens Gene-Cell Associations	1.0	-0.108401
SCML4	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.56068
central nuclear group	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.846011
CDKN2D	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.28864
DG(22:5(7Z,10Z,13Z,16Z,19Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
PK1	CCLE Cell Line Gene Mutation Profiles	1.0	null
anterior (rostral) cingulate (medial prefrontal) cortex_18 yrs_M_12984	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.12154
Kidney renal papillary cell carcinoma_KIRP_TCGA-Y8-A8RY-11A-11R-A37K-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
EPN1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.20951
GSE166004_1_v_0_pld1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
RS411	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(20:0/0:0/22:2n6)	HMDB Metabolites of Enzymes	1.0	null
Cervical squamous cell carcinoma and endocervical adenocarcinoma_CESC_TCGA-FU-A57G-01A-11R-A26T-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
Perturb_1066_KO_Esr1_SRP087718	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	1.0	6.42202
GTEX-T8EM-0626-SM-4DM62	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Oral squamous cell carcinoma	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.623
Cerebellar cortex	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.511
ChIP_TBX3_20139965	ESCAPE Omics Signatures of Genes and Proteins for Stem Cells	1.0	null
EJM	COSMIC Cell Line Gene Mutation Profiles	1.0	null
DG(18:4(6Z,9Z,12Z,15Z)/14:1(9Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-NL3H-0011-R4a-SM-2I3GK	GTEx Tissue Sample Gene Expression Profiles	1.0	1.11953
episupraoptic nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.37502
DG(16:0/0:0/20:0)	HMDB Metabolites of Enzymes	1.0	null
MEOX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.91549
DG(14:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
HCC1162	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.17399
GTEX-OHPL-2026-SM-3TW8R	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
head	TISSUES Curated Tissue Protein Expression Evidence Scores	1.0	null
GTEX-TMMY-2226-SM-4DXTN	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:0/24:1(15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(8Z,11Z,14Z,17Z)/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
PMC11184788-40164_2024_526_MOESM4_ESM.xls-MSC-EV_proteins-Unnamed_4_MSC	Rummagene Transcription Factor Associations 2026	1.0	null
IZ in caudal perirhinal cortex	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	-1.0	-0.824274
DG(22:6(4Z,7Z,10Z,13Z,16Z,19Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
SHH	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.38561
GSE163240_2_v_0_enzalutamide_human	RummaGEO Drug Perturbation Signatures	-1.0	null
DG(20:1(11Z)/22:1(13Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
mantle zone of JcPD	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.11465
DG(22:0/0:0/20:4n6)	HMDB Metabolites of Enzymes	1.0	null
POU4F2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	44.2728
GTEX-X585-0011-R2B-SM-46MVF	GTEx Tissue Sample Gene Expression Profiles	1.0	1.09991
DG(22:5(7Z,10Z,13Z,16Z,19Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(16:1(9Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
molecular_function	GO Molecular Function Annotations 2015	1.0	null
DG(20:4n6/0:0/18:3n3)	HMDB Metabolites of Enzymes	1.0	null
GTEX-X4XX-2926-SM-3NMB1	GTEx Tissue Sample Gene Expression Profiles	1.0	1.48396
DG(20:1(11Z)/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(4Z,7Z,10Z,13Z,16Z)/22:5(4Z,7Z,10Z,13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-UPIC-1526-SM-4IHLU	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:2(13Z,16Z)/18:3(6Z,9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
MUC3A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.88505
DG(24:1n9/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
METTL8	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.52042
laterostriatal stripe	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	-1.0	-1.98839
GSE146962_0_v_1_glucosamine_mouse	RummaGEO Drug Perturbation Signatures	-1.0	null
Fertilization envelope	COMPARTMENTS Text-mining Protein Localization Evidence Scores 2025	1.0	0.532
Tobacco Use Disorder	HuGE Navigator Gene-Phenotype Associations	1.0	null
substantia nigra, pars compacta, left	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	1.0	2.05613
FOXC1	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	39.3843
superficial stratum of r8BI	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.19135
GTEX-U412-0006-SM-3DB8J	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-XBEC-1326-SM-4AT69	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-4506	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.0155
COLO 205	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	1.0	0.863068
PCDHB14	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.9368
GTEX-QDT8-2926-SM-32PKC	GTEx Tissue Sample Gene Expression Profiles	1.0	1.49504
PMC12152148-41420_2025_2541_MOESM3_ESM.xlsx-AR-IP-DHT_peak-gene-symbol_AR	Rummagene Transcription Factor Associations 2026	1.0	null
MEIS2	JASPAR Predicted Human Transcription Factor Targets 2025	1.0	26.6287
DG(22:2(13Z,16Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Inner hair cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.77
SENP3	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.5584
hsa-miR-582-3p	TargetScan Predicted Conserved microRNA Targets	1.0	0.140752
DG(20:1n9/0:0/20:4n3)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1(11Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
rectum	HPA Tissue Protein Expression Profiles	1.0	0.801417
Stria terminalis	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.549
ZNF512	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.89073
GTEX-PVOW-0006-SM-3NMB8	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
hsa-miR-513a-5p	TargetScan Predicted Conserved microRNA Targets	1.0	0.119151
GTEx Muscle 20-29 vs 30-39	GTEx Tissue-Specific Aging Signatures	1.0	5.31287
GTEX-NPJ7-2826-SM-2I3FU	GTEx Tissue Sample Gene Expression Profiles	1.0	1.45216
medial geniculate nuclei	Allen Brain Atlas Prenatal Human Brain Tissue Gene Expression Profiles	1.0	0.912449
CAPAN-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
LBX1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.36953
SELENOO	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.48604
DG(18:3(6Z,9Z,12Z)/24:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_8832_KO_MESP1_SRP345831	PerturbAtlas Signatures of Differentially Expressed Genes for Gene Perturbations	1.0	9.22564
DG(18:1(9Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:1(11Z)/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Perturb_15060_OE_Trp53_SRP345823	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-3.75875
GSE135030_11_v_7_fludarabine_human	RummaGEO Drug Perturbation Signatures	-1.0	null
GTEX-PSDG-1426-SM-48TD1	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(24:1(15Z)/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
microcellular tegmental nucleus	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	2.03505
Perturb_4131_OE_PS2APP_SRP092532	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-2.35866
DG(20:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE151612_0_v_2_pracinostat_human	RummaGEO Drug Perturbation Signatures	1.0	null
COLO 679	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-1.90801
calyx of held	COMPARTMENTS Text-mining Protein Localization Evidence Scores	1.0	0.924197
PMC7265345-41598_2020_65638_MOESM5_ESM.xlsx-4_E2F8-Gene_E2F8	Rummagene Transcription Factor Associations 2026	1.0	null
hsa-miR-1251	TargetScan Predicted Nonconserved microRNA Targets	1.0	0.965816
GSE150072,GSE169209_4_v_11_qser1_human	RummaGEO Gene Perturbation Signatures	1.0	null
neoplasm by anatomical site	GWASdb SNP-Phenotype Associations	1.0	0.050905
organ system cancer	GWASdb SNP-Disease Associations	1.0	0.134368
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
TNFRSF25	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.28211
TGBC24TKB	COSMIC Cell Line Gene Mutation Profiles	1.0	null
496100616_FWM_no dementia_TBI_84_M	Allen Brain Atlas Aging Dementia and Traumatic Brain Injury Tissue Sample Gene Expression Profiles	-1.0	-2.78462
inferolateral temporal cortex (area TEv, area 20)_4 mos_M_12296	Allen Brain Atlas Developing Human Brain Tissue Gene Expression Profiles by RNA-seq	1.0	1.48692
hsa-miR-217	TargetScan Predicted Nonconserved microRNA Targets	1.0	1.07142
DG(20:4(8Z,11Z,14Z,17Z)/22:5(7Z,10Z,13Z,16Z,19Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
intracellular membrane-bounded organelle	LOCATE Predicted Protein Localization Annotations	1.0	null
DG(18:1(9Z)/14:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(14:0/0:0/22:0)	HMDB Metabolites of Enzymes	1.0	null
NUDT21	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80526
Axon	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
choroid plexus of the lateral ventricle	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-1.93505
DG(18:3n6/0:0/22:4n6)	HMDB Metabolites of Enzymes	1.0	null
brain disease	DISEASES Experimental Gene-Disease Association Evidence Scores	1.0	0.345945
liver	GTEx Tissue Gene Expression Profiles	-1.0	-1.34918
Kidney renal clear cell carcinoma_KIRC_TCGA-B0-4699-01A-01R-1277-07	TCGA Signatures of Differentially Expressed Genes for Tumors	1.0	null
superficial stratum of THyB-P	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.20249
GTEX-XYKS-1226-SM-4BRVI	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
Head and neck cancer	DISEASES Text-mining Gene-Disease Association Evidence Scores 2025	1.0	1.34
Perturb_4491_KO_Tcf4_SRP072458	PerturbAtlas Signatures of Differentially Expressed Genes for Mouse Gene Perturbations	-1.0	-20.0
DG(20:4(5Z,8Z,11Z,14Z)/22:2(13Z,16Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:0/20:2(11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
NCI-H1092	Klijn et al., Nat. Biotechnol., 2015 Cell Line Gene CNV Profiles	-1.0	-0.839002
CLDN7	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.93902
GTEX-U3ZM-0526-SM-4DXTB	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE214514_1_v_7_bmal1_mouse	RummaGEO Gene Perturbation Signatures	1.0	null
BICRAL	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.27205
GTEX-T5JC-0008-SM-4DM6A	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GTEX-SIU8-0008-SM-4BRUC	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:3(9Z,12Z,15Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/15:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:5(5Z,8Z,11Z,14Z,17Z)/20:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
GSE192663_3_v_2_acly_mouse	RummaGEO Gene Perturbation Signatures	-1.0	null
Chromaffin cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	1.292
DG(20:3(8Z,11Z,14Z)/18:1(11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RHOB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.06149
SCL-21571218-MEGAKARYOCYTES-HUMAN	ChEA Transcription Factor Targets 2022	1.0	null
GTEX-OHPN-0008-SM-4E3HW	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
GSE109285_3_v_4_glucagon_mouse	RummaGEO Drug Perturbation Signatures	1.0	null
STARD10	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	4.11811
TMEM14A	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.64407
DG(22:0/22:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(18:1n9/0:0/24:1n9)	HMDB Metabolites of Enzymes	1.0	null
CDH24	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.98048
SBF1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.80218
SPTSSB	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	2.3408
SK-MES-1	COSMIC Cell Line Gene Mutation Profiles	1.0	null
GTEX-WEY5-2326-SM-3GIKK	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(15:0/18:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(20:4(5Z,8Z,11Z,14Z)/20:4(8Z,11Z,14Z,17Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
RAJI	CCLE Cell Line Gene CNV Profiles	-1.0	-1.68425
DG(24:0/20:3(8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(24:0/18:2(9Z,12Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
Oogenesis phase fetal germ cell_Fetal gonad_Human	CellMarker Gene-Cell Type Associations	1.0	null
DG(22:1(13Z)/16:0/0:0)	HMDB Metabolites of Enzymes	1.0	null
globose nucleus, right	Allen Brain Atlas Adult Human Brain Tissue Gene Expression Profiles	-1.0	-0.880805
peroxisome	LOCATE Predicted Protein Localization Annotations	1.0	null
LHX8_Deficiency_GDS3254_600_mouse_Newborn ovaries	GEO Signatures of Differentially Expressed Genes for Gene Perturbations	-1.0	null
Mammalian uncoordinated homology 13, subgroup, domain 2	InterPro Predicted Protein Domain Annotations	1.0	null
Transport vesicle membrane	COMPARTMENTS Curated Protein Localization Evidence Scores 2025	1.0	3.0
GP2D	CCLE Cell Line Gene Mutation Profiles	1.0	null
HT-22 cell	TISSUES Text-mining Tissue Protein Expression Evidence Scores 2025	1.0	0.692
TPMT	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	-1.0	-3.49711
PDIA6	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.2039
HS936T	CCLE Cell Line Gene Mutation Profiles	1.0	null
GTEX-TMMY-0008-SM-4DXU3	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(18:2(9Z,12Z)/20:3(5Z,8Z,11Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GTEX-T2IS-0011-R5A-SM-32QP4	GTEx Tissue Sample Gene Expression Profiles	1.0	0.919112
layer 2 of OCx	Allen Brain Atlas Adult Mouse Brain Tissue Gene Expression Profiles	1.0	1.02606
GTEX-P4QS-0926-SM-48TBS	GTEx Tissue Sample Gene Expression Profiles	-1.0	-0.867989
DG(22:5(4Z,7Z,10Z,13Z,16Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
GFI1	CM4AI KOLF21J CRISPRi Gene Perturbation Atlas	1.0	3.07313
KMS20	CCLE Cell Line Gene Mutation Profiles	1.0	null
DG(14:0/18:4(6Z,9Z,12Z,15Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null
DG(22:5(7Z,10Z,13Z,16Z,19Z)/20:4(5Z,8Z,11Z,14Z)/0:0)	HMDB Metabolites of Enzymes	1.0	null