| Description | Drug perturbation signatures produced from automatically mined RNA-seq samples from GEO. |
| Measurement | gene expression by RNA-seq |
| Association | gene-drug perturbation associations by differential expression of gene following drug perturbation |
| Category | transcriptomics |
| Resource | RummaGEO |
| Citation(s) | |
| Last Updated | 2025 Jun 10 |
| Stats |
|
| API | |
| Script | |
| Downloads |
Gene Attribute
Gene Similarity
Attribute Similarity
UMAP
2867 sets of genes differentially expressed following drug perturbation from the RummaGEO Drug Perturbation Signatures dataset.
| Gene Set | Description |
|---|---|
| GSE205556_2_v_0_bexarotene_human | human control fibroblast line dmso 6 days cell vs human msd fibroblast line tazarotene/bexarotene 6 days cell |
| GSE119345_2_v_3_bexarotene_human | si veh ct cell line hut78 cutaneous lymphoma (ctcl) 1 vehicle 2 control sequencing vs si tr bexa cell line hut78 cutaneous lymphoma (ctcl) 1 sitr 2 bexarotene sequencing |
| GSE77569_0_v_1_bexarotene_mouse | app ps control strain c57bl/6 cortex app/ps1 agent 0.2 mg/kg glycerol brain vs app ps bex strain c57bl/6 cortex app/ps1 agent bexarotene brain |
| GSE119345_0_v_3_bexarotene_human | si ct cell line hut78 cutaneous lymphoma (ctcl) 1 2 control sequencing vs si tr bexa cell line hut78 cutaneous lymphoma (ctcl) 1 sitr 2 bexarotene sequencing |
| GSE119345_2_v_4_bexarotene_human | si veh ct cell line hut78 cutaneous lymphoma (ctcl) 1 vehicle 2 control sequencing vs si int bexa cell line hut78 cutaneous lymphoma (ctcl) 1 siint 2 bexarotene sequencing |
| GSE205556_1_v_0_bexarotene_human | human msd fibroblast line dmso 6 days cell vs human msd fibroblast line tazarotene/bexarotene 6 days cell |
| GSE192771_2_v_1_sorafenib_human | huh7 cell lines dmso line cells liver cancer vs huh7 cell lines mt1g oe line cells liver overexpression cancer |
| GSE242367_1_v_0_sorafenib_human | dpp9 nc cell line 786 clear renal carcinoma wt none vs dpp9 ko cell line 786 clear renal carcinoma knock none |
| GSE248770_0_v_1_sorafenib_human | cn cell line hep3b human hepatocarcinoma wt none vs sko cell line hep3b human hepatocarcinoma ko none |
| GSE186280_1_v_0_sorafenib_human | control hepg2 differentiation stage well differentiated cells p53 profile wild type dmso hepatocellular carcinoma vs sfb differentiation stage differentiated cells p53 profile sorafenib 10 um 12h hepatocellular carcinoma |
| GSE240109_0_v_1_sorafenib_human | si ctrl cell line hcclm3 sr control sirna transfection vs si circrna cell line hcclm3 sr cdcbld2 knockdown sirna transfection |
| GSE151412_2_v_3_sorafenib_human | cell line hep3b drug dmso hepatoma vs cell line huh7 drug gw3965 hepatoma |
| GSE176151_0_v_1_sorafenib_human | mhcc97h control cell line hcc phenotype â sorafenib sensitive vs mhcc97h sr cell line hcc phenotype â sorafenib resistant |
| GSE183113_2_v_0_sorafenib_human | hepg2 cell line sh control vs hepg2 cell line sh pcsk9 |
| GSE98973_3_v_0_sorafenib_mouse | control heart sex female strain fvb murine vs erlotinib heart sex female strain fvb murine |
| GSE242333_0_v_2_sorafenib_human | control huh7 (con) cell line hepatocellular carcinoma cells treated dmso vs sorafenib resistant huh7 (sr) cell line hepatocellular carcinoma cells treated chronic resulting resistance |
| GSE192771_2_v_3_sorafenib_human | huh7 cell lines dmso line cells liver cancer vs huh7 cell lines sorafenib line cells liver cancer |
| GSE242333_0_v_1_sorafenib_human | control huh7 (con) cell line hepatocellular carcinoma cells treated dmso vs regorafenib treated sorafenib resistant huh7 (sr+rego) cell line hepatocellular carcinoma (sr) cells |
| GSE151412_2_v_1_sorafenib_human | cell line hep3b drug dmso hepatoma vs cell line huh7 drug sorafenib hepatoma |
| GSE158458_2_v_3_sorafenib_human | untreated hepatocyte derived cellular carcinoma cell line vs sorafenib (7âµm) hepatocyte derived cellular carcinoma cell line |
| GSE113005_0_v_1_sorafenib_human | dmso cell line huh7sr parental huh7 drug exposure dose 2 um length 24 hr sorafenib resistant hcc (huh7sr) vs fostamatinib cell line huh7sr parental huh7 drug exposure dose 2 um length 24 hr sorafenib resistant hcc (huh7sr) |
| GSE192771_2_v_0_sorafenib_human | huh7 cell lines dmso line cells liver cancer vs huh7 cell lines vec line cells liver empty vector cancer |
| GSE158458_2_v_1_sorafenib_human | untreated hepatocyte derived cellular carcinoma cell line vs sorafenib (7âµm) hepatocyte derived cellular carcinoma cell line |
| GSE240747_0_v_1_sorafenib_human | hepg2 cells expressing empty vector replicate cell line liver cancer wt none vs hepg2 cells hsparc overexpression replicate cell line liver cancer sparc none |
| GSE183113_1_v_3_sorafenib_human | hepg2 cell line dmso vs hepg2 cell line pcsk9 inr |
| GSE98973_3_v_2_sorafenib_mouse | control heart sex female strain fvb murine vs sorafenib heart sex female strain fvb murine |
| GSE183113_2_v_3_sorafenib_human | hepg2 cell line sh control vs hepg2 cell line pcsk9 inr |
| GSE98973_3_v_1_sorafenib_mouse | control heart sex female strain fvb murine vs sunitinib heart sex female strain fvb murine |
| GSE183113_1_v_0_sorafenib_human | hepg2 cell line dmso vs hepg2 cell line sh pcsk9 |
| GSE242333_0_v_3_sorafenib_human | control huh7 (con) cell line hepatocellular carcinoma cells treated dmso vs regorafenib treated huh7 (rego) cell line hepatocellular carcinoma cells |
| GSE248769_1_v_0_sorafenib_human | control cell line hep3b human hepatocarcinoma con sample group parental cells vs dr cell line hep3b human hepatocarcinoma sample group sorafenib acquired resistance cells |
| GSE80446_0_v_1_anakinra_mouse | wt il1b 2 wild type (200 ng/mouse 14h) flow cell lane age adult mice (3 month old) cerebral cortical vs il 1r8 / anakinra (25 mg/kg per day 3 consecutive days .p. administration) flow cell lane age adult mice (3 month old) cerebral cortical |
| GSE80446_2_v_1_anakinra_mouse | wt nt wild type non treated flow cell lane age adult mice (3 month old) cerebral cortical vs il 1r8 / anakinra (25 mg/kg per day 3 consecutive days .p. administration) flow cell lane age adult mice (3 month old) cerebral cortical |
| GSE253056_0_v_1_erythropoietin_mouse | cdc1s xcr1+cd8a+ wt c57bl/6 time vs cdc1s tli/ats xcr1+cd8a+ epor tdtomato time day15 |
| GSE151195_0_v_1_erlotinib_human | control nasopharyngeal carcinoma (npc) passage p3 p10 cell line derived biopsy specimens vs gpe nasopharyngeal carcinoma (npc) passage p3 p10 cell line derived biopsy specimens |
| GSE148096_1_v_0_erlotinib_human | bt20 dmso 24hr agent cell line vs bt20 erlotinib 24hr agent cell line |
| GSE244730_0_v_1_erlotinib_human | pc9 cells vehicle (dmso) day1 cell line non smallcelllung cancercell vs pc9 cells erlotinib (e) day1 cell line non smallcelllung cancercell |
| GSE195568_2_v_10_palbociclib_human | met5a normal mesothelial cells immortalized sv40 cell line met 5a vs msto palbo 1 malignant pleural mesothelioma cells cell line 211h um palbociclib days |
| GSE195568_1_v_10_palbociclib_human | ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs msto palbo 1 malignant pleural mesothelioma cells cell line 211h um palbociclib days |
| GSE216273,GSE216292_14_v_1_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs imr32 5dpb neuroblastoma cell line imr 32 5d agent palbociclib |
| GSE195568_2_v_0_palbociclib_human | met5a normal mesothelial cells immortalized sv40 cell line met 5a vs h28 palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE216273,GSE216292_14_v_2_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs shsy5y 5dpb neuroblastoma cell line sh sy5y 5d agent palbociclib |
| GSE195568_2_v_4_palbociclib_human | met5a normal mesothelial cells immortalized sv40 cell line met 5a vs washout malignant pleural mesothelioma cells cell line nci 1 um palbociclib 10 days followed drug 48 hours |
| GSE216273,GSE216292_0_v_8_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs shsy5y 24hpb neuroblastoma cell line sh sy5y 24h agent palbociclib |
| GSE130437_0_v_1_palbociclib_human | mdamb231 parental cell line (control) replicate mda mb231 er breast cancer resistance none vs mcf7 palbociclib resistant replicate cell line er+ breast cancer resistance |
| GSE195568_6_v_10_palbociclib_human | h28 ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs msto palbo 1 malignant pleural mesothelioma cells cell line 211h um palbociclib days |
| GSE130437_2_v_1_palbociclib_human | mcf7 parental cell line (control) replicate er+ breast cancer resistance none vs mcf7 palbociclib resistant replicate cell line er+ breast cancer resistance |
| GSE216273,GSE216292_14_v_6_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs be2c 7dpb neuroblastoma cell line sk n (2)c 7d agent palbociclib |
| GSE192870_2_v_0_palbociclib_human | control lusc cell line h520 vs palbociclib lusc cell line h520 |
| GSE195568_3_v_4_palbociclib_human | msto ctrl 1 malignant pleural mesothelioma cells cell line 211h 0 % dmso days vs washout malignant pleural mesothelioma cells cell line nci 1 um palbociclib 10 days followed drug 48 hours |
| GSE130437_0_v_3_palbociclib_human | mdamb231 parental cell line (control) replicate mda mb231 er breast cancer resistance none vs mdamb231 palbociclib resistant replicate cell line mda mb231 er breast cancer resistance |
| GSE195568_2_v_7_palbociclib_human | met5a normal mesothelial cells immortalized sv40 cell line met 5a vs palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE216273,GSE216292_0_v_3_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs be2c 24hpb neuroblastoma cell line sk n (2)c 24h agent palbociclib |
| GSE234514,GSE234516_2_v_0_palbociclib_human | mcf 7 wt cells breast cell line cancer vs mcf 7 pr shmitf cells breast cell line cancer mitf knockdown |
| GSE234514,GSE234516_2_v_3_palbociclib_human | mcf 7 wt cells breast cell line cancer vs mcf 7 pr3 cells breast cell line pr cancer palbociclib |
| GSE195568_6_v_0_palbociclib_human | h28 ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs h28 palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE216273,GSE216292_14_v_3_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs be2c 24hpb neuroblastoma cell line sk n (2)c 24h agent palbociclib |
| GSE195568_6_v_7_palbociclib_human | h28 ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE195568_1_v_7_palbociclib_human | ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE216273,GSE216292_0_v_6_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs be2c 7dpb neuroblastoma cell line sk n (2)c 7d agent palbociclib |
| GSE123401_2_v_0_palbociclib_mouse | vavcre jak2+/+ cdk6+/+ replicate bone marrow lsk cells untreated vs vavcre jak2v617f cdk6+/+ palbociclib treated replicate bone marrow lsk cells |
| GSE216274,GSE216292_4_v_3_palbociclib_human | be2c dmso neuroblastoma cell line sk n (2)c agent vs be2c pb neuroblastoma cell line sk n (2)c agent palbociclib |
| GSE216274,GSE216292_4_v_2_palbociclib_human | be2c dmso neuroblastoma cell line sk n (2)c agent vs be2c ra neuroblastoma cell line sk n (2)c agent retinoic acid |
| GSE216273,GSE216292_0_v_2_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs shsy5y 5dpb neuroblastoma cell line sh sy5y 5d agent palbociclib |
| GSE192870_2_v_3_palbociclib_human | control lusc cell line h520 vs blu9931 +palbociclib lusc cell line h520 |
| GSE130437_2_v_3_palbociclib_human | mcf7 parental cell line (control) replicate er+ breast cancer resistance none vs mdamb231 palbociclib resistant replicate cell line mda mb231 er breast cancer resistance |
| GSE216273,GSE216292_14_v_7_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs imr32 24hpb neuroblastoma cell line imr 32 24h agent palbociclib |
| GSE216273,GSE216292_0_v_1_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs imr32 5dpb neuroblastoma cell line imr 32 5d agent palbociclib |
| GSE216273,GSE216292_0_v_7_palbociclib_human | be2c control neuroblastoma cell line sk n (2)c agent vs imr32 24hpb neuroblastoma cell line imr 32 24h agent palbociclib |
| GSE192870_2_v_1_palbociclib_human | control lusc cell line h520 vs blu9931 lusc cell line h520 |
| GSE123401_3_v_0_palbociclib_mouse | vavcre jak2+/+ cdk6 / replicate bone marrow lsk cells untreated vs vavcre jak2v617f cdk6+/+ palbociclib treated replicate bone marrow lsk cells |
| GSE195568_1_v_0_palbociclib_human | ctrl 1 malignant pleural mesothelioma cells cell line nci 0 % dmso days vs h28 palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE216274,GSE216292_4_v_1_palbociclib_human | be2c dmso neuroblastoma cell line sk n (2)c agent vs be2c pbandra neuroblastoma cell line sk n (2)c agent palbociclib retinoic acid |
| GSE216273,GSE216292_14_v_8_palbociclib_human | shsy5y control neuroblastoma cell line sh sy5y agent vs shsy5y 24hpb neuroblastoma cell line sh sy5y 24h agent palbociclib |
| GSE195568_3_v_0_palbociclib_human | msto ctrl 1 malignant pleural mesothelioma cells cell line 211h 0 % dmso days vs h28 palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE234514,GSE234516_1_v_3_palbociclib_human | mcf 7 pr control cells breast cell line cancer palbociclib vs mcf 7 pr3 cells breast cell line pr cancer palbociclib |
| GSE195568_3_v_7_palbociclib_human | msto ctrl 1 malignant pleural mesothelioma cells cell line 211h 0 % dmso days vs palbo 1 malignant pleural mesothelioma cells cell line nci um palbociclib days |
| GSE195568_3_v_10_palbociclib_human | msto ctrl 1 malignant pleural mesothelioma cells cell line 211h 0 % dmso days vs msto palbo 1 malignant pleural mesothelioma cells cell line 211h um palbociclib days |
| GSE140066_2_v_1_methotrexate_human | control cell line caco2 caco 2 spheroids vs methotrexate lactoferrin cell line caco2 caco 2 spheroids |
| GSE185872_0_v_1_methotrexate_human | dmso treated mãx98 macrophage cell monocyte derived csf macrophages vs chir99021+mtx treated mãx98 macrophage cell monocyte derived csf macrophages |
| GSE140066_2_v_3_methotrexate_human | control cell line caco2 caco 2 spheroids vs lactoferrin cell line caco2 caco 2 spheroids |
| GSE185872_0_v_2_methotrexate_human | dmso treated mãx98 macrophage cell monocyte derived csf macrophages vs dmso+mtx treated mãx98 macrophage cell monocyte derived csf macrophages |
| GSE185872_0_v_3_methotrexate_human | dmso treated mãx98 macrophage cell monocyte derived csf macrophages vs chir99021 treated mãx98 macrophage cell monocyte derived csf macrophages |
| GSE186151_1_v_0_methotrexate_human | m2 mãx98 macrophage monocyte derived csf macrophages untreated vs m2 mtx mãx98 macrophage monocyte derived csf macrophages treated |
| GSE205540_2_v_0_phloridzin_mouse | control group liver wt vs phloridzin group sample liver +ccl4 induced fibrosis modle |
| GSE205540_2_v_3_phloridzin_mouse | control group liver wt vs silibinin group sample liver +ccl4 induced fibrosis modle |
| GSE205540_2_v_1_phloridzin_mouse | control group liver wt vs modle group sample liver ccl4 induced fibrosis |
| GSE144796_1_v_0_linagliptin_mouse | control vehicle strain c57bl/6 primary cultured age aged approximately 8 weeks treated 0.1% dmso 24h adult cardiomyocytes vs dmhfd treated strain c57bl/6 primary cultured age high fat diet 26 weeks streptozotocin injection 12 9nmol/l linagliptin 24h adult cardiomyocytes |
| GSE144796_3_v_0_linagliptin_mouse | control treated strain c57bl/6 primary cultured age aged approximately 8 weeks 9nmol/l linagliptin 24h adult cardiomyocytes vs dmhfd treated strain c57bl/6 primary cultured age high fat diet 26 weeks streptozotocin injection 12 9nmol/l linagliptin 24h adult cardiomyocytes |
| GSE86021_1_v_3_crenolanib_mouse | el08 cells +dmso co culture replicate dmso stromal cell line vs el08 cells +aza co culture replicate aza stromal cell line |
| GSE86021_0_v_3_crenolanib_human | pdx cells +dmso co culture replicate dmso derived aml cell line vs pdx cells +aza co culture replicate aza derived aml cell line |
| GSE86021_0_v_1_crenolanib_human | pdx cells +dmso co culture replicate dmso derived aml cell line vs pdx cells +crenolanib co culture replicate crenolanib derived aml cell line |
| GSE86021_1_v_3_crenolanib_human | el08 cells +dmso co culture replicate dmso stromal cell line vs el08 cells +aza co culture replicate aza stromal cell line |
| GSE86021_1_v_2_crenolanib_mouse | el08 cells +dmso co culture replicate dmso stromal cell line vs el08 cells 4 days mono culure replicate day culture stromal cell line |
| GSE86021_0_v_1_crenolanib_mouse | pdx cells +dmso co culture replicate dmso derived aml cell line vs pdx cells +crenolanib co culture replicate crenolanib derived aml cell line |
| GSE86021_0_v_3_crenolanib_mouse | pdx cells +dmso co culture replicate dmso derived aml cell line vs pdx cells +aza co culture replicate aza derived aml cell line |
| GSE154074_2_v_0_bleomycin_mouse | wt nc strain background c57bl/6 age 3 months sex male /variation wild type control (sham) lung vs dn pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative bleomycin injected (blm) lung form p38î± blm |
| GSE180951_1_v_4_bleomycin_mouse | nacl d14 cd19+ cells b time day14 disease model status control vs cd19+ b cells adtgfãx9f 14d adtgfbeta time day14 disease model status fibrosis activated |
| GSE180951_2_v_4_bleomycin_mouse | cd19+ b cells addl70 3 14d time day14 disease model status control vs cd19+ b cells adtgfãx9f 14d adtgfbeta time day14 disease model status fibrosis activated |
| GSE180951_1_v_0_bleomycin_mouse | nacl d14 cd19+ cells b time day14 disease model status control vs cd19+ b cells adtgfãx9f 21d adtgfbeta time day21 disease model status fibrosis activated |
| GSE154074_2_v_4_bleomycin_mouse | wt nc strain background c57bl/6 age 3 months sex male /variation wild type control (sham) lung vs ca pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven 3ha mkk6 constitutive active bleomycin injected (blm) lung form blm |
| GSE180951_2_v_0_bleomycin_mouse | cd19+ b cells addl70 3 14d time day14 disease model status control vs cd19+ b cells adtgfãx9f 21d adtgfbeta time day21 disease model status fibrosis activated |
| GSE154074_5_v_0_bleomycin_mouse | dn nc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative control (sham) lung form p38î± vs dn pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative bleomycin injected (blm) lung form p38î± blm |
| GSE180951_6_v_3_bleomycin_mouse | nacl d21 cd19+ cells b time day21 disease model status control vs bleomycin d21 cd19+ cells b time day21 disease model status fibrosis activated |
| GSE154074_3_v_0_bleomycin_mouse | wt pc strain background c57bl/6 age 3 months sex male /variation wild type bleomycin injected (blm) lung blm vs dn pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative bleomycin injected (blm) lung form p38î± blm |
| GSE190157_0_v_2_bleomycin_mouse | primary at2 p300 knockout negative control pbs murine atii cells vs primary at2 p300 knockout pbs murine atii cells |
| GSE180951_6_v_4_bleomycin_mouse | nacl d21 cd19+ cells b time day21 disease model status control vs cd19+ b cells adtgfãx9f 14d adtgfbeta time day14 disease model status fibrosis activated |
| GSE180951_1_v_3_bleomycin_mouse | nacl d14 cd19+ cells b time day14 disease model status control vs bleomycin d21 cd19+ cells b time day21 disease model status fibrosis activated |
| GSE180951_6_v_0_bleomycin_mouse | nacl d21 cd19+ cells b time day21 disease model status control vs cd19+ b cells adtgfãx9f 21d adtgfbeta time day21 disease model status fibrosis activated |
| GSE180951_7_v_3_bleomycin_mouse | cd19+ b cells addl70 3 21d time day21 disease model status control vs bleomycin d21 cd19+ cells b time day21 disease model status fibrosis activated |
| GSE154074_5_v_4_bleomycin_mouse | dn nc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative control (sham) lung form p38î± vs ca pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven 3ha mkk6 constitutive active bleomycin injected (blm) lung form blm |
| GSE143212_1_v_2_bleomycin_mouse | at2 blm strain c57bl/6 lung cells wild type bleomycin (blm) vs atg5âx88x92/âx88x92at2 pbs strain c57bl/6 lung at2 cells atg5 / |
| GSE109913_1_v_2_bleomycin_mouse | strain c57bl/6 lung alveolar epithelial cells (aecs) control vs lps 1 strain c57bl/6 lung alveolar epithelial cells (aecs) day |
| GSE180951_6_v_5_bleomycin_mouse | nacl d21 cd19+ cells b time day21 disease model status control vs bleomycin d14 cd19+ cells b time day14 disease model status fibrosis activated |
| GSE143212_0_v_3_bleomycin_mouse | at2 pbs strain c57bl/6 lung cells wild type vs atg5âx88x92/âx88x92at2 blm strain c57bl/6 lung at2 cells atg5 / bleomycin (blm) |
| GSE180951_7_v_4_bleomycin_mouse | cd19+ b cells addl70 3 21d time day21 disease model status control vs cd19+ b cells adtgfãx9f 14d adtgfbeta time day14 disease model status fibrosis activated |
| GSE143212_1_v_3_bleomycin_mouse | at2 blm strain c57bl/6 lung cells wild type bleomycin (blm) vs atg5âx88x92/âx88x92at2 blm strain c57bl/6 lung at2 cells atg5 / bleomycin (blm) |
| GSE154074_1_v_4_bleomycin_mouse | ca nc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven 3ha mkk6 constitutive active control (sham) lung form vs ca pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven 3ha mkk6 constitutive active bleomycin injected (blm) lung form blm |
| GSE180951_1_v_5_bleomycin_mouse | nacl d14 cd19+ cells b time day14 disease model status control vs bleomycin d14 cd19+ cells b time day14 disease model status fibrosis activated |
| GSE190157_0_v_1_bleomycin_mouse | primary at2 p300 knockout negative control pbs murine atii cells vs primary at2 p300 knockout bleomycin murine atii cells |
| GSE143212_0_v_2_bleomycin_mouse | at2 pbs strain c57bl/6 lung cells wild type vs atg5âx88x92/âx88x92at2 pbs strain c57bl/6 lung at2 cells atg5 / |
| GSE180951_2_v_3_bleomycin_mouse | cd19+ b cells addl70 3 14d time day14 disease model status control vs bleomycin d21 cd19+ cells b time day21 disease model status fibrosis activated |
| GSE154074_1_v_0_bleomycin_mouse | ca nc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven 3ha mkk6 constitutive active control (sham) lung form vs dn pc strain background c57bl/6 age 3 months sex male /variation transgenic human surfactant protein c promoter driven m2 flag p38alpha dominant negative bleomycin injected (blm) lung form p38î± blm |
| GSE161827_2_v_3_ertugliflozin_mouse | cd untreated diet control (cd) drug group left ventricle heart vs hfhs ertugliflozin diet high fat sugar (hfhs) drug group left ventricle heart |
| GSE161827_0_v_3_ertugliflozin_mouse | cd ertugliflozin diet control (cd) drug group left ventricle heart vs hfhs ertugliflozin diet high fat sugar (hfhs) drug group left ventricle heart |
| GSE161827_1_v_3_ertugliflozin_mouse | hfhs untreated diet high fat sugar (hfhs) drug group left ventricle heart vs hfhs ertugliflozin diet high fat sugar (hfhs) drug group left ventricle heart |
| GSE104022_3_v_4_tamoxifen_mouse | wt 3day epi strain mixed background epidermis age tamoxifen vs icko 3day der strain mixed background dermis age tamoxifen |
| GSE160083,GSE160084_1_v_3_tamoxifen_mouse | tibialis anterior wt+tam 7w rep [mim1 c] strain 129pas wt sex male age muscles tamoxifen vs tibialis anterior mtm1 / + tam 7w rep [mim1 c] strain 129pas sex male age muscles tamoxifen |
| GSE164529_0_v_1_tamoxifen_human | vehicle control cell line mcf7 ethanol duration 24 months breast cancer vs endx r cell line mcf7 endoxifen (1microm) duration 24 months breast cancer |
| GSE160083,GSE160084_2_v_3_tamoxifen_mouse | tibialis anterior wt 7w rep [mim1 c] strain 129pas sex male age muscles vs tibialis anterior mtm1 / + tam 7w rep [mim1 c] strain 129pas sex male age muscles tamoxifen |
| GSE63857_3_v_2_tamoxifen_mouse | end wt gender female parity nulliparous strain c57bl/6 wild type mammary glands vs paired end arom gender female parity nulliparous strain c57bl/6 tet op cyp19a1mmtv rtta mammary glands |
| GSE104022_1_v_0_tamoxifen_mouse | wt 3day der strain mixed background dermis age tamoxifen vs icko epi 3day strain mixed background epidermis age tamoxifen |
| GSE164529_0_v_3_tamoxifen_human | vehicle control cell line mcf7 ethanol duration 24 months breast cancer vs ici r cell line mcf7 (1microm) duration 24 months breast cancer |
| GSE92965_0_v_1_tamoxifen_mouse | cre control day6 background strain c57bl/6j heart endothelial cells age 8 10 weeks primary cardiac microvascular vs ec k2k4 dko day6 background strain c57bl/6j heart endothelial cells klf2 klf4 double knockout age 8 10 weeks primary cardiac microvascular |
| GSE104022_3_v_7_tamoxifen_mouse | wt 3day epi strain mixed background epidermis age tamoxifen vs icko 3day epi stat3i strain mixed background epidermis age tamoxifen |
| GSE160083,GSE160084_1_v_0_tamoxifen_mouse | tibialis anterior wt+tam 7w rep [mim1 c] strain 129pas wt sex male age muscles tamoxifen vs tibialis anterior mtm1 / 7w rep [mim1 c] strain 129pas sex male age muscles |
| GSE78199_0_v_3_tamoxifen_human | minustam cell line mcf7 cells invasive breast ductal carcinoma transfected negative control sirna treated none date vs plustam cell line mcf7 cells invasive breast ductal carcinoma transfected sirna basp1 treated 100nm tamoxifen date sibasp1 |
| GSE120336_1_v_3_tamoxifen_mouse | wt strain background c57bl/6 age post natal day 36 /variation wild type quadriceps muscle vs ko tam strain background c57bl/6 age post natal day 36 /variation mtm1 / 40mg/kg tamoxifen/day quadriceps muscle |
| GSE156454_0_v_1_tamoxifen_human | mcf 7 cell line cultured control cm breast cancer cells vs mcf 7 cell line cultured bcsc cm breast cancer cells |
| GSE95302_1_v_4_tamoxifen_human | rna seq sicontrol mcf 7 cells treated vehicle replicate cell line veh vs rna seq sifen1 mcf 7 cells treated e2 replicate cell line |
| GSE78199_2_v_3_tamoxifen_human | plustam cell line mcf7 cells invasive breast ductal carcinoma transfected negative control sirna treated 100nm tamoxifen date vs plustam cell line mcf7 cells invasive breast ductal carcinoma transfected sirna basp1 treated 100nm tamoxifen date sibasp1 |
| GSE149880_0_v_3_tamoxifen_mouse | wt 1 month strain c57bl/6 whole ear tamoxifen time injection vs card14e138a 1 month strain c57bl/6 whole ear tamoxifen time injection |
| GSE164529_0_v_2_tamoxifen_human | vehicle control cell line mcf7 ethanol duration 24 months breast cancer vs 4ht r cell line mcf7 (1microm) duration 24 months breast cancer |
| GSE78199_0_v_1_tamoxifen_human | minustam cell line mcf7 cells invasive breast ductal carcinoma transfected negative control sirna treated none date vs minustam cell line mcf7 cells invasive breast ductal carcinoma transfected sirna basp1 treated none date sibasp1 |
| GSE149880_0_v_1_tamoxifen_mouse | wt 1 month strain c57bl/6 whole ear tamoxifen time injection vs card14e138a day 5 strain c57bl/6 whole ear tamoxifen time days injection |
| GSE95302_2_v_3_tamoxifen_human | rna seq sicontrol mcf 7 cells treated e2 replicate cell line vs rna seq sifen1 mcf 7 cells treated vehicle replicate cell line veh |
| GSE120336_1_v_2_tamoxifen_mouse | wt strain background c57bl/6 age post natal day 36 /variation wild type quadriceps muscle vs ko strain background c57bl/6 age post natal day 36 /variation mtm1 / quadriceps muscle |
| GSE160083,GSE160084_2_v_0_tamoxifen_mouse | tibialis anterior wt 7w rep [mim1 c] strain 129pas sex male age muscles vs tibialis anterior mtm1 / 7w rep [mim1 c] strain 129pas sex male age muscles |
| GSE78199_2_v_1_tamoxifen_human | plustam cell line mcf7 cells invasive breast ductal carcinoma transfected negative control sirna treated 100nm tamoxifen date vs minustam cell line mcf7 cells invasive breast ductal carcinoma transfected sirna basp1 treated none date sibasp1 |
| GSE83145_1_v_0_tamoxifen_mouse | nipp1 ctr testis strain background mixed /variation control ubc cre ert2+/ ppp1r8 fl/+ age 6 weeks treated tamoxifen total wks vs nipp1 ko testis strain background mixed /variation ubc cre ert2+/ ppp1r8 fl/ age 6 weeks treated tamoxifen total wks |
| GSE63857_3_v_1_tamoxifen_mouse | end wt gender female parity nulliparous strain c57bl/6 wild type mammary glands vs end brca gender female parity nulliparous strain c57bl/6 brca1fl11/fl11/mmtv cre/p53+/ mammary glands |
| GSE104022_1_v_7_tamoxifen_mouse | wt 3day der strain mixed background dermis age tamoxifen vs icko 3day epi stat3i strain mixed background epidermis age tamoxifen |
| GSE120336_0_v_3_tamoxifen_mouse | wt tam strain background c57bl/6 age post natal day 36 /variation wild type 40mg/kg tamoxifen/day quadriceps muscle vs ko tam strain background c57bl/6 age post natal day 36 /variation mtm1 / 40mg/kg tamoxifen/day quadriceps muscle |
| GSE149880_2_v_1_tamoxifen_mouse | wt day 5 strain c57bl/6 whole ear tamoxifen time days injection vs card14e138a day 5 strain c57bl/6 whole ear tamoxifen time days injection |
| GSE92965_0_v_3_tamoxifen_mouse | cre control day6 background strain c57bl/6j heart endothelial cells age 8 10 weeks primary cardiac microvascular vs ec k4 ko day6 background strain c57bl/6j heart endothelial cells klf4 knockout age 8 10 weeks primary cardiac microvascular |
| GSE149880_2_v_3_tamoxifen_mouse | wt day 5 strain c57bl/6 whole ear tamoxifen time days injection vs card14e138a 1 month strain c57bl/6 whole ear tamoxifen time injection |
| GSE104022_3_v_0_tamoxifen_mouse | wt 3day epi strain mixed background epidermis age tamoxifen vs icko epi 3day strain mixed background epidermis age tamoxifen |
| GSE120336_0_v_2_tamoxifen_mouse | wt tam strain background c57bl/6 age post natal day 36 /variation wild type 40mg/kg tamoxifen/day quadriceps muscle vs ko strain background c57bl/6 age post natal day 36 /variation mtm1 / quadriceps muscle |
| GSE233679_6_v_13_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_6_v_1_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c)+ nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_11_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 1 mm rep lung cell line endothelial cells |
| GSE233679_6_v_11_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 1 mm rep lung cell line endothelial cells |
| GSE147662_3_v_5_nicotinamide_mouse | clp wt [cohort2] control common lymphoid progenitor vs gmp nr treated [cohort2] nicotinamide reboside common myeloid progenitor |
| GSE157594_5_v_2_nicotinamide_mouse | control kidney 1340mg kg strain c57bl/6 age 8w gender male vs nmn kidney 2680mg kg strain c57bl/6 age 8w gender male 2680mg/kg/ treated |
| GSE183271_2_v_0_nicotinamide_mouse | mii young oocyte untreated (metaphase ii) strain c57bl/6jausb control vs mii oocyte nmn (metaphase ii) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE183271_4_v_3_nicotinamide_mouse | mii oocyte untreated (metaphase ii) strain c57bl/6jausb control vs gv aged oocyte nmn (germinal vesicle) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE233679_12_v_11_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 1 mm rep lung cell line endothelial cells |
| GSE233679_5_v_15_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_0_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 10 mm rep lung cell line endothelial cells |
| GSE233679_6_v_2_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_12_v_4_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 1 mm rep lung cell line endothelial cells |
| GSE233679_12_v_3_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE121793_0_v_1_nicotinamide_mouse | sample sex male age (weeks) 20 strain dba/1j control nampt ankle vs sample sex male age (weeks) 20 strain dba/1j collagen induced arthritis nampt ankle |
| GSE242555_1_v_0_nicotinamide_human | hepg2 cells wt sample liver cell line vs hepg2 cells fn3k ko sample liver cell line |
| GSE233679_5_v_9_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE144443_5_v_1_nicotinamide_mouse | wt 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 12 days whole vs ko 6d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 6 days whole |
| GSE233679_6_v_10_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_5_v_8_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_13_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_12_v_9_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c)+ nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE125211_0_v_1_nicotinamide_mouse | st cells hsc control bone marrow vs lt cells hsc treated 1mm nr bone marrow |
| GSE144443_0_v_6_nicotinamide_mouse | wt 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 21 days whole vs ko 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 3 days whole |
| GSE147662_0_v_4_nicotinamide_mouse | gmp wt [cohort2] control common myeloid progenitor vs clp nr treated [cohort2] nicotinamide reboside common lymphoid progenitor |
| GSE233679_14_v_7_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c) nmn 10 mm rep lung cell line endothelial cells |
| GSE172494_2_v_1_nicotinamide_human | mda mb 468 control untreated cell line human breast tnbc vs mda mb nam treated 20mm nicotinamide 48hrs cell line human breast tnbc |
| GSE157594_3_v_2_nicotinamide_mouse | control liver 1340mg kg strain c57bl/6 age 8w gender male vs nmn kidney 2680mg kg strain c57bl/6 age 8w gender male 2680mg/kg/ treated |
| GSE233679_6_v_4_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 1 mm rep lung cell line endothelial cells |
| GSE233679_5_v_3_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_8_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE157594_6_v_7_nicotinamide_mouse | control liver kg strain c57bl/6 age 8w gender male vs nmn liver kg strain c57bl/6 age 8w gender male treated |
| GSE233679_5_v_7_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c) nmn 10 mm rep lung cell line endothelial cells |
| GSE144443_10_v_3_nicotinamide_mouse | wt 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 3 days whole vs ko 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 12 days whole |
| GSE157594_6_v_4_nicotinamide_mouse | control liver kg strain c57bl/6 age 8w gender male vs nmn kidney 1340mg kg strain c57bl/6 age 8w gender male 1340mg/kg/ treated |
| GSE144443_5_v_6_nicotinamide_mouse | wt 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 12 days whole vs ko 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 3 days whole |
| GSE233679_14_v_15_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_12_v_1_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c)+ nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE157594_5_v_7_nicotinamide_mouse | control kidney 1340mg kg strain c57bl/6 age 8w gender male vs nmn liver kg strain c57bl/6 age 8w gender male treated |
| GSE233679_12_v_8_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE144443_0_v_1_nicotinamide_mouse | wt 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 21 days whole vs ko 6d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 6 days whole |
| GSE233679_5_v_10_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 0.1 mm rep lung cell line endothelial cells |
| GSE157594_3_v_4_nicotinamide_mouse | control liver 1340mg kg strain c57bl/6 age 8w gender male vs nmn kidney 1340mg kg strain c57bl/6 age 8w gender male 1340mg/kg/ treated |
| GSE233679_6_v_7_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 10 mm rep lung cell line endothelial cells |
| GSE147662_3_v_1_nicotinamide_mouse | clp wt [cohort2] control common lymphoid progenitor vs hsc nr treated [cohort2] nicotinamide reboside hematopoietic stem cell |
| GSE183271_5_v_0_nicotinamide_mouse | gv young oocyte untreated (germinal vesicle) strain c57bl/6jausb control vs mii oocyte nmn (metaphase ii) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE233679_12_v_7_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 10 mm rep lung cell line endothelial cells |
| GSE233679_5_v_0_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 10 mm rep lung cell line endothelial cells |
| GSE233679_6_v_0_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 10 mm rep lung cell line endothelial cells |
| GSE164884_2_v_3_nicotinamide_human | d7 nt retinal organoid time control source line hipsc1 vs d4 nam retinal organoid time nicotinamide source line hipsc1 |
| GSE157594_6_v_2_nicotinamide_mouse | control liver kg strain c57bl/6 age 8w gender male vs nmn kidney 2680mg kg strain c57bl/6 age 8w gender male 2680mg/kg/ treated |
| GSE233679_5_v_11_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 1 mm rep lung cell line endothelial cells |
| GSE147662_0_v_1_nicotinamide_mouse | gmp wt [cohort2] control common myeloid progenitor vs hsc nr treated [cohort2] nicotinamide reboside hematopoietic stem cell |
| GSE233679_14_v_4_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c) nmn 1 mm rep lung cell line endothelial cells |
| GSE183271_2_v_3_nicotinamide_mouse | mii young oocyte untreated (metaphase ii) strain c57bl/6jausb control vs gv aged oocyte nmn (germinal vesicle) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE233679_14_v_1_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_2_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c) nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_12_v_10_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_6_v_3_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_6_v_8_nicotinamide_human | hcaec poly( c)+ nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE144443_10_v_6_nicotinamide_mouse | wt 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 3 days whole vs ko 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 3 days whole |
| GSE147662_2_v_4_nicotinamide_mouse | hsc wt [cohort2] control hematopoietic stem cell vs clp nr treated [cohort2] nicotinamide reboside common lymphoid progenitor |
| GSE144443_0_v_7_nicotinamide_mouse | wt 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 21 days whole vs ko 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 21 days whole |
| GSE233679_12_v_2_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c) nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_5_v_1_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE157594_0_v_7_nicotinamide_mouse | control kidney 2680mg kg strain c57bl/6 age 8w gender male vs nmn liver kg strain c57bl/6 age 8w gender male treated |
| GSE144443_5_v_3_nicotinamide_mouse | wt 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 12 days whole vs ko 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 12 days whole |
| GSE144443_5_v_7_nicotinamide_mouse | wt 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 12 days whole vs ko 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 21 days whole |
| GSE144443_0_v_3_nicotinamide_mouse | wt 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 21 days whole vs ko 12d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 12 days whole |
| GSE183271_1_v_0_nicotinamide_mouse | gv aged oocyte untreated (germinal vesicle) strain c57bl/6jausb control vs mii oocyte nmn (metaphase ii) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE157594_3_v_7_nicotinamide_mouse | control liver 1340mg kg strain c57bl/6 age 8w gender male vs nmn liver kg strain c57bl/6 age 8w gender male treated |
| GSE157594_0_v_4_nicotinamide_mouse | control kidney 2680mg kg strain c57bl/6 age 8w gender male vs nmn kidney 1340mg kg strain c57bl/6 age 8w gender male 1340mg/kg/ treated |
| GSE233679_12_v_15_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c)+ nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_10_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hpmec poly( c)+ nmn 0.1 mm rep lung cell line endothelial cells |
| GSE233679_14_v_3_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 0.1 mm rep coronary artery cell line endothelial cells |
| GSE233679_5_v_13_nicotinamide_human | hpmec poly( c) nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c) nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_12_v_0_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hpmec poly( c)+ nmn 10 mm rep lung cell line endothelial cells |
| GSE157594_5_v_4_nicotinamide_mouse | control kidney 1340mg kg strain c57bl/6 age 8w gender male vs nmn kidney 1340mg kg strain c57bl/6 age 8w gender male 1340mg/kg/ treated |
| GSE125211_2_v_3_nicotinamide_mouse | lt cells hsc control bone marrow vs st cells hsc treated 1mm nr bone marrow |
| GSE172494_3_v_1_nicotinamide_human | bt20 control untreated cell line bt 20 human breast tnbc vs mda mb nam treated 20mm nicotinamide 48hrs cell line human breast tnbc |
| GSE144443_10_v_7_nicotinamide_mouse | wt 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 3 days whole vs ko 21d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 21 days whole |
| GSE147662_2_v_5_nicotinamide_mouse | hsc wt [cohort2] control hematopoietic stem cell vs gmp nr treated [cohort2] nicotinamide reboside common myeloid progenitor |
| GSE144443_10_v_1_nicotinamide_mouse | wt 3d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation wild type (wt) sex female age 3 days whole vs ko 6d full liver [022 strain background c57bl/6jbomtac (pmid 31320478) /variation hepatocyte specific nampt knockout (ko) sex female age 6 days whole |
| GSE233679_12_v_13_nicotinamide_human | hcaec poly( c) nmn 0 mm (ctrl) rep coronary artery cell line endothelial cells vs hcaec poly( c) nmn 10 mm rep coronary artery cell line endothelial cells |
| GSE233679_14_v_9_nicotinamide_human | hpmec poly( c)+ nmn 0 mm (ctrl) rep lung cell line endothelial cells vs hcaec poly( c)+ nmn 1 mm rep coronary artery cell line endothelial cells |
| GSE164884_2_v_1_nicotinamide_human | d7 nt retinal organoid time control source line hipsc1 vs d7 nam retinal organoid time nicotinamide source line hipsc1 |
| GSE183271_4_v_0_nicotinamide_mouse | mii oocyte untreated (metaphase ii) strain c57bl/6jausb control vs mii oocyte nmn (metaphase ii) strain c57bl/6jausb 2g/l drinking water 4 weeks |
| GSE58724_3_v_0_oxymetholone_mouse | strain background 129s4 age 4 month gender male /variation wildtype treated oxymetholone cell population ter119+/cd71high/fschigh cells vs strain background 129s4 age 4 month gender male /variation treated oxymetholone cell population ckit+ sca1+ lin cells |
| GSE58724_1_v_0_oxymetholone_mouse | strain background 129s4 age 4 month gender male /variation wildtype treated palcebo cell population ter119+/cd71high/fschigh cells vs strain background 129s4 age 4 month gender male /variation treated oxymetholone cell population ckit+ sca1+ lin cells |
| GSE58724_3_v_4_oxymetholone_mouse | strain background 129s4 age 4 month gender male /variation wildtype treated oxymetholone cell population ter119+/cd71high/fschigh cells vs strain background 129s4 age 4 month gender male /variation treated palcebo cell population ckit+ sca1+ lin cells |
| GSE58724_1_v_4_oxymetholone_mouse | strain background 129s4 age 4 month gender male /variation wildtype treated palcebo cell population ter119+/cd71high/fschigh cells vs strain background 129s4 age 4 month gender male /variation treated palcebo cell population ckit+ sca1+ lin cells |
| GSE164364_0_v_1_zymosan_mouse | d6 veh f480hi f4/80hi macrophages strain c57/bl6 (female) control peritoneal lavage vs d6 ciii f480hi f4/80hi macrophages strain c57/bl6 (female) compound iii peritoneal lavage |
| GSE164364_2_v_1_zymosan_mouse | d6 veh f480lo f4/80lo macrophages strain c57/bl6 (female) control peritoneal lavage vs d6 ciii f480hi f4/80hi macrophages strain c57/bl6 (female) compound iii peritoneal lavage |
| GSE164364_2_v_3_zymosan_mouse | d6 veh f480lo f4/80lo macrophages strain c57/bl6 (female) control peritoneal lavage vs d6 ciii f480lo f4/80lo macrophages strain c57/bl6 (female) compound iii peritoneal lavage |
| GSE164364_0_v_3_zymosan_mouse | d6 veh f480hi f4/80hi macrophages strain c57/bl6 (female) control peritoneal lavage vs d6 ciii f480lo f4/80lo macrophages strain c57/bl6 (female) compound iii peritoneal lavage |
| GSE214596,GSE214598_1_v_3_rosiglitazone_mouse | rna seq map cells control cell line immortalized mouse adipocyte progenitor (map) vehicle vs rna seq map cells fsk3d cell line immortalized mouse adipocyte progenitor (map) forskolin time 3d |
| GSE162276_2_v_0_rosiglitazone_mouse | hf/tzd c control mouse tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver vs hf ko hepatocyte specfic ppargamma hepatocytes nash disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE171826_1_v_3_rosiglitazone_human | immortalized human bone marrow mesenchymal stromal cells htert (imsc3) transformation telomerase transformed untreated vs adiopcyte derived imsc3 rosiglatazone added induction maintainance media rosiglitazone treated adipocytes |
| GSE214596,GSE214598_1_v_4_rosiglitazone_mouse | rna seq map cells control cell line immortalized mouse adipocyte progenitor (map) vehicle vs rna seq map cells fsk4h cell line immortalized mouse adipocyte progenitor (map) forskolin time 4h |
| GSE139987_1_v_0_rosiglitazone_mouse | phenotype non diabetic normal control heterozygous mutation leptin receptor (db) age 15 weeks renal cortex vs phenotype type 2 diabetic rosiglitazone treated homozygous mutation leptin receptor (db) age 15 weeks renal cortex |
| GSE162276_2_v_3_rosiglitazone_mouse | hf/tzd c control mouse tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE214596,GSE214598_1_v_0_rosiglitazone_mouse | rna seq map cells control cell line immortalized mouse adipocyte progenitor (map) vehicle vs rna seq map cells fsk1d cell line immortalized mouse adipocyte progenitor (map) forskolin time 1d (24h) |
| GSE139987_1_v_2_rosiglitazone_mouse | phenotype non diabetic normal control heterozygous mutation leptin receptor (db) age 15 weeks renal cortex vs phenotype type 2 diabetic homozygous mutation leptin receptor (db) age 15 weeks renal cortex |
| GSE162276_4_v_3_rosiglitazone_mouse | lf c control mouse disease healthy diet low fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE162276_5_v_0_rosiglitazone_mouse | hf c control mouse disease non alcoholic steatohepatitis diet high fat id pg liver vs hf ko hepatocyte specfic ppargamma hepatocytes nash disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE88706_3_v_0_rosiglitazone_mouse | carotid artery rbp7 wild type treated rosiglitazone replicate strain/background c57bl/6j /variation sex male vs carotid artery rbp7 knock treated rosiglitazone replicate strain/background c57bl/6j /variation sex male |
| GSE88706_1_v_0_rosiglitazone_mouse | carotid artery rbp7 wild type treated dmso replicate strain/background c57bl/6j /variation sex male vs carotid artery rbp7 knock treated rosiglitazone replicate strain/background c57bl/6j /variation sex male |
| GSE162276_4_v_0_rosiglitazone_mouse | lf c control mouse disease healthy diet low fat id pg liver vs hf ko hepatocyte specfic ppargamma hepatocytes nash disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE171826_1_v_0_rosiglitazone_human | immortalized human bone marrow mesenchymal stromal cells htert (imsc3) transformation telomerase transformed untreated vs adiopcyte derived imsc3 rosiglitazone added induction media treated adipocytes |
| GSE214596,GSE214598_1_v_2_rosiglitazone_mouse | rna seq map cells control cell line immortalized mouse adipocyte progenitor (map) vehicle vs rna seq map cells rosi3d cell line immortalized mouse adipocyte progenitor (map) rosiglitazone time 3d |
| GSE162276_5_v_3_rosiglitazone_mouse | hf c control mouse disease non alcoholic steatohepatitis diet high fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE193402_0_v_2_imatinib_human | renal angiomyolipoma cells (untreated) disease tuberous sclerosis untreated drug none cell line umb1949 (atcc #crl 4004 rrid cvcl c471) vs renal angiomyolipoma cells (0.05um rapamycin) disease tuberous sclerosis treated 0.05um rapamycin 24hrs drug (#r 5000 lc laboratories) cell line umb1949 (atcc #crl 4004 rrid cvcl c471) |
| GSE193402_0_v_4_imatinib_human | renal angiomyolipoma cells (untreated) disease tuberous sclerosis untreated drug none cell line umb1949 (atcc #crl 4004 rrid cvcl c471) vs renal angiomyolipoma cells (1um imatinib) disease tuberous sclerosis treated 1um imatinib 24hrs drug (novartis) cell line umb1949 (atcc #crl 4004 rrid cvcl c471) |
| GSE193402_0_v_1_imatinib_human | renal angiomyolipoma cells (untreated) disease tuberous sclerosis untreated drug none cell line umb1949 (atcc #crl 4004 rrid cvcl c471) vs renal angiomyolipoma cells (10um imatinib) disease tuberous sclerosis treated 10um imatinib 24hrs drug (novartis) cell line umb1949 (atcc #crl 4004 rrid cvcl c471) |
| GSE140322_0_v_1_imatinib_human | srsf1 dmso origin human derived blast crisis cml cell line k562 atcc vs vector im origin human derived blast crisis cml cell line k562 atcc |
| GSE193402_0_v_3_imatinib_human | renal angiomyolipoma cells (untreated) disease tuberous sclerosis untreated drug none cell line umb1949 (atcc #crl 4004 rrid cvcl c471) vs renal angiomyolipoma cells (1um rapamycin) disease tuberous sclerosis treated 1um rapamycin 24hrs drug (#r 5000 lc laboratories) cell line umb1949 (atcc #crl 4004 rrid cvcl c471) |
| GSE140322_3_v_1_imatinib_human | vector dmso origin human derived blast crisis cml cell line k562 atcc vs vector im origin human derived blast crisis cml cell line k562 atcc |
| GSE140322_0_v_2_imatinib_human | srsf1 dmso origin human derived blast crisis cml cell line k562 atcc vs srsf1 im origin human derived blast crisis cml cell line k562 atcc |
| GSE155800_1_v_0_imatinib_human | adjacent normal sample gastrointestinal stromal disease group imatinib sensitive vs tumor sample gastrointestinal stromal disease group imatinib |
| GSE140322_3_v_2_imatinib_human | vector dmso origin human derived blast crisis cml cell line k562 atcc vs srsf1 im origin human derived blast crisis cml cell line k562 atcc |
| GSE252988_0_v_1_lefamulin_human | hepg2 cells ctrl cell line dmso vs hepg2 cells lef cell line lefamulin |
| GSE252987_0_v_3_lefamulin_mouse | hepg2 derived xenograft ctrl tumor vehicle vs hepg2 derived xenograft sor tumor sorafenib |
| GSE128730_3_v_2_neratinib_human | 5637 nr control [272 ds cell line 5637nr phenotype neratinib resistant cells vs 5637 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_7_v_2_neratinib_human | ovcar8 nr control [272 ds cell line ovcar8nr phenotype neratinib resistant cells vs 5637 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_0_v_2_neratinib_human | 5637 parental control [272 ds cell line phenotype vs 5637 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_3_v_5_neratinib_human | 5637 nr control [272 ds cell line 5637nr phenotype neratinib resistant cells vs ovcar8 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_0_v_5_neratinib_human | 5637 parental control [272 ds cell line phenotype vs ovcar8 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_4_v_6_neratinib_human | ovcar8 parental control [272 ds cell line phenotype vs 5637 nr tx [272 ds cell line 5637nr phenotype neratinib resistant cells |
| GSE128730_4_v_2_neratinib_human | ovcar8 parental control [272 ds cell line phenotype vs 5637 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_0_v_1_neratinib_human | 5637 parental control [272 ds cell line phenotype vs ovcar8 nr tx [272 ds cell line ovcar8nr phenotype neratinib resistant cells |
| GSE130396_0_v_2_neratinib_human | a375wt dt cell line background a375 human brafv600e mutant melanoma /variation wild type culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs a375flag pi3kmut cell line background a375 human brafv600e mutant melanoma /variation pi3k h1047r overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE128730_7_v_6_neratinib_human | ovcar8 nr control [272 ds cell line ovcar8nr phenotype neratinib resistant cells vs 5637 nr tx [272 ds cell line 5637nr phenotype neratinib resistant cells |
| GSE128730_3_v_6_neratinib_human | 5637 nr control [272 ds cell line 5637nr phenotype neratinib resistant cells vs 5637 nr tx [272 ds cell line 5637nr phenotype neratinib resistant cells |
| GSE128730_4_v_5_neratinib_human | ovcar8 parental control [272 ds cell line phenotype vs ovcar8 parental tx [272 ds cell line phenotype neratinib |
| GSE130396_1_v_2_neratinib_human | ko11 dmso cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs a375flag pi3kmut cell line background a375 human brafv600e mutant melanoma /variation pi3k h1047r overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE128730_7_v_1_neratinib_human | ovcar8 nr control [272 ds cell line ovcar8nr phenotype neratinib resistant cells vs ovcar8 nr tx [272 ds cell line ovcar8nr phenotype neratinib resistant cells |
| GSE130396_7_v_6_neratinib_human | a375flagpi3kwt cell line background a375 human brafv600e mutant melanoma /variation pi3k wt overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs dt cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE130396_1_v_6_neratinib_human | ko11 dmso cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs dt cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE128730_3_v_1_neratinib_human | 5637 nr control [272 ds cell line 5637nr phenotype neratinib resistant cells vs ovcar8 nr tx [272 ds cell line ovcar8nr phenotype neratinib resistant cells |
| GSE130396_0_v_6_neratinib_human | a375wt dt cell line background a375 human brafv600e mutant melanoma /variation wild type culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs dt cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE128730_0_v_6_neratinib_human | 5637 parental control [272 ds cell line phenotype vs 5637 nr tx [272 ds cell line 5637nr phenotype neratinib resistant cells |
| GSE130396_8_v_6_neratinib_human | a375wt dmso cell line background a375 human brafv600e mutant melanoma /variation wild type culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs dt cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE128730_7_v_5_neratinib_human | ovcar8 nr control [272 ds cell line ovcar8nr phenotype neratinib resistant cells vs ovcar8 parental tx [272 ds cell line phenotype neratinib |
| GSE128730_4_v_1_neratinib_human | ovcar8 parental control [272 ds cell line phenotype vs ovcar8 nr tx [272 ds cell line ovcar8nr phenotype neratinib resistant cells |
| GSE135686_2_v_3_etomoxir_human | cont cell line primary pancreatic tumor control vs mcm cell line primary pancreatic tumor macrophage conditioned media |
| GSE115542_5_v_1_digoxin_human | icb 1078mb 18342 control s8 brain group 4 disease state medulloblastoma vs icb 1078mb 22241 digoxin bio s13 brain treat group 4 disease state medulloblastoma |
| GSE115542_5_v_0_digoxin_human | icb 1078mb 18342 control s8 brain group 4 disease state medulloblastoma vs icb 2555mb 20908 s23 brain group 3 disease state medulloblastoma |
| GSE115542_5_v_4_digoxin_human | icb 1078mb 18342 control s8 brain group 4 disease state medulloblastoma vs icb 1078mb 22234 digoxin bio s12 brain treat group 4 disease state medulloblastoma |
| GSE112202_5_v_2_digoxin_human | gender female age /variation tert wild type tumor histology thyroid cancer agent none non medullary carcinoma vs gender age /variation tert tumor histology follicular thyroid cancer oncocytic variant agent digoxin non medullary carcinoma |
| GSE115542_2_v_1_digoxin_human | icb 1078mb 18343 control s9 brain group 4 disease state medulloblastoma vs icb 1078mb 22241 digoxin bio s13 brain treat group 4 disease state medulloblastoma |
| GSE115542_5_v_3_digoxin_human | icb 1078mb 18342 control s8 brain group 4 disease state medulloblastoma vs icb 2555mb 21659 digoxin bio s14 brain treat group 3 disease state medulloblastoma |
| GSE115542_2_v_3_digoxin_human | icb 1078mb 18343 control s9 brain group 4 disease state medulloblastoma vs icb 2555mb 21659 digoxin bio s14 brain treat group 3 disease state medulloblastoma |
| GSE112202_5_v_0_digoxin_human | gender female age /variation tert wild type tumor histology thyroid cancer agent none non medullary carcinoma vs gender age /variation tert mutant tumor histology thyroid cancer agent digoxin non medullary carcinoma |
| GSE112202_4_v_1_digoxin_human | gender age /variation tert wild type tumor histology follicular thyroid cancer oncocytic variant agent none non medullary carcinoma vs gender age /variation tert mutant tumor histology papillary thyroid cancer agent none non medullary carcinoma |
| GSE112202_4_v_0_digoxin_human | gender age /variation tert wild type tumor histology follicular thyroid cancer oncocytic variant agent none non medullary carcinoma vs gender age /variation tert mutant tumor histology thyroid cancer agent digoxin non medullary carcinoma |
| GSE115542_2_v_4_digoxin_human | icb 1078mb 18343 control s9 brain group 4 disease state medulloblastoma vs icb 1078mb 22234 digoxin bio s12 brain treat group 4 disease state medulloblastoma |
| GSE115542_2_v_0_digoxin_human | icb 1078mb 18343 control s9 brain group 4 disease state medulloblastoma vs icb 2555mb 20908 s23 brain group 3 disease state medulloblastoma |
| GSE112202_6_v_1_digoxin_human | gender female age /variation tert wild type tumor histology thyroid cancer agent digoxin non medullary carcinoma vs gender age /variation tert mutant tumor histology papillary thyroid cancer agent none non medullary carcinoma |
| GSE116810_5_v_0_selinexor_human | jeko1 dmso 6h b cell lymphoma line vs jeko1 ib 6h b cell lymphoma line |
| GSE181003_3_v_0_selinexor_human | ociaml2 dmso leukemic blasts disease aml cell line vs ociaml2 selinexor leukemic blasts disease aml (200nm) 36hours cell line |
| GSE116810_2_v_0_selinexor_human | maver dmso 6h b cell lymphoma line vs jeko1 ib 6h b cell lymphoma line |
| GSE116810_5_v_1_selinexor_human | jeko1 dmso 6h b cell lymphoma line vs maver ib 6h b cell lymphoma line |
| GSE137702_2_v_4_selinexor_human | vehicle tumor type diffuse intrinsic pontine glioma cell line control cultured cells vs selinexor tumor type diffuse intrinsic pontine glioma cell line nm cultured cells |
| GSE116810_2_v_4_selinexor_human | maver dmso 6h b cell lymphoma line vs maver kpt 6h b cell lymphoma line |
| GSE116810_2_v_1_selinexor_human | maver dmso 6h b cell lymphoma line vs maver ib 6h b cell lymphoma line |
| GSE116810_5_v_3_selinexor_human | jeko1 dmso 6h b cell lymphoma line vs maver pu 6h b cell lymphoma line |
| GSE116810_5_v_4_selinexor_human | jeko1 dmso 6h b cell lymphoma line vs maver kpt 6h b cell lymphoma line |
| GSE181003_1_v_0_selinexor_human | molm13 dmso leukemic blasts disease aml molm 13 cell line vs ociaml2 selinexor leukemic blasts disease aml (200nm) 36hours cell line |
| GSE137702_2_v_1_selinexor_human | vehicle tumor type diffuse intrinsic pontine glioma cell line control cultured cells vs bt 245 tumor type diffuse midline glioma (thalamus) cell line cultured cells |
| GSE181003_1_v_2_selinexor_human | molm13 dmso leukemic blasts disease aml molm 13 cell line vs molm13 selinexor leukemic blasts disease aml (75nm) 36hours molm 13 cell line |
| GSE116810_2_v_3_selinexor_human | maver dmso 6h b cell lymphoma line vs maver pu 6h b cell lymphoma line |
| GSE181003_3_v_2_selinexor_human | ociaml2 dmso leukemic blasts disease aml cell line vs molm13 selinexor leukemic blasts disease aml (75nm) 36hours molm 13 cell line |
| GSE202175_1_v_0_triptolide_mouse | nc group replicate liver normal saline (nc) method oral gavage 7 days vs mtp+cr group replicate liver 300î¼g/kg moderate dose tp + 100 mg/kg cr (mtp+cr) method oral gavage 7 days |
| GSE74490_0_v_1_triptolide_mouse | caf 1 control strain c57bl/6 fibroblasts krasg12d trp53r172h pdx cre (kpc) pancreatic cancer vs caf 1 triptolide strain c57bl/6 fibroblasts krasg12d trp53r172h pdx cre (kpc) pancreatic cancer |
| GSE202175_1_v_2_triptolide_mouse | nc group replicate liver normal saline (nc) method oral gavage 7 days vs mtp group replicate liver 300î¼g/kg moderate dose tp (mtp) method oral gavage 7 days |
| GSE143139,GSE143141_1_v_3_elacridar_mouse | wt replicate strain c57bl/6 cd8 cells day 6 vitro generated 10 u/ml rhil 2 vs mdr1ko replicate strain c57bl/6 abcb1a/1b / cd8 cells day 6 vitro generated 10 u/ml rhil 2 |
| GSE125157_1_v_0_piceatannol_mouse | bmdm ctrl strain c57bl/6 bone marrow derived macrophage agent control vs bmdm piceatannol strain c57bl/6 bone marrow derived macrophage agent |
| GSE168604,GSE183859_1_v_0_selumetinib_human | ht29 untreated ccnb1 colorectal cancer cell line growth media rpmi 1640 fixed/unfixed glyoxal fixed stained sorted vs ht29 selumetinib ccnb1 + colorectal cancer cell line growth media rpmi 1640 1um (24 hours) fixed/unfixed glyoxal fixed stained sorted |
| GSE168602,GSE168604_2_v_1_selumetinib_human | colo205 untreated ccnb1 colorectal cancer cell line growth media rpmi 1640 fixed/unfixed glyoxal fixed stained sorted vs colo205 selumetinib ccnb1 colorectal cancer cell line growth media rpmi 1640 + 1um (24 hours) fixed/unfixed glyoxal fixed stained sorted |
| GSE168602,GSE168604_2_v_6_selumetinib_human | colo205 untreated ccnb1 colorectal cancer cell line growth media rpmi 1640 fixed/unfixed glyoxal fixed stained sorted vs colo205 hr selumetinib colorectal cancer cell line growth media rpmi 1640 + 1um fixed/unfixed unfixed processed direct rna |
| GSE205021_3_v_1_fenofibrate_mouse | control liver vs high fat diet liver |
| GSE205021_3_v_2_fenofibrate_mouse | control liver vs fenofibrate liver high fat diet + |
| GSE142588_2_v_1_cinobufagin_human | huh 7 control cell line none liver cancer cells vs hepg2 treated cinobufagin h cell line liver cancer cells |
| GSE142588_2_v_0_cinobufagin_human | huh 7 control cell line none liver cancer cells vs huh 7 treated cinobufagin 24 h cell line liver cancer cells |
| GSE142588_2_v_3_cinobufagin_human | huh 7 control cell line none liver cancer cells vs huh 7 treated cinobufagin 12 h cell line liver cancer cells |
| GSE147876,GSE147877_2_v_0_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42d maintenance veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE130246_1_v_0_enzalutamide_human | 4970 gnt enza cell line lncap prostate cancer /variation control (sgnt) 10 um enzalutamide 5 days sgnt enz vs 4970 gtle3 ut cell line lncap prostate cancer /variation tle3ko (sgtle3) vehicle 5 days sgtle3 |
| GSE81796_0_v_3_enzalutamide_human | control tag cell line prostate cancer c4 2 vs enz tag cell line prostate cancer c4 2 |
| GSE258991_1_v_2_enzalutamide_human | ailncap14 cells sicontrol cell line human prostate cancer vs ailncap14 cells ar sirna cell line human prostate cancer |
| GSE147876,GSE147877_4_v_0_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42d maintenance veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE115395_2_v_3_enzalutamide_human | control illumina truseq stranded mrna c] prostate epithelial passages 10 agent vehicle cell line lncap derived metastatic site left supraclavicular lymph node vs r + enz illumina truseq stranded mrna mdv] prostate epithelial passages 10 agent androgen enzalutamide cell line lncap derived metastatic site left supraclavicular lymph node |
| GSE147876,GSE147877_2_v_1_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs v16d mdv cell line prostate carcinoma castration resistant enzalutamide |
| GSE115395_2_v_5_enzalutamide_human | control illumina truseq stranded mrna c] prostate epithelial passages 10 agent vehicle cell line lncap derived metastatic site left supraclavicular lymph node vs r (androgen) illumina truseq stranded mrna r] prostate epithelial passages 10 agent androgen cell line lncap derived metastatic site left supraclavicular lymph node |
| GSE147876,GSE147877_4_v_9_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42f maintenance mdv cell line mr42d prostate carcinoma enzalutamide resistant |
| GSE115395_2_v_0_enzalutamide_human | control illumina truseq stranded mrna c] prostate epithelial passages 10 agent vehicle cell line lncap derived metastatic site left supraclavicular lymph node vs r + ( ) 450 illumina truseq stranded mrna minus450] prostate epithelial passages 10 agent androgen jj )450 cell line lncap derived metastatic site left supraclavicular lymph node |
| GSE125014_6_v_4_enzalutamide_human | lncap sicontrol mdv cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) enzalutamide replicate biological cancer cells vs lncap vehicle rnaseq cell line prostate cancer disease state adenocarcinoma cells |
| GSE125014_1_v_5_enzalutamide_human | lncap sicontrol vehicle cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) replicate biological cancer cells vs lncap sigata2 vehicle cell line prostate adenocarcinoma sirna (dharmacaon cat#l 009024 02 0020) replicate biological cancer cells |
| GSE110802_1_v_0_enzalutamide_human | c4 2b control parental cell line bone metastatic lncap derivative vs c4 2b enz resistant parental cell line bone metastatic lncap derivative enzalutamide |
| GSE258991_1_v_4_enzalutamide_human | ailncap14 cells sicontrol cell line human prostate cancer vs ailncap14 cells cell line human prostate cancer |
| GSE125014_6_v_5_enzalutamide_human | lncap sicontrol mdv cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) enzalutamide replicate biological cancer cells vs lncap sigata2 vehicle cell line prostate adenocarcinoma sirna (dharmacaon cat#l 009024 02 0020) replicate biological cancer cells |
| GSE147876,GSE147877_4_v_10_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42d washout mdv cell line prostate carcinoma enzalutamide resistant |
| GSE163240_3_v_0_enzalutamide_human | lncap enzar dmso rep cell line enzalutamide resistant subline vs ducap enzar rep cell line enzalutamide resistant subline |
| GSE199538,GSE199539_0_v_1_enzalutamide_human | lncap sgnc condition control cells cell line prostate cancer vs lncap sgprrx2 enz condition prrx2 overexpressing cells cell line prostate cancer |
| GSE138939_2_v_3_enzalutamide_human | seq10 vc cell line vcap ctrl pretreatment treated ethanol time 4 month 1um enzalutamide vs seq10 ver cell line vcap enz pretreatment treated 1um enzalutamide time 4 month |
| GSE130246_2_v_0_enzalutamide_human | 4970 gnt ut cell line lncap prostate cancer /variation control (sgnt) vehicle 5 days sgnt vs 4970 gtle3 ut cell line lncap prostate cancer /variation tle3ko (sgtle3) vehicle 5 days sgtle3 |
| GSE161302,GSE161304_1_v_2_enzalutamide_human | lncap mettl3 dmso rna seq cell line shrna 0.1% vs lncap mettl3 enz rna seq cell line shrna 10 um enzalutamide |
| GSE258991_5_v_4_enzalutamide_human | lncap cells sicontrol cell line human prostate cancer vs ailncap14 cells cell line human prostate cancer |
| GSE130246_1_v_3_enzalutamide_human | 4970 gnt enza cell line lncap prostate cancer /variation control (sgnt) 10 um enzalutamide 5 days sgnt enz vs 4970 10 gtle3 enza cell line lncap prostate cancer /variation tle3ko (sgtle3) um enzalutamide 5 days sgtle3 enz |
| GSE147876,GSE147877_4_v_3_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42f washout mdv cell line prostate carcinoma enzalutamide resistant |
| GSE147876,GSE147877_2_v_7_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42d maintenance arv 771 cell line prostate carcinoma enzalutamide resistant |
| GSE147876,GSE147877_4_v_5_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs v16d veh cell line prostate carcinoma castration resistant vehicle |
| GSE125014_6_v_3_enzalutamide_human | lncap sicontrol mdv cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) enzalutamide replicate biological cancer cells vs lncap mdv rnaseq cell line prostate cancer disease state adenocarcinoma time cells |
| GSE199538,GSE199539_2_v_1_enzalutamide_human | lncap sgprrx2 dmso condition prrx2 overexpressing cells cell line prostate cancer vs lncap sgprrx2 enz condition prrx2 overexpressing cells cell line prostate cancer |
| GSE147876,GSE147877_2_v_3_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42f washout mdv cell line prostate carcinoma enzalutamide resistant |
| GSE147876,GSE147877_4_v_8_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42f washout veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE147876,GSE147877_2_v_8_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42f washout veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE147876,GSE147877_2_v_10_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42d washout mdv cell line prostate carcinoma enzalutamide resistant |
| GSE203362_0_v_1_enzalutamide_human | rna seq 22rv1 ctrl cell line prostate cancer none vs rna seq 22rv1 ck1î± ko cell line prostate cancer none |
| GSE81796_0_v_1_enzalutamide_human | control tag cell line prostate cancer c4 2 vs aclyi tag cell line prostate cancer c4 2 |
| GSE197630_1_v_0_enzalutamide_human | c4 2b enzr cell control line prostate cancer /variation negative vs c4 2b enzr cell ruvbl1 knockdown line prostate cancer /variation |
| GSE147876,GSE147877_2_v_5_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs v16d veh cell line prostate carcinoma castration resistant vehicle |
| GSE150895,GSE150896_0_v_1_enzalutamide_human | c4 2b enzr cell control line prostate cancer /variation negative vs c4 2b enzr cell kif15 knockdown line prostate cancer /variation knocked |
| GSE125014_6_v_2_enzalutamide_human | lncap sicontrol mdv cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) enzalutamide replicate biological cancer cells vs lncap sigata2 mdv cell line prostate adenocarcinoma sirna (dharmacaon cat#l 009024 02 0020) enzalutamide replicate biological cancer cells |
| GSE258991_1_v_0_enzalutamide_human | ailncap14 cells sicontrol cell line human prostate cancer vs lncap cells ar sirna cell line human prostate cancer |
| GSE125014_1_v_4_enzalutamide_human | lncap sicontrol vehicle cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) replicate biological cancer cells vs lncap vehicle rnaseq cell line prostate cancer disease state adenocarcinoma cells |
| GSE147876,GSE147877_2_v_6_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42d maintenance jq1 cell line prostate carcinoma enzalutamide resistant |
| GSE147876,GSE147877_2_v_9_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42f maintenance mdv cell line mr42d prostate carcinoma enzalutamide resistant |
| GSE125014_1_v_3_enzalutamide_human | lncap sicontrol vehicle cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) replicate biological cancer cells vs lncap mdv rnaseq cell line prostate cancer disease state adenocarcinoma time cells |
| GSE163240_3_v_4_enzalutamide_human | lncap enzar dmso rep cell line enzalutamide resistant subline vs ducap 10 âµm rep cell line microm |
| GSE130246_2_v_3_enzalutamide_human | 4970 gnt ut cell line lncap prostate cancer /variation control (sgnt) vehicle 5 days sgnt vs 4970 10 gtle3 enza cell line lncap prostate cancer /variation tle3ko (sgtle3) um enzalutamide 5 days sgtle3 enz |
| GSE81796_0_v_2_enzalutamide_human | control tag cell line prostate cancer c4 2 vs combination tag cell line prostate cancer c4 2 |
| GSE151083_0_v_1_enzalutamide_human | c42 b cell line human prostate cancer derived subcutaneous lncap xenografts castrated nude mice phenotype control vs c42 b enz cell line human prostate cancer derived subcutaneous lncap xenografts castrated nude mice phenotype enzalutamide resistant cells |
| GSE147876,GSE147877_4_v_11_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42d washout veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE258991_5_v_0_enzalutamide_human | lncap cells sicontrol cell line human prostate cancer vs lncap cells ar sirna cell line human prostate cancer |
| GSE163240_2_v_0_enzalutamide_human | lncap dmso rep cell line vs ducap enzar rep cell line enzalutamide resistant subline |
| GSE115395_2_v_4_enzalutamide_human | control illumina truseq stranded mrna c] prostate epithelial passages 10 agent vehicle cell line lncap derived metastatic site left supraclavicular lymph node vs r + (+) 450 illumina truseq stranded mrna plus450] prostate epithelial passages 10 agent androgen jj cell line lncap derived metastatic site left supraclavicular lymph node |
| GSE115395_2_v_1_enzalutamide_human | control illumina truseq stranded mrna c] prostate epithelial passages 10 agent vehicle cell line lncap derived metastatic site left supraclavicular lymph node vs r + imtppe illumina truseq stranded mrna 10] prostate epithelial passages 10 agent androgen cell line lncap derived metastatic site left supraclavicular lymph node |
| GSE163240_2_v_4_enzalutamide_human | lncap dmso rep cell line vs ducap 10 âµm rep cell line microm |
| GSE147876,GSE147877_4_v_7_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42d maintenance arv 771 cell line prostate carcinoma enzalutamide resistant |
| GSE258991_5_v_2_enzalutamide_human | lncap cells sicontrol cell line human prostate cancer vs ailncap14 cells ar sirna cell line human prostate cancer |
| GSE125014_1_v_2_enzalutamide_human | lncap sicontrol vehicle cell line prostate adenocarcinoma sirna (dharmacon cat# 001810 10 50) replicate biological cancer cells vs lncap sigata2 mdv cell line prostate adenocarcinoma sirna (dharmacaon cat#l 009024 02 0020) enzalutamide replicate biological cancer cells |
| GSE161302,GSE161304_1_v_0_enzalutamide_human | lncap mettl3 dmso rna seq cell line shrna 0.1% vs lncap gfp sh enz rna seq cell line shrna non targeting 10 um enzalutamide |
| GSE220097_4_v_1_enzalutamide_human | lncap r1881 dmso 22h prostate cancer cell line time 1nm vs lncap r1881 enzalutamide 22h prostate cancer cell line time 1nm + 2um |
| GSE147876,GSE147877_4_v_1_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs v16d mdv cell line prostate carcinoma castration resistant enzalutamide |
| GSE147876,GSE147877_2_v_11_enzalutamide_human | lncap veh cell line prostate carcinoma wild type vehicle vs mr42d washout veh cell line prostate carcinoma enzalutamide resistant vehicle |
| GSE147876,GSE147877_4_v_6_enzalutamide_human | lncap mdv cell line prostate carcinoma wild type enzalutamide vs mr42d maintenance jq1 cell line prostate carcinoma enzalutamide resistant |
| GSE203362_0_v_2_enzalutamide_human | rna seq 22rv1 ctrl cell line prostate cancer none vs rna seq 22rv1 ck1î± oe cell line prostate cancer none |
| GSE159678_4_v_2_chloroquine_human | rd r d1 3 monocytes disease state healthy donor hkca+hcq icu admission na vs cp 2 rna monocytes disease state covid19 days hcq icu admission |
| GSE159678_4_v_3_chloroquine_human | rd r d1 3 monocytes disease state healthy donor hkca+hcq icu admission na vs cp 1 rna monocytes disease state covid19 0 days hcq icu admission |
| GSE159678_6_v_2_chloroquine_human | rd r d1 monocytes disease state healthy donor icu admission na vs cp 2 rna monocytes disease state covid19 days hcq icu admission |
| GSE159678_4_v_7_chloroquine_human | rd r d1 3 monocytes disease state healthy donor hkca+hcq icu admission na vs cp rna monocytes disease state covid19 days hcq icu admission |
| GSE128844_0_v_3_chloroquine_human | myoblast normal (icdf) skin fibroblasts transdifferentiated vs myoblast treated 10 dm1 (ipdf) skin fibroblasts transdifferentiated chloroquine 10m |
| GSE209582_1_v_2_chloroquine_human | te11 cells vehicle control replicate cell line esophageal squamous carcinoma 0.1% dmso vs te11 cells 5 fluorouracil replicate cell line esophageal squamous carcinoma 25 um |
| GSE193157_0_v_1_chloroquine_human | high progression free survival group (pfs) rate patientid ldh level normal ffpe melanoma tumor vs low progression free survival group (pfs) rate patientid ldh level elevated ffpe melanoma tumor |
| GSE128844_0_v_2_chloroquine_human | myoblast normal (icdf) skin fibroblasts transdifferentiated vs myoblast dm1 (ipdf) skin fibroblasts transdifferentiated |
| GSE193157_3_v_1_chloroquine_human | low progression free survival group (pfs) rate patientid ldh level normal ffpe melanoma tumor vs low progression free survival group (pfs) rate patientid ldh level elevated ffpe melanoma tumor |
| GSE209582_1_v_3_chloroquine_human | te11 cells vehicle control replicate cell line esophageal squamous carcinoma 0.1% dmso vs te11 cells chloroquine 5 fluorouracil replicate cell line esophageal squamous carcinoma 10 um + 25 |
| GSE128844_0_v_1_chloroquine_human | myoblast normal (icdf) skin fibroblasts transdifferentiated vs myoblast treated 01 dm1 (ipdf) skin fibroblasts transdifferentiated chloroquine 0.1m |
| GSE159678_6_v_3_chloroquine_human | rd r d1 monocytes disease state healthy donor icu admission na vs cp 1 rna monocytes disease state covid19 0 days hcq icu admission |
| GSE159678_6_v_7_chloroquine_human | rd r d1 monocytes disease state healthy donor icu admission na vs cp rna monocytes disease state covid19 days hcq icu admission |
| GSE209582_1_v_0_chloroquine_human | te11 cells vehicle control replicate cell line esophageal squamous carcinoma 0.1% dmso vs te11 cells chloroquine replicate cell line esophageal squamous carcinoma 10 um |
| GSE218060_5_v_6_decitabine_human | pdx1 biol rep dmso spleen cell line leukemic blasts nsg vs pdx4 biol rep dac spleen cell line leukemic blasts nsg |
| GSE74251_0_v_1_decitabine_human | yb5 cntrl cell line colon cancer colorectal adenocarcinoma duke' type c grade iv gender female vs mcf7 100nm dac cell line breast cancer mammary gland er status positive gender female |
| GSE218060_1_v_4_decitabine_human | pdx5 biol rep dmso bone marrow cell line leukemic blasts nsg vs pdx1 biol rep dac spleen cell line leukemic blasts nsg |
| GSE188570,GSE188571_3_v_2_decitabine_human | smz1 dmso cell line lymphoma 72hrs vs smz1 guad cell line lymphoma guadecitabine 100nm 72hrs |
| GSE218060_1_v_6_decitabine_human | pdx5 biol rep dmso bone marrow cell line leukemic blasts nsg vs pdx4 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_2_v_3_decitabine_human | pdx4 biol rep dmso spleen cell line leukemic blasts nsg vs pdx5 biol rep dac bone marrow cell line leukemic blasts nsg |
| GSE74251_2_v_3_decitabine_human | mcf7 cntrl cell line breast cancer mammary gland er status positive gender female vs yb5 1î¼m dac cell line colon cancer colorectal adenocarcinoma duke' type c grade iv gender female |
| GSE218060_5_v_0_decitabine_human | pdx1 biol rep dmso spleen cell line leukemic blasts nsg vs pdx3 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_5_v_3_decitabine_human | pdx1 biol rep dmso spleen cell line leukemic blasts nsg vs pdx5 biol rep dac bone marrow cell line leukemic blasts nsg |
| GSE153443_1_v_3_decitabine_human | dmso cell line glioma cells vs dac cell line glioma cells |
| GSE218060_1_v_0_decitabine_human | pdx5 biol rep dmso bone marrow cell line leukemic blasts nsg vs pdx3 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_2_v_0_decitabine_human | pdx4 biol rep dmso spleen cell line leukemic blasts nsg vs pdx3 biol rep dac spleen cell line leukemic blasts nsg |
| GSE216757_0_v_1_decitabine_human | dmso pg20 4h cell line primary human gingival fibroblast vs dac medium 4h cell line primary human gingival fibroblast |
| GSE101336_1_v_2_decitabine_mouse | mouse allograft untreated model kpc derived tumor cells allografted syngeneic host mice krasg12d/+ trp53r172h/+ pdx 1 cre none sc injection rin subcutaneous vs mouse 1 kpc hop dac model transgenic krasg12d/+ trp53r172h/+ pdx cre 1um 3 times every 48h rin head pancreas |
| GSE74251_2_v_1_decitabine_human | mcf7 cntrl cell line breast cancer mammary gland er status positive gender female vs mcf7 100nm dac cell line breast cancer mammary gland er status positive gender female |
| GSE188570,GSE188571_5_v_1_decitabine_human | hut78 dmso cell line lymphoma 72hrs vs hut78 guad cell line lymphoma guadecitabine 100nm 72hrs |
| GSE101336_1_v_3_decitabine_mouse | mouse allograft untreated model kpc derived tumor cells allografted syngeneic host mice krasg12d/+ trp53r172h/+ pdx 1 cre none sc injection rin subcutaneous vs mouse kpc hop pbs model transgenic krasg12d/+ trp53r172h/+ pdx 1 cre 3 times every 48h rin head pancreas |
| GSE216757_4_v_2_decitabine_human | dmso medium 4h cell line primary human gingival fibroblast vs dac pg20 4h cell line primary human gingival fibroblast |
| GSE188570,GSE188571_5_v_0_decitabine_human | hut78 dmso cell line lymphoma 72hrs vs smz1 aza cell line lymphoma azacitidine 100nm 72hrs |
| GSE218060_2_v_6_decitabine_human | pdx4 biol rep dmso spleen cell line leukemic blasts nsg vs pdx4 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_5_v_4_decitabine_human | pdx1 biol rep dmso spleen cell line leukemic blasts nsg vs pdx1 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_1_v_3_decitabine_human | pdx5 biol rep dmso bone marrow cell line leukemic blasts nsg vs pdx5 biol rep dac bone marrow cell line leukemic blasts nsg |
| GSE216757_4_v_1_decitabine_human | dmso medium 4h cell line primary human gingival fibroblast vs dac medium 4h cell line primary human gingival fibroblast |
| GSE218060_2_v_4_decitabine_human | pdx4 biol rep dmso spleen cell line leukemic blasts nsg vs pdx1 biol rep dac spleen cell line leukemic blasts nsg |
| GSE153443_1_v_2_decitabine_human | dmso cell line glioma cells vs su ao3 cell line glioma cells |
| GSE240439_1_v_3_decitabine_human | hl60 dmso hematopoetic cell line hl 60 non adherent vs hl60 simva hematopoetic cell line hl 60 non adherent simvastatin |
| GSE188570,GSE188571_3_v_4_decitabine_human | smz1 dmso cell line lymphoma 72hrs vs hut78 aza cell line lymphoma azacitidine 100nm 72hrs |
| GSE218060_7_v_6_decitabine_human | pdx3 biol rep dmso spleen cell line leukemic blasts nsg vs pdx4 biol rep dac spleen cell line leukemic blasts nsg |
| GSE240439_1_v_0_decitabine_human | hl60 dmso hematopoetic cell line hl 60 non adherent vs hl60 combo hematopoetic cell line hl 60 non adherent decitabine+simvastatin |
| GSE218060_7_v_3_decitabine_human | pdx3 biol rep dmso spleen cell line leukemic blasts nsg vs pdx5 biol rep dac bone marrow cell line leukemic blasts nsg |
| GSE216988,GSE216989_0_v_1_decitabine_human | tamr control [rna seq] tamoxifen resistant (tamr) mcf7 cells replicate cell line vs tamr decitabine [rna seq] tamoxifen resistant (tamr) mcf7 cells replicate cell line |
| GSE218060_7_v_4_decitabine_human | pdx3 biol rep dmso spleen cell line leukemic blasts nsg vs pdx1 biol rep dac spleen cell line leukemic blasts nsg |
| GSE218060_7_v_0_decitabine_human | pdx3 biol rep dmso spleen cell line leukemic blasts nsg vs pdx3 biol rep dac spleen cell line leukemic blasts nsg |
| GSE240439_1_v_2_decitabine_human | hl60 dmso hematopoetic cell line hl 60 non adherent vs hl60 dac hematopoetic cell line hl 60 non adherent decitabine |
| GSE101336_1_v_0_decitabine_mouse | mouse allograft untreated model kpc derived tumor cells allografted syngeneic host mice krasg12d/+ trp53r172h/+ pdx 1 cre none sc injection rin subcutaneous vs mouse 11 kpc cutltured model transgenic krasg12d/+ trp53r172h/+ pdx 1 cre rin cultured tumor epithelial cells |
| GSE188570,GSE188571_3_v_1_decitabine_human | smz1 dmso cell line lymphoma 72hrs vs hut78 guad cell line lymphoma guadecitabine 100nm 72hrs |
| GSE188570,GSE188571_5_v_2_decitabine_human | hut78 dmso cell line lymphoma 72hrs vs smz1 guad cell line lymphoma guadecitabine 100nm 72hrs |
| GSE74251_0_v_3_decitabine_human | yb5 cntrl cell line colon cancer colorectal adenocarcinoma duke' type c grade iv gender female vs yb5 1î¼m dac cell line colon cancer colorectal adenocarcinoma duke' type c grade iv gender female |
| GSE216757_0_v_2_decitabine_human | dmso pg20 4h cell line primary human gingival fibroblast vs dac pg20 4h cell line primary human gingival fibroblast |
| GSE168797_4_v_6_cannabidiol_human | a549 veh mock cell line cells ace2 overexpression infection dmso vs infection cbdv rep cell line a549 cells ace2 overexpression sars cov 2 moi 3 cannabidivarin 10um |
| GSE168797_2_v_3_cannabidiol_human | a549 cell line cells ace2 overexpression infection sars cov 2 moi 3 dmso vs mock cbdv rep cell line a549 cells ace2 overexpression infection cannabidivarin 10um |
| GSE168797_1_v_3_cannabidiol_human | mock vehicle rep cell line a549 cells ace2 overexpression infection dmso vs mock cbdv rep cell line a549 cells ace2 overexpression infection cannabidivarin 10um |
| GSE168797_1_v_0_cannabidiol_human | mock vehicle rep cell line a549 cells ace2 overexpression infection dmso vs a549 cbd infect cell line cells ace2 overexpression infection sars cov 2 moi 3 cannabidiol 10um |
| GSE168797_2_v_6_cannabidiol_human | a549 cell line cells ace2 overexpression infection sars cov 2 moi 3 dmso vs infection cbdv rep cell line a549 cells ace2 overexpression sars cov 2 moi 3 cannabidivarin 10um |
| GSE168797_4_v_0_cannabidiol_human | a549 veh mock cell line cells ace2 overexpression infection dmso vs a549 cbd infect cell line cells ace2 overexpression infection sars cov 2 moi 3 cannabidiol 10um |
| GSE168797_4_v_3_cannabidiol_human | a549 veh mock cell line cells ace2 overexpression infection dmso vs mock cbdv rep cell line a549 cells ace2 overexpression infection cannabidivarin 10um |
| GSE168797_2_v_0_cannabidiol_human | a549 cell line cells ace2 overexpression infection sars cov 2 moi 3 dmso vs a549 cbd infect cell line cells ace2 overexpression infection sars cov 2 moi 3 cannabidiol 10um |
| GSE131565_1_v_0_cannabidiol_human | control group primary keratinocytes vs cbd group primary keratinocytes |
| GSE168797_4_v_5_cannabidiol_human | a549 veh mock cell line cells ace2 overexpression infection dmso vs a549 cbd mock cell line cells ace2 overexpression infection cannabidiol 10um |
| GSE168797_1_v_5_cannabidiol_human | mock vehicle rep cell line a549 cells ace2 overexpression infection dmso vs a549 cbd mock cell line cells ace2 overexpression infection cannabidiol 10um |
| GSE168797_2_v_5_cannabidiol_human | a549 cell line cells ace2 overexpression infection sars cov 2 moi 3 dmso vs a549 cbd mock cell line cells ace2 overexpression infection cannabidiol 10um |
| GSE168797_1_v_6_cannabidiol_human | mock vehicle rep cell line a549 cells ace2 overexpression infection dmso vs infection cbdv rep cell line a549 cells ace2 overexpression sars cov 2 moi 3 cannabidivarin 10um |
| GSE145790_0_v_1_bruceantin_human | veh castration resistant prostate cancer cells cell line 22rv1 agent dmso vs bct castration resistant prostate cancer cells cell line 22rv1 agent 10 nm bruceantin |
| GSE146864,GSE146866_2_v_0_fatostatin_mouse | control rnaseq primary microglia culture strain c57bl/6 dmso vehicle time (hours) 72 p1 pup vs fatostatin rnaseq primary microglia culture strain c57bl/6 5microm selleckchem s8284 time (hours) 72 p1 pup |
| GSE211215_1_v_0_pemetrexed_human | shnc lung cancer cell line pc9 brm3 wt routine culture vs shakr1b10 lung cancer cell line pc9 brm3 akr1b10 knockdown routine culture |
| GSE236228_0_v_1_penfluridol_human | control endometrium cell line ishikawa dmso vs penfluridol endometrium cell line ishikawa 5 microm |
| GSE186810,GSE186813_7_v_5_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_2_v_0_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps background c57bl/6 age 8 weeks furin ko sex anti cd3 cd28 stimulation cd8+ cells |
| GSE186810,GSE186813_7_v_0_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps background c57bl/6 age 8 weeks furin ko sex anti cd3 cd28 stimulation cd8+ cells |
| GSE158456_1_v_3_furin_mouse | unstim lymphoblast se deleted unstimulated el 4 cell line vs pmaiono lymphoblast se deleted pma (10 ng/ml) + ionomycin (100 el 4 cell line |
| GSE186810,GSE186813_3_v_5_furin_mouse | 3dps background c57bl/6 age 8 weeks wt sex anti cd3 cd28 stimulation cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_3_v_0_furin_mouse | 3dps background c57bl/6 age 8 weeks wt sex anti cd3 cd28 stimulation cd8+ cells vs 3dps background c57bl/6 age 8 weeks furin ko sex anti cd3 cd28 stimulation cd8+ cells |
| GSE158456_2_v_3_furin_mouse | unstim lymphoblast wild type unstimulated el 4 cell line vs pmaiono lymphoblast se deleted pma (10 ng/ml) + ionomycin (100 el 4 cell line |
| GSE186810,GSE186813_2_v_1_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_7_v_1_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_3_v_1_furin_mouse | 3dps background c57bl/6 age 8 weeks wt sex anti cd3 cd28 stimulation cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186812,GSE186813_0_v_1_furin_mouse | naive background strain c57bl/6 age weeks wt mouse sex male cd8+ cells vs naive background strain c57bl/6 age weeks furin ko mouse sex male cd8+ cells |
| GSE186810,GSE186813_2_v_5_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE207512,GSE207515_1_v_0_acetylcysteine_mouse | vehicle ctr tumor wap cre/pik3ca h1047r dmso vs byl rel tumor wap cre/pik3ca h1047r byl719 relapse |
| GSE207514,GSE207515_1_v_3_acetylcysteine_human | ctr veh cell line t47d breast cancer cells ctrl dmso vs nf1 byl cell line t47d breast cancer cells nf1ko byl719 |
| GSE207512,GSE207515_1_v_2_acetylcysteine_mouse | vehicle ctr tumor wap cre/pik3ca h1047r dmso vs byl non rel tumor wap cre/pik3ca h1047r byl719 stable |
| GSE207514,GSE207515_0_v_3_acetylcysteine_human | ctr byl cell line t47d breast cancer cells ctrl byl719 vs nf1 byl cell line t47d breast cancer cells nf1ko byl719 |
| GSE207514,GSE207515_2_v_3_acetylcysteine_human | nf1 veh cell line t47d breast cancer cells nf1ko dmso vs nf1 byl cell line t47d breast cancer cells nf1ko byl719 |
| GSE222047_0_v_1_imidazole_human | con cell line rpmi 8226 multiple myeloma control time 48h vs p17 cell line rpmi 8226 multiple myeloma xya1353 time 48h |
| GSE184902_3_v_1_adiponectin_mouse | bulk rna seq wt rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j vs bulk rna seq ko rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j adipor1 / |
| GSE168596_2_v_3_adiponectin_mouse | liver wt strain c57bl/6 wild type gender male age post natal day vs adipocyte ko strain c57bl/6 adipocytes specific trib1 gender male age post natal day |
| GSE168596_1_v_3_adiponectin_mouse | adipocyte wt strain c57bl/6 adipocytes wild type gender male age post natal day vs adipocyte ko strain c57bl/6 adipocytes specific trib1 gender male age post natal day |
| GSE184902_3_v_0_adiponectin_mouse | bulk rna seq wt rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j vs bulk rna seq ko retina p30 age (days) 30 strain c57bl/6j adipor1 / |
| GSE184902_4_v_1_adiponectin_mouse | bulk rna seq wt retina p30 age (days) 30 strain c57bl/6j vs bulk rna seq ko rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j adipor1 / |
| GSE242095_0_v_1_adiponectin_mouse | control kidney wt vs adipoq overexpressed kidney adiponectin overexpression |
| GSE184902_4_v_0_adiponectin_mouse | bulk rna seq wt retina p30 age (days) 30 strain c57bl/6j vs bulk rna seq ko retina p30 age (days) 30 strain c57bl/6j adipor1 / |
| GSE242647_2_v_3_adiponectin_mouse | cont cell line uv f2 cells stably expressing cadherin endotherial overexpressed untreated vs roxa apn cell line uv f2 cells stably expressing cadherin endotherial overexpressed treated roxadustat 50um adiponectin 10ug/ml 48hours |
| GSE242647_2_v_0_adiponectin_mouse | cont cell line uv f2 cells stably expressing cadherin endotherial overexpressed untreated vs roxa cell line uv f2 cells stably expressing cadherin endotherial overexpressed treated roxadustat 50um 48hours |
| GSE135030_8_v_2_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs jvm2 ibru 5um cell line lymphoid |
| GSE135030_3_v_1_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs mec1 idel 10um 48h cell line lymphoid |
| GSE135030_8_v_6_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs mec1 flud 50um 48h cell line lymphoid |
| GSE135030_11_v_5_fludarabine_human | eheb ctrl dmso cell line lymphoid vs jvm2 idel 10um cell line lymphoid |
| GSE135030_3_v_2_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs jvm2 ibru 5um cell line lymphoid |
| GSE135030_3_v_9_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs mec1 ibru 5um 48h cell line lymphoid |
| GSE135030_3_v_10_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs eheb ibru 5um cell line lymphoid |
| GSE135030_8_v_10_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs eheb ibru 5um cell line lymphoid |
| GSE135030_8_v_9_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs mec1 ibru 5um 48h cell line lymphoid |
| GSE135030_11_v_7_fludarabine_human | eheb ctrl dmso cell line lymphoid vs jvm2 flud 50um cell line lymphoid |
| GSE135030_11_v_9_fludarabine_human | eheb ctrl dmso cell line lymphoid vs mec1 ibru 5um 48h cell line lymphoid |
| GSE135030_11_v_2_fludarabine_human | eheb ctrl dmso cell line lymphoid vs jvm2 ibru 5um cell line lymphoid |
| GSE135030_3_v_6_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs mec1 flud 50um 48h cell line lymphoid |
| GSE135030_3_v_4_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs eheb flud 50um cell line lymphoid |
| GSE135030_8_v_5_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs jvm2 idel 10um cell line lymphoid |
| GSE135030_3_v_0_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs eheb idel 10um cell line lymphoid |
| GSE135030_11_v_6_fludarabine_human | eheb ctrl dmso cell line lymphoid vs mec1 flud 50um 48h cell line lymphoid |
| GSE135030_8_v_7_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs jvm2 flud 50um cell line lymphoid |
| GSE135030_11_v_4_fludarabine_human | eheb ctrl dmso cell line lymphoid vs eheb flud 50um cell line lymphoid |
| GSE135030_11_v_10_fludarabine_human | eheb ctrl dmso cell line lymphoid vs eheb ibru 5um cell line lymphoid |
| GSE135030_8_v_1_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs mec1 idel 10um 48h cell line lymphoid |
| GSE135030_8_v_4_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs eheb flud 50um cell line lymphoid |
| GSE135030_8_v_0_fludarabine_human | mec1 dmso ctrl 48h cell line lymphoid vs eheb idel 10um cell line lymphoid |
| GSE135030_11_v_1_fludarabine_human | eheb ctrl dmso cell line lymphoid vs mec1 idel 10um 48h cell line lymphoid |
| GSE135030_3_v_7_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs jvm2 flud 50um cell line lymphoid |
| GSE135030_3_v_5_fludarabine_human | jvm2 ctrl dmso cell line lymphoid vs jvm2 idel 10um cell line lymphoid |
| GSE135030_11_v_0_fludarabine_human | eheb ctrl dmso cell line lymphoid vs eheb idel 10um cell line lymphoid |
| GSE125782_0_v_1_glutamine_mouse | 3t3 wt cell line mouse embryonic fibroblast (mef) /variation wildtype p53 culture condition dmem without l glutamine (glutamine free) mef free vs 3t3 p53 cell line mouse embryonic fibroblast (mef) /variation / culture condition dmem + 2 mm l glutamine mef null complete |
| GSE183176_0_v_1_glutamine_mouse | wt il4 strain c57bl/6 peritoneal cavity macrophages condition vs basal strain c57bl/6 peritoneal cavity macrophages condition |
| GSE199204,GSE211619_4_v_7_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 shrna 1 cell line monomac6 igf2bp2 sh1 human acute myeloid leukemia (aml) cells aml |
| GSE199204,GSE211619_4_v_0_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 shrna 3 cell line monomac6 igf2bp2 sh3 human acute myeloid leukemia (aml) cells aml |
| GSE125782_3_v_2_glutamine_mouse | 3t3 wt cell line mouse embryonic fibroblast (mef) /variation wildtype p53 culture condition dmem + 2 mm l glutamine mef complete vs 3t3 p53 cell line mouse embryonic fibroblast (mef) /variation / culture condition dmem without l glutamine (glutamine free) mef null free |
| GSE155087_2_v_3_glutamine_mouse | 4su seq ctrl strain c57bl/6 zfp36fl/fl zfp36l1fl/fl control age mice 10 weeks sex mix male/female number spleen peripheral mesenteric ln cd4+ cells activated vs mrna zfp36/zfp36l1 dko strain c57bl/6 zfp36fl/fl zfp36l1fl/fl cd4 cre age mice weeks sex number 2 spleen peripheral mesenteric ln cd4+ cells activated |
| GSE125782_0_v_2_glutamine_mouse | 3t3 wt cell line mouse embryonic fibroblast (mef) /variation wildtype p53 culture condition dmem without l glutamine (glutamine free) mef free vs 3t3 p53 cell line mouse embryonic fibroblast (mef) /variation / culture condition dmem without l glutamine (glutamine free) mef null free |
| GSE199204,GSE211619_4_v_6_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 shrna 2 cell line monomac6 igf2bp2 sh2 human acute myeloid leukemia (aml) cells aml |
| GSE123825_2_v_3_glutamine_mouse | baseline ko muscle associated macrophages normal glud1 vs ctx ko muscle associated macrophages injected glud1 |
| GSE125782_3_v_1_glutamine_mouse | 3t3 wt cell line mouse embryonic fibroblast (mef) /variation wildtype p53 culture condition dmem + 2 mm l glutamine mef complete vs 3t3 p53 cell line mouse embryonic fibroblast (mef) /variation / culture condition dmem + 2 mm l glutamine mef null complete |
| GSE60691_0_v_1_glutamine_mouse | wt strain c57bl/6j muscle vs mut strain c57bl/6j sumo mutant sumoylation ar blocked muscle |
| GSE123825_1_v_3_glutamine_mouse | ctx wt muscle associated macrophages injected vs ctx ko muscle associated macrophages injected glud1 |
| GSE60691_2_v_1_glutamine_mouse | aso strain c57bl/6j wt antisense oligonucleotide targeting androgen receptor muscle vs mut strain c57bl/6j sumo mutant sumoylation ar blocked muscle |
| GSE199204,GSE211619_4_v_2_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 shns na cell line monomac6 human acute myeloid leukemia (aml) cells aml |
| GSE199204,GSE211619_4_v_5_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 ns cell line monomac6 shns human acute myeloid leukemia (aml) cells aml |
| GSE199204,GSE211619_4_v_1_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 05um 48h cell line monomac6 human acute myeloid leukemia (aml) cells cwi1 2 (0.5um) 48 hours aml |
| GSE199204,GSE211619_4_v_3_glutamine_human | mm6 dmso 48h cell line monomac6 human acute myeloid leukemia (aml) cells 48 hours aml vs mm6 shythdf2 na cell line monomac6 human acute myeloid leukemia (aml) cells aml |
| GSE209973_1_v_0_glutamine_human | pc9nt cell line pc 9 luad control vs pc9siephb2 cell line pc 9 luad ephb2 knockdown |
| GSE140274_1_v_0_glutamine_human | ctrl tumor model melanoma pdx tm00702 (jackson lab) control diet vs gln tumor model melanoma pdx tm00702 (jackson lab) high glutamine diet |
| GSE60691_2_v_3_glutamine_mouse | aso strain c57bl/6j wt antisense oligonucleotide targeting androgen receptor muscle vs krkr 1 strain c57bl/6j knockin mutation exon ar amino acids 385 518 muscle |
| GSE183176_0_v_2_glutamine_mouse | wt il4 strain c57bl/6 peritoneal cavity macrophages condition vs ko il4 strain c57bl/6 peritoneal cavity macrophages condition gls1 |
| GSE60691_0_v_3_glutamine_mouse | wt strain c57bl/6j muscle vs krkr 1 strain c57bl/6j knockin mutation exon ar amino acids 385 518 muscle |
| GSE123825_0_v_3_glutamine_mouse | baseline wt muscle associated macrophages normal vs ctx ko muscle associated macrophages injected glud1 |
| GSE153871_4_v_2_cytarabine_human | mutunt rep strain name u2os drug untreated dnmt3a r882h mutation osteosarcoma cell line vs mut24hr tr rep strain name u2os drug 24hr post dnmt3a r882h mutation osteosarcoma cell line |
| GSE153871_4_v_3_cytarabine_human | mutunt rep strain name u2os drug untreated dnmt3a r882h mutation osteosarcoma cell line vs ev24hr tr rep strain name u2os drug 24hr post empty vector osteosarcoma cell line |
| GSE234637_2_v_0_cytarabine_human | sem wildtype control treated cell line bcp wt cytarabine vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE153871_1_v_3_cytarabine_human | wt24hr tr strain name u2os drug 24hr post wild type dnmt3a osteosarcoma cell line vs ev24hr tr rep strain name u2os drug 24hr post empty vector osteosarcoma cell line |
| GSE153871_1_v_2_cytarabine_human | wt24hr tr strain name u2os drug 24hr post wild type dnmt3a osteosarcoma cell line vs mut24hr tr rep strain name u2os drug 24hr post dnmt3a r882h mutation osteosarcoma cell line |
| GSE153871_5_v_3_cytarabine_human | wtunt rep strain name u2os drug untreated wild type dnmt3a osteosarcoma cell line vs ev24hr tr rep strain name u2os drug 24hr post empty vector osteosarcoma cell line |
| GSE153871_0_v_2_cytarabine_human | evunt rep strain name u2os drug untreated empty vector osteosarcoma cell line vs mut24hr tr rep strain name u2os drug 24hr post dnmt3a r882h mutation osteosarcoma cell line |
| GSE153871_5_v_2_cytarabine_human | wtunt rep strain name u2os drug untreated wild type dnmt3a osteosarcoma cell line vs mut24hr tr rep strain name u2os drug 24hr post dnmt3a r882h mutation osteosarcoma cell line |
| GSE234637_1_v_0_cytarabine_human | sem wiltdype control untreated cell line bcp wt vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE153871_0_v_3_cytarabine_human | evunt rep strain name u2os drug untreated empty vector osteosarcoma cell line vs ev24hr tr rep strain name u2os drug 24hr post empty vector osteosarcoma cell line |
| GSE234637_3_v_0_cytarabine_human | sem ikzf1 knockout untreated cell line bcp vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE68156_0_v_5_dextran_mouse | colon wt dss strain c57bl/6 vilcre dextran sulfate sodium vs colon tg water strain c57bl/6 vilcre cmvcanrf2 none |
| GSE155031_6_v_1_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs copper treated replicate cell line sh sy5y 4 hours neuroblastoma |
| GSE181959_3_v_2_dextran_mouse | liver strain c57bl/6 control age post natal day 42 vs colon strain c57bl/6 dss age post natal day 42 |
| GSE136397_1_v_0_dextran_mouse | control strain c57bl/6 colon age 10 12 weeks old sex male obtained mouse dss induced colitis injected pbs vs uc msc strain c57bl/6 colon age 10 12 weeks old sex male obtained mouse dss induced colitis injected |
| GSE155031_6_v_4_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs tepa treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE155031_5_v_0_dextran_human | control replicate cell line sh sy5y untreated (24h) neuroblastoma vs dc+ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE68156_3_v_4_dextran_mouse | epithelial cells wt strain c57bl/6 vilcre none vs colon tg dss strain c57bl/6 vilcre cmvcanrf2 dextran sulfate sodium |
| GSE155031_5_v_2_dextran_human | control replicate cell line sh sy5y untreated (24h) neuroblastoma vs tepa+ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE230329_0_v_3_dextran_mouse | colon water control colonic epithelium cage sex tnfr2 f/f vs colon dss tnfr2ko colonic epithelium cage sex f vil1 cre tnfr2 f/f |
| GSE68156_0_v_1_dextran_mouse | colon wt dss strain c57bl/6 vilcre dextran sulfate sodium vs epithelial cells tg strain c57bl/6 vilcre cmvcanrf2 none |
| GSE155031_6_v_2_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs tepa+ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE155031_6_v_3_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE155031_5_v_3_dextran_human | control replicate cell line sh sy5y untreated (24h) neuroblastoma vs ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE155031_6_v_0_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs dc+ifn treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE181959_1_v_0_dextran_mouse | colon strain c57bl/6 control age post natal day 42 vs liver strain c57bl/6 dss age post natal day 42 |
| GSE68156_3_v_5_dextran_mouse | epithelial cells wt strain c57bl/6 vilcre none vs colon tg water strain c57bl/6 vilcre cmvcanrf2 none |
| GSE155031_5_v_1_dextran_human | control replicate cell line sh sy5y untreated (24h) neuroblastoma vs copper treated replicate cell line sh sy5y 4 hours neuroblastoma |
| GSE155031_6_v_7_dextran_human | control copper replicate cell line sh sy5y untreated (4h) neuroblastoma vs dc treated replicate cell line sh sy5y 24 hours neuroblastoma |
| GSE181959_1_v_2_dextran_mouse | colon strain c57bl/6 control age post natal day 42 vs colon strain c57bl/6 dss age post natal day 42 |
| GSE141093_1_v_0_dextran_mouse | dss day 39 wt intestinal macrophage strain colon marker cd45+cd11b+ly6g ly6c mhcii+cd64+ vs dss day csf1r ep4 / intestinal macrophage strain colon marker cd45+cd11b+ly6g ly6c mhcii+cd64+ |
| GSE181959_3_v_0_dextran_mouse | liver strain c57bl/6 control age post natal day 42 vs liver strain c57bl/6 dss age post natal day 42 |
| GSE189219_0_v_1_dextran_mouse | terminal ileum wt strain il17rafl/fl atoh1 cre age 6 weeks murine small intestinal vs terminal ileum ko strain il17rafl/fl atoh1 cre+ age 6 weeks murine small intestinal |
| GSE68156_3_v_1_dextran_mouse | epithelial cells wt strain c57bl/6 vilcre none vs epithelial cells tg strain c57bl/6 vilcre cmvcanrf2 none |
| GSE68156_0_v_4_dextran_mouse | colon wt dss strain c57bl/6 vilcre dextran sulfate sodium vs colon tg dss strain c57bl/6 vilcre cmvcanrf2 dextran sulfate sodium |
| GSE118548_1_v_0_trametinib_human | t84 dmso cell line colon carcinoma time 24h colorectal cancer vs t84 trametinib + jq1 cell line colon carcinoma time 24h colorectal cancer |
| GSE213588_9_v_4_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE197555_1_v_3_trametinib_human | a549 response meki sensitive meki(trametinib) 0.1% dmso 24h cell line non small lung cancer adenocarcinoma vs a549 trame response meki sensitive meki(trametinib) 100nm trametinib 24h cell line non small lung cancer adenocarcinoma |
| GSE213588_10_v_5_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216+tram 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) + trametinib (0.1 time 24 hours |
| GSE213588_8_v_13_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE164757,GSE164759_4_v_0_trametinib_mouse | kl1 veh3d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 tram13d nsclc lung tumor kras mutant lkb1 / 10nm trametinib guide rna none immortalized cell line derived |
| GSE213588_8_v_6_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE213588_8_v_11_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE213588_8_v_5_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216+tram 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) + trametinib (0.1 time 24 hours |
| GSE213588_8_v_3_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE213588_10_v_13_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE130401_4_v_3_trametinib_human | sgcon dmso nlf neuroblastoma derived cell line genetic alteration scrambled sgrna 0.01% vs tram nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 20 nm trametinib |
| GSE197555_1_v_2_trametinib_human | a549 response meki sensitive meki(trametinib) 0.1% dmso 24h cell line non small lung cancer adenocarcinoma vs h460 trame response meki resistant meki(trametinib) 5um trametinib 24h cell line non small lung cancer adenocarcinoma |
| GSE164757,GSE164759_1_v_3_trametinib_mouse | kl1 veh13d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 tram3d nsclc lung tumor kras mutant lkb1 / 10nm trametinib guide rna none immortalized cell line derived |
| GSE213588_9_v_2_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE213588_10_v_2_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE82032_3_v_1_trametinib_human | dmso cell line hcc1143 vs 1um trametinib cell line hcc1143 |
| GSE82032_3_v_2_trametinib_human | dmso cell line hcc1143 vs 1um jq1 cell line hcc1143 |
| GSE213588_10_v_11_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE164757,GSE164759_1_v_0_trametinib_mouse | kl1 veh13d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 tram13d nsclc lung tumor kras mutant lkb1 / 10nm trametinib guide rna none immortalized cell line derived |
| GSE130401_4_v_0_trametinib_human | sgcon dmso nlf neuroblastoma derived cell line genetic alteration scrambled sgrna 0.01% vs sgcon tram nlf neuroblastoma derived cell line genetic alteration scrambled sgrna 20 nm trametinib |
| GSE165174,GSE165175_0_v_2_trametinib_mouse | n group normal vehicle age 12weeks strain c57bl/6 liver treated vs mcd group mice vehicle age 12weeks strain c57bl/6 liver treated |
| GSE130401_6_v_0_trametinib_human | yapko2 dmso nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 0.01% vs sgcon tram nlf neuroblastoma derived cell line genetic alteration scrambled sgrna 20 nm trametinib |
| GSE213588_9_v_12_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE130401_1_v_0_trametinib_human | yapko1 dmso nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 0.01% vs sgcon tram nlf neuroblastoma derived cell line genetic alteration scrambled sgrna 20 nm trametinib |
| GSE213588_10_v_0_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE130401_6_v_3_trametinib_human | yapko2 dmso nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 0.01% vs tram nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 20 nm trametinib |
| GSE213588_9_v_1_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE165174,GSE165175_0_v_1_trametinib_mouse | n group normal vehicle age 12weeks strain c57bl/6 liver treated vs 4 3 group mcd mice trametinib age 12weeks strain c57bl/6 liver treated |
| GSE213588_8_v_1_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE118490_1_v_0_trametinib_human | hct116 parental control colorectal cancer cell line vs hct116 r4 trametinib 30nm colorectal cancer cell line |
| GSE164757,GSE164759_1_v_2_trametinib_mouse | kl1 veh13d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 trament13d nsclc lung tumor kras mutant lkb1 / 10nm trametinib + 1um entinostat guide rna none immortalized cell line derived |
| GSE213588_8_v_2_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE82032_3_v_5_trametinib_human | dmso cell line hcc1143 vs 1um + jq1 cell line hcc1143 |
| GSE197555_0_v_3_trametinib_human | h460 response meki resistant meki(trametinib) 0.1% dmso 24h cell line non small lung cancer adenocarcinoma vs a549 trame response meki sensitive meki(trametinib) 100nm trametinib 24h cell line non small lung cancer adenocarcinoma |
| GSE213588_10_v_12_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE164757,GSE164759_4_v_2_trametinib_mouse | kl1 veh3d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 trament13d nsclc lung tumor kras mutant lkb1 / 10nm trametinib + 1um entinostat guide rna none immortalized cell line derived |
| GSE213588_8_v_0_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE213588_9_v_7_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE82032_3_v_0_trametinib_human | dmso cell line hcc1143 vs 1um bez235 cell line hcc1143 |
| GSE213588_10_v_6_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE213588_8_v_12_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE209898,GSE209899_0_v_1_trametinib_human | hela flcn ko dmso cell line epithelial vs hela flcn ko trametinib cell line epithelial |
| GSE213588_9_v_6_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE118548_1_v_3_trametinib_human | t84 dmso cell line colon carcinoma time 24h colorectal cancer vs t84 trametinib cell line colon carcinoma 30nm time 24h colorectal cancer |
| GSE213588_8_v_7_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE213588_9_v_3_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE213588_10_v_3_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo pict 24h cell line melanoma cells nf1 loss function pictilisib (1 âµm) time 24 hours |
| GSE213588_9_v_5_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216+tram 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) + trametinib (0.1 time 24 hours |
| GSE213588_9_v_11_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE197555_0_v_2_trametinib_human | h460 response meki resistant meki(trametinib) 0.1% dmso 24h cell line non small lung cancer adenocarcinoma vs h460 trame response meki resistant meki(trametinib) 5um trametinib 24h cell line non small lung cancer adenocarcinoma |
| GSE213588_8_v_4_trametinib_human | mewo dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE213588_9_v_13_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE164757,GSE164759_4_v_3_trametinib_mouse | kl1 veh3d nsclc lung tumor kras mutant lkb1 / dmso guide rna none immortalized cell line derived vs kl1 tram3d nsclc lung tumor kras mutant lkb1 / 10nm trametinib guide rna none immortalized cell line derived |
| GSE130401_1_v_3_trametinib_human | yapko1 dmso nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 0.01% vs tram nlf neuroblastoma derived cell line genetic alteration yap1 gene knockout 20 nm trametinib |
| GSE213588_9_v_0_trametinib_human | wm3918 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs skmel113 m216 24h cell line melanoma cells nf1 loss function mtx 216 (1 âµm) time 24 hours |
| GSE213588_10_v_7_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo tram 24h cell line melanoma cells nf1 loss function trametinib (0.1 âµm) time 24 hours |
| GSE213588_10_v_4_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs wm3918 m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE118548_1_v_2_trametinib_human | t84 dmso cell line colon carcinoma time 24h colorectal cancer vs t84 jq1 cell line colon carcinoma 1âµm time 24h colorectal cancer |
| GSE213588_10_v_1_trametinib_human | skmel113 dmso 24h cell line melanoma cells nf1 loss function time 24 hours vs mewo m211 24h cell line melanoma cells nf1 loss function mtx 211 (1 âµm) time 24 hours |
| GSE193751_1_v_3_oridonin_human | control cell line hela human cervical carcinoma dmso vs combi cell line hela human cervical carcinoma oridonin imidazole ketone erastin |
| GSE189789_0_v_1_oridonin_human | cell line wi 38 dox dmso medium vs cell line wi 38 dox doxorubicin medium oridonin |
| GSE174362_3_v_0_oridonin_mouse | wt ori mouse derived hematopoietic stem cells strain c57bl/6 oridonin .p treats recipient mice 15 days vs r878h ori mouse derived hematopoietic stem cells strain c57bl/6 oridonin .p treats recipient mice 15 days |
| GSE174362_2_v_0_oridonin_mouse | r878h ctl mouse derived hematopoietic stem cells strain c57bl/6 vehicle vs r878h ori mouse derived hematopoietic stem cells strain c57bl/6 oridonin .p treats recipient mice 15 days |
| GSE174362_1_v_0_oridonin_mouse | wt ctl mouse derived hematopoietic stem cells strain c57bl/6 vehicle vs r878h ori mouse derived hematopoietic stem cells strain c57bl/6 oridonin .p treats recipient mice 15 days |
| GSE193076_2_v_0_febuxostat_mouse | strain c57bl/6 brain untreated vs strain c57bl/6 brain treated febuxostat ich |
| GSE193076_2_v_1_febuxostat_mouse | strain c57bl/6 brain untreated vs strain c57bl/6 brain ich |
| GSE143944_2_v_3_ribociclib_human | cama 1 dmso cell line ribociclib sensitivity sensitive breast cancer vs cama 1 ribor ribo cell line um ribociclib sensitivity resistant breast cancer |
| GSE143944_1_v_3_ribociclib_human | cama 1 ribor dmso cell line ribociclib sensitivity resistant breast cancer vs cama 1 ribor ribo cell line um ribociclib sensitivity resistant breast cancer |
| GSE143944_1_v_0_ribociclib_human | cama 1 ribor dmso cell line ribociclib sensitivity resistant breast cancer vs cama 1 ribo cell line um ribociclib sensitivity sensitive breast cancer |
| GSE143944_2_v_0_ribociclib_human | cama 1 dmso cell line ribociclib sensitivity sensitive breast cancer vs cama 1 ribo cell line um ribociclib sensitivity sensitive breast cancer |
| GSE142994_0_v_1_ellagic acid_human | (rna seq) cell line hel control blood vs (rna seq) cell line hel dmag blood |
| GSE171311_0_v_1_ellagic acid_human | dmso liver cell line hepg2 control vs ea liver cell line hepg2 ellagic acid |
| GSE182680,GSE182683_10_v_3_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 48hr replicate human cell leukemia cells line |
| GSE198826,GSE198911_1_v_2_dexamethasone_mouse | gas dex strain c57bl/6 mouse wt dexamethasone treated gastrocnemius muscle vs lsd1 sol dex strain c57bl/6 mouse mko dexamethasone treated soleus muscle |
| GSE182680,GSE182683_10_v_2_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 replicate human cell leukemia cells line |
| GSE96649_1_v_3_dexamethasone_human | untreated cell line a549 lung epithelial cells vs dexamethasone treated cell line a549 lung epithelial cells |
| GSE189356_3_v_4_dexamethasone_mouse | wt ni strain fvb/nj grwt/wt mouse embryonic fibroblasts vehicle fibroblast vs mon dex strain fvb/nj grd+l/+l mouse embryonic fibroblasts dexamethasone fibroblast |
| GSE165071,GSE165072_1_v_0_dexamethasone_mouse | control scs strain c57bl/6 muscle satellite cell agent wildtype primary vs klf5ko scs strain c57bl/6 muscle satellite cell agent primary |
| GSE182680,GSE182683_0_v_1_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq cutll1 dex 24hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_5_v_3_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 48hr replicate human cell leukemia cells line |
| GSE189356_5_v_6_dexamethasone_mouse | wt dex strain fvb/nj grwt/wt mouse embryonic fibroblasts dexamethasone fibroblast vs dim2 ni strain fvb/nj grl/l mouse embryonic fibroblasts vehicle fibroblast |
| GSE182680,GSE182683_10_v_13_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 72hr replicate human cell leukemia cells line |
| GSE198683_1_v_0_dexamethasone_human | haecs donor control primary human airway epithelial cells (haecs) individual donorid dexamethasone il 17 vs haecs donor il17 primary human airway epithelial cells (haecs) individual donorid dexamethasone il 17 yes |
| GSE198683_1_v_3_dexamethasone_human | haecs donor control primary human airway epithelial cells (haecs) individual donorid dexamethasone il 17 vs haecs donor il17+dexamethasone primary human airway epithelial cells (haecs) individual donorid dexamethasone yes il 17 |
| GSE189356_5_v_1_dexamethasone_mouse | wt dex strain fvb/nj grwt/wt mouse embryonic fibroblasts dexamethasone fibroblast vs dex strain fvb/nj mouse embryonic fibroblasts dexamethasone fibroblast |
| GSE169571_0_v_4_dexamethasone_mouse | 3h post dex gender male wt skeletal muscle vs 3h post dex gender male ko skeletal muscle |
| GSE169571_3_v_4_dexamethasone_mouse | 24h post saline gender male wt skeletal muscle vs 3h post dex gender male ko skeletal muscle |
| GSE135350_3_v_4_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs 697 kpt cell line protocol rna sequencing agent b |
| GSE182680,GSE182683_7_v_3_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 48hr replicate human cell leukemia cells line |
| GSE169571_3_v_2_dexamethasone_mouse | 24h post saline gender male wt skeletal muscle vs 24h post dex gender male ko skeletal muscle |
| GSE182680,GSE182683_5_v_1_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq cutll1 dex 24hr replicate human cell leukemia cells line |
| GSE159084_0_v_1_dexamethasone_mouse | liver vehicle control (saline) treated strain c57bl/6j sex male mouse vs liver dexamethasone treated strain c57bl/6j sex male mouse |
| GSE225901_2_v_1_dexamethasone_human | endoc î²h1 control biol rep cell line human pancreatic beta betah1 dmso vs endoc î²h1 dexamethasone biol rep cell line human pancreatic beta betah1 |
| GSE169571_0_v_1_dexamethasone_mouse | 3h post dex gender male wt skeletal muscle vs 24h post saline gender male ko skeletal muscle |
| GSE182680,GSE182683_5_v_12_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 dex 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_7_v_8_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 dex 48hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_10_v_12_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 dex 72hr replicate human cell leukemia cells line |
| GSE135350_3_v_5_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs supt1 kpt 1 cell line supt protocol rna sequencing agent |
| GSE182680,GSE182683_0_v_13_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 72hr replicate human cell leukemia cells line |
| GSE225901_0_v_1_dexamethasone_human | human islet control donor pancreatic islets dmso vs endoc î²h1 dexamethasone biol rep cell line human pancreatic beta betah1 |
| GSE150049_2_v_0_dexamethasone_human | cells monocytes untreated peripheral blood vs cells monocytes dexa treated peripheral blood |
| GSE182680,GSE182683_7_v_9_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 dex 24hr replicate human cell leukemia cells line |
| GSE169571_0_v_2_dexamethasone_mouse | 3h post dex gender male wt skeletal muscle vs 24h post dex gender male ko skeletal muscle |
| GSE198683_1_v_2_dexamethasone_human | haecs donor control primary human airway epithelial cells (haecs) individual donorid dexamethasone il 17 vs haecs donor dexamethasone primary human airway epithelial cells (haecs) individual donorid yes il 17 |
| GSE189356_3_v_0_dexamethasone_mouse | wt ni strain fvb/nj grwt/wt mouse embryonic fibroblasts vehicle fibroblast vs mon ni strain fvb/nj grd+l/+l mouse embryonic fibroblasts vehicle fibroblast |
| GSE135350_2_v_5_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs supt1 kpt 1 cell line supt protocol rna sequencing agent |
| GSE189356_5_v_4_dexamethasone_mouse | wt dex strain fvb/nj grwt/wt mouse embryonic fibroblasts dexamethasone fibroblast vs mon dex strain fvb/nj grd+l/+l mouse embryonic fibroblasts dexamethasone fibroblast |
| GSE135350_3_v_0_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs supt1 combi 1 cell line supt protocol rna sequencing agent dexa+kpt |
| GSE182680,GSE182683_7_v_1_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq cutll1 dex 24hr replicate human cell leukemia cells line |
| GSE125862_2_v_0_dexamethasone_human | dmso replicate imr90 ipsc derived cardiomyocytes developmental stage day 28 differentiated cells condition 3d cardiac spheres vs treat replicate imr90 ipsc derived cardiomyocytes developmental stage day 28 differentiated cells condition 3d cardiac spheres |
| GSE182680,GSE182683_0_v_9_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 dex 24hr replicate human cell leukemia cells line |
| GSE135350_3_v_6_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs supt1 dex 1 cell line supt protocol rna sequencing agent dexa |
| GSE182680,GSE182683_7_v_4_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_10_v_4_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_7_v_13_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_7_v_11_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 48hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_5_v_9_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq cutll1 shusp11 dex 24hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_0_v_12_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 dex 72hr replicate human cell leukemia cells line |
| GSE96649_1_v_2_dexamethasone_human | untreated cell line a549 lung epithelial cells vs belinostat treated cell line a549 lung epithelial cells |
| GSE182680,GSE182683_10_v_11_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 48hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_7_v_12_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq dnd41 dex 72hr replicate human cell leukemia cells line |
| GSE135350_2_v_7_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs 697 dex cell line protocol rna sequencing agent dexa b |
| GSE162087_0_v_1_dexamethasone_mouse | undifferentiated/proliferative cad strain c57bl/6 x dba/2 sex male transformant ncbi taxid 1891767 simian virus 40 (sv40) cell line cns control (rrid cvcl 0199) vs dex differentiated cad strain c57bl/6 x dba/2 sex male transformant ncbi taxid 1891767 simian virus 40 (sv40) cell line cns dexamethasone (rrid cvcl 0199) |
| GSE182680,GSE182683_7_v_6_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq cutll1 dasatinib 24hr replicate human cell leukemia cells line dasatininb |
| GSE182680,GSE182683_5_v_2_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq cutll1 shusp11 replicate human cell leukemia cells line |
| GSE169571_3_v_1_dexamethasone_mouse | 24h post saline gender male wt skeletal muscle vs 24h post saline gender male ko skeletal muscle |
| GSE189356_3_v_6_dexamethasone_mouse | wt ni strain fvb/nj grwt/wt mouse embryonic fibroblasts vehicle fibroblast vs dim2 ni strain fvb/nj grl/l mouse embryonic fibroblasts vehicle fibroblast |
| GSE135350_2_v_1_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs 697 combi cell line protocol rna sequencing agent dexa+kpt b |
| GSE96649_1_v_0_dexamethasone_human | untreated cell line a549 lung epithelial cells vs dexamethasone belinostat co treated cell line a549 lung epithelial cells |
| GSE189305_1_v_2_dexamethasone_mouse | y1 control 1 adrenocortical cells agent 0.05percent ethanol 1h vs y1 dexamethasone 1h 1 adrenocortical cells agent |
| GSE189305_1_v_0_dexamethasone_mouse | y1 control 1 adrenocortical cells agent 0.05percent ethanol 1h vs y1 dexamethasone 24h 1 adrenocortical cells agent |
| GSE182680,GSE182683_5_v_11_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 usp7i 48hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_5_v_13_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 72hr replicate human cell leukemia cells line |
| GSE189356_3_v_1_dexamethasone_mouse | wt ni strain fvb/nj grwt/wt mouse embryonic fibroblasts vehicle fibroblast vs dex strain fvb/nj mouse embryonic fibroblasts dexamethasone fibroblast |
| GSE152165_1_v_0_dexamethasone_mouse | wild type proximal tubule cells strain cd1 dmso tsc1 fl/fl disease wt vs six2 cre tsc1 fl/fl + rapamycin treated proximal tubule cells repeat strain cd1 disease tuberous sclerosis rrapamycin |
| GSE125862_2_v_1_dexamethasone_human | dmso replicate imr90 ipsc derived cardiomyocytes developmental stage day 28 differentiated cells condition 3d cardiac spheres vs left ventricle replicate pediatric heart samples subtype condition cardiomyocytes |
| GSE169571_5_v_1_dexamethasone_mouse | 24h post dex gender male wt skeletal muscle vs 24h post saline gender male ko skeletal muscle |
| GSE182680,GSE182683_10_v_1_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq cutll1 dex 24hr replicate human cell leukemia cells line |
| GSE135350_3_v_1_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs 697 combi cell line protocol rna sequencing agent dexa+kpt b |
| GSE182680,GSE182683_10_v_6_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq cutll1 dasatinib 24hr replicate human cell leukemia cells line dasatininb |
| GSE182680,GSE182683_5_v_8_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 dex 48hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_0_v_3_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 dex usp7i 48hr replicate human cell leukemia cells line |
| GSE169571_5_v_2_dexamethasone_mouse | 24h post dex gender male wt skeletal muscle vs 24h post dex gender male ko skeletal muscle |
| GSE182680,GSE182683_7_v_2_dexamethasone_human | rna seq cutll1 control 24hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 replicate human cell leukemia cells line |
| GSE182680,GSE182683_0_v_6_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq cutll1 dasatinib 24hr replicate human cell leukemia cells line dasatininb |
| GSE135350_2_v_6_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs supt1 dex 1 cell line supt protocol rna sequencing agent dexa |
| GSE189356_5_v_0_dexamethasone_mouse | wt dex strain fvb/nj grwt/wt mouse embryonic fibroblasts dexamethasone fibroblast vs mon ni strain fvb/nj grd+l/+l mouse embryonic fibroblasts vehicle fibroblast |
| GSE182680,GSE182683_10_v_9_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 dex 24hr replicate human cell leukemia cells line |
| GSE169571_5_v_4_dexamethasone_mouse | 24h post dex gender male wt skeletal muscle vs 3h post dex gender male ko skeletal muscle |
| GSE135350_2_v_4_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs 697 kpt cell line protocol rna sequencing agent b |
| GSE225901_0_v_3_dexamethasone_human | human islet control donor pancreatic islets dmso vs human islet dexamethasone donor pancreatic islets |
| GSE182680,GSE182683_10_v_8_dexamethasone_human | rna seq dnd41 dmso 72hr replicate human cell leukemia cells line vs rna seq dnd41 dex 48hr replicate human cell leukemia cells line |
| GSE135350_2_v_0_dexamethasone_human | supt1 dmso 1 cell line supt protocol rna sequencing agent vs supt1 combi 1 cell line supt protocol rna sequencing agent dexa+kpt |
| GSE182680,GSE182683_5_v_6_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq cutll1 dasatinib 24hr replicate human cell leukemia cells line dasatininb |
| GSE182680,GSE182683_5_v_4_dexamethasone_human | rna seq cutll1 control replicate human cell leukemia cells line vs rna seq dnd41 usp7i 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_0_v_11_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 48hr replicate human cell leukemia cells line |
| GSE135350_3_v_7_dexamethasone_human | 697 dmso cell line protocol rna sequencing agent b vs 697 dex cell line protocol rna sequencing agent dexa b |
| GSE182680,GSE182683_0_v_4_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 usp7i 72hr replicate human cell leukemia cells line |
| GSE182680,GSE182683_0_v_2_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq cutll1 shusp11 replicate human cell leukemia cells line |
| GSE225901_2_v_3_dexamethasone_human | endoc î²h1 control biol rep cell line human pancreatic beta betah1 dmso vs human islet dexamethasone donor pancreatic islets |
| GSE182680,GSE182683_0_v_8_dexamethasone_human | rna seq dnd41 dmso 48hr replicate human cell leukemia cells line vs rna seq dnd41 dex 48hr replicate human cell leukemia cells line |
| GSE100293_0_v_3_apelin_mouse | apelin wt rep strain c57bl6/j wild type endothelial cells shrenilla vs apelin ko rep strain c57bl6/j apln / endothelial cells shapln |
| GSE201309_1_v_2_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_1_v_3_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_3_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_1_v_0_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_2_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_8_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_7_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_3_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_2_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_0_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_8_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_0_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_7_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_1_v_8_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs hl 60 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_5_v_6_matrine_human | u937 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_1_v_7_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs k562 mat 30min replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_1_v_6_matrine_human | k562 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE201309_4_v_6_matrine_human | hl 60 ct replicate rna seq cell line myeloid leukemia cells control vs u937 mat 24h replicate rna seq cell line myeloid leukemia cells matrine |
| GSE169152_5_v_2_ibrutinib_human | n6 ctr cell line nalm6 untreated vs n6 ibr cell line nalm6 10um ibrutinib |
| GSE128688_0_v_2_ibrutinib_human | nt like cardiomyocytes vehicle (dmso) hesc strain hes2 derived vs v 1um ventricular like cardiomyocytes ibrutinib hesc strain hes2 derived |
| GSE145990_1_v_0_ibrutinib_human | dmso human melanoma cells cell line m229r vs vemurafenib ibrutinib human melanoma cells cell line m229r |
| GSE139427_2_v_1_ibrutinib_mouse | left atria heart (left atria) developmental stage adult ctl vs left atria heart (left atria) developmental stage adult |
| GSE169152_3_v_4_ibrutinib_human | se ctr cell line sem untreated vs se ibr cell line sem 10um ibrutinib |
| GSE122509,GSE122513_2_v_0_ibrutinib_human | z138 scr kd dmso mantle cell lymphoma line z 138 control shrna vs z138 smarca4 kd ai mantle cell lymphoma line z 138 ibrutinib plus venetoclax shrna knockdown |
| GSE169152_3_v_2_ibrutinib_human | se ctr cell line sem untreated vs n6 ibr cell line nalm6 10um ibrutinib |
| GSE169152_5_v_7_ibrutinib_human | n6 ctr cell line nalm6 untreated vs n6 asn 1 cell line nalm6 iu/ml asparaginase |
| GSE122509,GSE122513_1_v_0_ibrutinib_human | z138 smarca4 kd dmso mantle cell lymphoma line z 138 shrna knockdown vs z138 smarca4 kd ai mantle cell lymphoma line z 138 ibrutinib plus venetoclax shrna knockdown |
| GSE76183_2_v_0_ibrutinib_mouse | sample untreateddmso background strain c57bl/6 spleen type hplus dmso primary b cells tumor burdened em tcl p53r172h/+ mice (c57b/6) spleens vs sample ib background strain c57bl/6 spleen type hplus primary b cells tumor burdened em tcl p53r172h/+ mice (c57b/6) spleens |
| GSE214725_1_v_0_ibrutinib_human | untreated biol rep 1 mantle cell lymphoma cells line rec b vs ibrutinib biol rep 1 mantle cell lymphoma cells line rec b 400 nm |
| GSE145990_1_v_4_ibrutinib_human | dmso human melanoma cells cell line m229r vs vemurafenib acalabrutinib human melanoma cells cell line m229r |
| GSE169152_5_v_4_ibrutinib_human | n6 ctr cell line nalm6 untreated vs se ibr cell line sem 10um ibrutinib |
| GSE145990_1_v_5_ibrutinib_human | dmso human melanoma cells cell line m229r vs vemurafenib human melanoma cells cell line m229r |
| GSE169152_3_v_6_ibrutinib_human | se ctr cell line sem untreated vs se asn 1 cell line sem iu/ml asparaginase |
| GSE169152_5_v_1_ibrutinib_human | n6 ctr cell line nalm6 untreated vs n6 combi 1 cell line nalm6 10um ibrutinib iu/ml asparaginase |
| GSE169152_3_v_7_ibrutinib_human | se ctr cell line sem untreated vs n6 asn 1 cell line nalm6 iu/ml asparaginase |
| GSE169152_5_v_6_ibrutinib_human | n6 ctr cell line nalm6 untreated vs se asn 1 cell line sem iu/ml asparaginase |
| GSE76183_1_v_0_ibrutinib_mouse | sample dmso background strain c57bl/6 spleen type wt primary b cells tumor burdened em tcl mice (c57b/6) spleens vs sample ib background strain c57bl/6 spleen type hplus primary b cells tumor burdened em tcl p53r172h/+ mice (c57b/6) spleens |
| GSE169152_3_v_0_ibrutinib_human | se ctr cell line sem untreated vs se combi 1 cell line sem 10um ibrutinib iu/ml asparaginase |
| GSE141143_1_v_0_ibrutinib_human | dmso 1 24h tmd8 cells cas9 expression lentivirally transduced express agent abc dlbcl cell line vs ibrutinib 2nm 24h tmd8 cells cas9 expression lentivirally transduced express agent abc dlbcl cell line |
| GSE169152_3_v_1_ibrutinib_human | se ctr cell line sem untreated vs n6 combi 1 cell line nalm6 10um ibrutinib iu/ml asparaginase |
| GSE169152_5_v_0_ibrutinib_human | n6 ctr cell line nalm6 untreated vs se combi 1 cell line sem 10um ibrutinib iu/ml asparaginase |
| GSE145990_1_v_3_ibrutinib_human | dmso human melanoma cells cell line m229r vs acalabrutinib human melanoma cells cell line m229r |
| GSE128688_0_v_1_ibrutinib_human | nt like cardiomyocytes vehicle (dmso) hesc strain hes2 derived vs 1um atrial like cardiomyocytes ibrutinib hesc strain hes2 derived |
| GSE122509,GSE122513_3_v_0_ibrutinib_human | z138 scr kd ai mantle cell lymphoma line z 138 ibrutinib plus venetoclax control shrna vs z138 smarca4 kd ai mantle cell lymphoma line z 138 ibrutinib plus venetoclax shrna knockdown |
| GSE211829_9_v_8_tafasitamab_human | su dhl 6 solvent diffuse large b cell lymphoma line germinal center like control (solvent ) time [hours] replicate vs su dhl 6 tafa@5nm diffuse large b cell lymphoma line germinal center like 5nm tafasitamab time [hours] replicate |
| GSE211829_9_v_1_tafasitamab_human | su dhl 6 solvent diffuse large b cell lymphoma line germinal center like control (solvent ) time [hours] replicate vs su dhl 6 tafa@5nm+rtx@5nm diffuse large b cell lymphoma line germinal center like 5nm tafasitamab rituximab time [hours] replicate |
| GSE211829_9_v_4_tafasitamab_human | su dhl 6 solvent diffuse large b cell lymphoma line germinal center like control (solvent ) time [hours] replicate vs su dhl 6 rtx@5nm diffuse large b cell lymphoma line germinal center like 5nm rituximab time [hours] replicate |
| GSE93156_1_v_0_idelalisib_human | h39236/tmd 8 dmso p8 clone cell line tmd8 diffuse large b lymphoma idela sensitive vs h39236/tmd 8 + 1um id clone idela cell line tmd8 diffuse large b lymphoma resistant |
| GSE198982,GSE198986_1_v_2_daunorubicin_human | hl 60 rna dmso cell line acute myeloid leukemia vs hl 60 rna dnr cell line acute myeloid leukemia |
| GSE131660_2_v_0_piperlongumine_human | u251 pl modification wt piperlongumine replica vs u251 trpv2 kd pl modification crispri piperlongumine replica |
| GSE131660_1_v_0_piperlongumine_human | u251 modification wt dmso replica vs u251 trpv2 kd pl modification crispri piperlongumine replica |
| GSE201882,GSE201883_3_v_2_interferon gamma_mouse | quantseq rnaseq at3 3hours dmso replicate cell line timepoint 3 hours mammary carcinoma vs quantseq rnaseq at3 3hours ifny replicate cell line timepoint 3 hours mammary carcinoma |
| GSE136653,GSE136660_1_v_0_interferon gamma_mouse | condition uninfected control stomach mucosa vs condition helicobacter pylori infection stomach mucosa |
| GSE153189_2_v_3_interferon gamma_mouse | mt864 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt864 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE201882,GSE201883_3_v_0_interferon gamma_mouse | quantseq rnaseq at3 3hours dmso replicate cell line timepoint 3 hours mammary carcinoma vs quantseq rnaseq at3 3hours a485 replicate cell line timepoint 3 hours 485 1000nm mammary carcinoma |
| GSE201882,GSE201883_3_v_5_interferon gamma_mouse | quantseq rnaseq at3 3hours dmso replicate cell line timepoint 3 hours mammary carcinoma vs quantseq rnaseq at3 3hours a241 replicate cell line timepoint 3 hours 241 250nm mammary carcinoma |
| GSE153189_1_v_0_interferon gamma_mouse | mt4788 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt4788 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE201882,GSE201883_3_v_4_interferon gamma_mouse | quantseq rnaseq at3 3hours dmso replicate cell line timepoint 3 hours mammary carcinoma vs quantseq rnaseq at3 3hours a241+ifny replicate cell line timepoint 3 hours ifny+ 241 mammary carcinoma |
| GSE153189_1_v_3_interferon gamma_mouse | mt4788 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt864 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE153189_2_v_0_interferon gamma_mouse | mt864 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt4788 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE201882,GSE201883_3_v_1_interferon gamma_mouse | quantseq rnaseq at3 3hours dmso replicate cell line timepoint 3 hours mammary carcinoma vs quantseq rnaseq at3 3hours a485+ifny replicate cell line timepoint 3 hours ifny+ 485 mammary carcinoma |
| GSE92589_0_v_1_sirolimus_mouse | ko vehicle age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox prrx1 cre+/ 1% fbs 24hr (dmso) middle limb dermis vs ko sirolimus age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox prrx1 cre+/ 1%fbs 24hr (20ng/ml) middle limb dermis |
| GSE92589_2_v_1_sirolimus_mouse | wt vehicle age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox 1% fbs 24hr (dmso) middle limb dermis vs ko sirolimus age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox prrx1 cre+/ 1%fbs 24hr (20ng/ml) middle limb dermis |
| GSE92589_3_v_1_sirolimus_mouse | wt sirolimus age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox 1%fbs 24hr (20ng/ml) middle limb dermis vs ko sirolimus age postnatal day 1 2 fibroblast strain c57bl/6 129/sv mix tsc2flox/flox prrx1 cre+/ 1%fbs 24hr (20ng/ml) middle limb dermis |
| GSE96598_1_v_2_ifetroban_mouse | wt wild type drug status treated left ventricle vs dsg ko ifetroban knockout mutant drug status treated left ventricle |
| GSE132369,GSE132371_4_v_0_cccp_human | imr90 cells prolif ev gene transduction empty vector control drug dmso cell line state proliferating vs imr90 cells ir parkin cccp gene transduction drug cell line state senescent |
| GSE132369,GSE132371_3_v_0_cccp_human | imr90 cells ir cccp gene transduction empty vector control drug cell line state senescent vs imr90 cells ir parkin cccp gene transduction drug cell line state senescent |
| GSE132369,GSE132371_5_v_0_cccp_human | imr90 cells prolif parkin gene transduction drug dmso cell line state proliferating vs imr90 cells ir parkin cccp gene transduction drug cell line state senescent |
| GSE132369,GSE132371_2_v_0_cccp_human | imr90 cells ir parkin gene transduction drug dmso cell line state senescent vs imr90 cells ir parkin cccp gene transduction drug cell line state senescent |
| GSE132369,GSE132371_1_v_0_cccp_human | imr90 cells ir ev gene transduction empty vector control drug dmso cell line state senescent vs imr90 cells ir parkin cccp gene transduction drug cell line state senescent |
| GSE190384,GSE190386_3_v_4_fulvestrant_human | repl mcf7 plus e2 elacestrant long term estrogen deprivation (lted) lted esr1 mutation status wildtype source atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line |
| GSE216540_10_v_6_fulvestrant_human | pdo #30 non conditioned media dmso rep breast cell line derived organoid control vs pdo #28 conditioned media fulvestrant rep breast cell line derived organoid cancer associated fibroblast medium |
| GSE190384,GSE190386_0_v_4_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 elacestrant long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line |
| GSE216540_1_v_6_fulvestrant_human | pdo #30 conditioned media dmso rep breast cell line derived organoid cancer associated fibroblast medium control vs pdo #28 conditioned media fulvestrant rep breast cell line derived organoid cancer associated fibroblast medium |
| GSE190384,GSE190386_6_v_8_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 elacestrant long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator breast cancer cell line |
| GSE190384,GSE190386_0_v_8_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 elacestrant long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 elacestrant long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator breast cancer cell line |
| GSE216540_0_v_6_fulvestrant_human | pdo #30 non conditioned media fulvestrant rep breast cell line derived organoid control vs pdo #28 conditioned media fulvestrant rep breast cell line derived organoid cancer associated fibroblast medium |
| GSE190384,GSE190386_6_v_4_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line |
| GSE216540_8_v_6_fulvestrant_human | pdo #28 conditioned media dmso rep breast cell line derived organoid cancer associated fibroblast medium control vs pdo #28 conditioned media fulvestrant rep breast cell line derived organoid cancer associated fibroblast medium |
| GSE190384,GSE190386_3_v_8_fulvestrant_human | repl mcf7 plus e2 elacestrant long term estrogen deprivation (lted) lted esr1 mutation status wildtype source atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 elacestrant long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator breast cancer cell line |
| GSE190384,GSE190386_2_v_8_fulvestrant_human | repl mcf7 plus e2 fulvestrant long term estrogen deprivation (lted) lted esr1 mutation status wildtype source atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 elacestrant long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator breast cancer cell line |
| GSE190384,GSE190386_1_v_4_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 fulvestrant long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line |
| GSE190384,GSE190386_1_v_8_fulvestrant_human | repl mcf7 lted esr1 wt plus e2 fulvestrant long term estrogen deprivation (lted) mutation status wildtype source derived atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 elacestrant long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator breast cancer cell line |
| GSE190384,GSE190386_2_v_4_fulvestrant_human | repl mcf7 plus e2 fulvestrant long term estrogen deprivation (lted) lted esr1 mutation status wildtype source atcc estradiol (e2) added selective er modulator breast cancer cell line vs repl mcf7 lted esr1 mut plus e2 long term estrogen deprivation (lted) mutation status mutated y537c source derived atcc estradiol (e2) added selective er modulator none breast cancer cell line |
| GSE216540_3_v_6_fulvestrant_human | pdo #28 non conditioned media dmso rep breast cell line derived organoid control vs pdo #28 conditioned media fulvestrant rep breast cell line derived organoid cancer associated fibroblast medium |
| GSE95077_1_v_4_amiloride_human | jj dm disease plasma cell leukemia line jjn3 treated untreated (dmso) vs jj tg disease plasma cell leukemia line jjn3 treated tg003 0.4 mm 24h |
| GSE95077_5_v_0_amiloride_human | bm dm disease multiple myeloma cell line kms 12 treated untreated (dmso) vs bm tg disease multiple myeloma cell line kms 12 treated tg003 0.4 mm 24h kms12 |
| GSE95077_5_v_4_amiloride_human | bm dm disease multiple myeloma cell line kms 12 treated untreated (dmso) vs jj tg disease plasma cell leukemia line jjn3 treated tg003 0.4 mm 24h |
| GSE95077_1_v_0_amiloride_human | jj dm disease plasma cell leukemia line jjn3 treated untreated (dmso) vs bm tg disease multiple myeloma cell line kms 12 treated tg003 0.4 mm 24h kms12 |
| GSE95077_1_v_3_amiloride_human | jj dm disease plasma cell leukemia line jjn3 treated untreated (dmso) vs bm amil disease multiple myeloma cell line kms 12 treated amiloride 0.1 mm 24h |
| GSE95077_5_v_3_amiloride_human | bm dm disease multiple myeloma cell line kms 12 treated untreated (dmso) vs bm amil disease multiple myeloma cell line kms 12 treated amiloride 0.1 mm 24h |
| GSE95077_5_v_2_amiloride_human | bm dm disease multiple myeloma cell line kms 12 treated untreated (dmso) vs jj amil disease plasma cell leukemia line jjn3 treated amiloride 0.4 mm 24h |
| GSE95077_1_v_2_amiloride_human | jj dm disease plasma cell leukemia line jjn3 treated untreated (dmso) vs jj amil disease plasma cell leukemia line jjn3 treated amiloride 0.4 mm 24h |
| GSE240444_2_v_1_idasanutlin_human | rna expression pdx line dmso control biological replicate strain dfci12 vs rna expression pdx line 1.5um ida biological replicate strain dfci12 |
| GSE240444_2_v_3_idasanutlin_human | rna expression pdx line dmso control biological replicate strain dfci12 vs rna expression pdx line 300nm nav 1.5um ida biological replicate strain dfci12 |
| GSE172016_2_v_5_paclitaxel_human | tov21g control epithelial disease state grade 3 stage iii primary malignant clear cell carcinoma ovary immortalized line (tov 21g) vs tov21g pacr epithelial disease state grade 3 stage iii primary malignant clear cell carcinoma ovary immortalized line (tov 21g) |
| GSE228106_0_v_1_paclitaxel_human | sample patu wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample suit.2 028 resistant paclitaxel cells biol rep pancreatic ductal adenocarcinoma cell line pr immortalized ptx none |
| GSE228106_3_v_4_paclitaxel_human | sample suit.2 028 wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample patu resistant gemcitabine cells biol pancreatic ductal adenocarcinoma cell line gr immortalized gem none |
| GSE236502_2_v_3_paclitaxel_human | pmca 3 appendiceal adenocarcinoma saline control pdx model tumor treated (replicate vs pmca 3 appendiceal adenocarcinoma intraperitoneal paclitaxel pdx model tumor treated (replicate |
| GSE172016_2_v_1_paclitaxel_human | tov21g control epithelial disease state grade 3 stage iii primary malignant clear cell carcinoma ovary immortalized line (tov 21g) vs primary tumor (ovary) stage histotype adenocarcinoma grade |
| GSE228106_0_v_4_paclitaxel_human | sample patu wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample patu resistant gemcitabine cells biol pancreatic ductal adenocarcinoma cell line gr immortalized gem none |
| GSE236502_1_v_3_paclitaxel_human | tm00351 appendiceal adenocarcinoma saline control pdx model tumor treated (replicate vs pmca 3 appendiceal adenocarcinoma intraperitoneal paclitaxel pdx model tumor treated (replicate |
| GSE236502_1_v_0_paclitaxel_human | tm00351 appendiceal adenocarcinoma saline control pdx model tumor treated (replicate vs tm00351 appendiceal adenocarcinoma intraperitoneal paclitaxel pdx model tumor treated (replicate |
| GSE228106_0_v_5_paclitaxel_human | sample patu wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample patu resistant paclitaxel cells biol rep pancreatic ductal adenocarcinoma cell line pr immortalized ptx none |
| GSE172016_2_v_0_paclitaxel_human | tov21g control epithelial disease state grade 3 stage iii primary malignant clear cell carcinoma ovary immortalized line (tov 21g) vs ovcar3 epithelial disease state progressive papillary adenocarcinoma ascites/ovary immortalized cell line (nih ovcar3) |
| GSE228106_0_v_2_paclitaxel_human | sample patu wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample suit.2 028 resistant gemcitabine cells biol rep pancreatic ductal adenocarcinoma cell line gr immortalized gem none |
| GSE243199_1_v_0_paclitaxel_human | oe group control nsclc vs oe alkbh5 group nsclc |
| GSE228106_3_v_5_paclitaxel_human | sample suit.2 028 wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample patu resistant paclitaxel cells biol rep pancreatic ductal adenocarcinoma cell line pr immortalized ptx none |
| GSE236502_2_v_0_paclitaxel_human | pmca 3 appendiceal adenocarcinoma saline control pdx model tumor treated (replicate vs tm00351 appendiceal adenocarcinoma intraperitoneal paclitaxel pdx model tumor treated (replicate |
| GSE228106_3_v_2_paclitaxel_human | sample suit.2 028 wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample suit.2 028 resistant gemcitabine cells biol rep pancreatic ductal adenocarcinoma cell line gr immortalized gem none |
| GSE228106_3_v_1_paclitaxel_human | sample suit.2 028 wt cells biol rep pancreatic ductal adenocarcinoma cell line immortalized none vs sample suit.2 028 resistant paclitaxel cells biol rep pancreatic ductal adenocarcinoma cell line pr immortalized ptx none |
| GSE196117_6_v_7_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex male vs inc whole blood individual condition sepsis class clarithromycin time day age sex female |
| GSE196117_1_v_0_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex female vs inc whole blood individual condition sepsis class b placebo time day age sex female |
| GSE196117_1_v_5_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex female vs inc whole blood individual condition sepsis class clarithromycin time day age sex male |
| GSE196117_1_v_11_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex female vs inc whole blood individual condition sepsis class b placebo time day age sex male |
| GSE196117_1_v_7_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex female vs inc whole blood individual condition sepsis class clarithromycin time day age sex female |
| GSE196117_1_v_8_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex female vs inc whole blood individual condition sepsis class clarithromycin time day age sex |
| GSE196117_6_v_11_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex male vs inc whole blood individual condition sepsis class b placebo time day age sex male |
| GSE196117_6_v_5_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex male vs inc whole blood individual condition sepsis class clarithromycin time day age sex male |
| GSE196117_6_v_8_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex male vs inc whole blood individual condition sepsis class clarithromycin time day age sex |
| GSE196117_6_v_0_clarithromycin_human | hvi whole blood individual condition control class healthy na time age sex male vs inc whole blood individual condition sepsis class b placebo time day age sex female |
| GSE89154_1_v_0_proscillaridin_human | cntrl cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female vs dac+prosa cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female |
| GSE89154_1_v_2_proscillaridin_human | cntrl cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female vs prosa cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female |
| GSE89154_1_v_3_proscillaridin_human | cntrl cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female vs dac cell line yb5 colon cancer dukes' type c grade iv colorectal adenocarcinoma gender female |
| GSE109565_12_v_4_glyphosate_human | control combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent pcb 126 vs pcb 1um combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent 126 |
| GSE109565_12_v_2_glyphosate_human | control combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent pcb 126 vs roundup 10ug/l combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent |
| GSE109565_12_v_11_glyphosate_human | control combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent pcb 126 vs pcb 10nm combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent 126 |
| GSE109565_12_v_7_glyphosate_human | control combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent pcb 126 vs glyphosate combined cell line hepargtm cells (hpr 116) terminally differentiated hepatic agent |
| GSE168458_1_v_3_disulfiram_mouse | (lung d0) strain c57bl/6 sex female lung infection state uninfected untreated timepoint d0 vs (lung d21) strain c57bl/6 sex female lung infection state infected disulfiram timepoint d21 |
| GSE138863_3_v_0_disulfiram_human | sf188 control cell line/source tumor grade iv line disease state pediatric high glioma vs gpc16 dsf cell line/source tumor grade iv primary derived stem cells disease state pediatric high glioma disulfiram treated (0.32 microm) |
| GSE139016_3_v_1_disulfiram_human | gpc16 csirna disease state pediatric high grade glioma tumor iv primary derived stem cells (gpc16) 250 pmol control sirna vs gpc16 mll1 mll2 sirna disease state pediatric high grade glioma tumor iv primary derived stem cells (gpc16) 250 pmol mll1/mll2 |
| GSE168458_2_v_3_disulfiram_mouse | (lung d35) strain c57bl/6 sex female lung infection state infected untreated timepoint d35 vs (lung d21) strain c57bl/6 sex female lung infection state infected disulfiram timepoint d21 |
| GSE138863_3_v_1_disulfiram_human | sf188 control cell line/source tumor grade iv line disease state pediatric high glioma vs sf188 dsf cell line/source tumor grade iv line disease state pediatric high glioma disulfiram treated (1 microm) |
| GSE139016_0_v_2_disulfiram_human | sf188 csirna disease state pediatric high grade glioma cell line tumor iv 25 pmol control sirna vs sf188 mll1 mll2 sirna disease state pediatric high grade glioma cell line tumor iv 25 pmol mll1/mll2 |
| GSE209533_0_v_1_disulfiram_human | mda mb 231 cells dmso treated human breast cell line vs mda mb 231 cells dsf cu treated human breast cell line disulfiram/cu |
| GSE139016_3_v_2_disulfiram_human | gpc16 csirna disease state pediatric high grade glioma tumor iv primary derived stem cells (gpc16) 250 pmol control sirna vs sf188 mll1 mll2 sirna disease state pediatric high grade glioma cell line tumor iv 25 pmol mll1/mll2 |
| GSE139016_0_v_1_disulfiram_human | sf188 csirna disease state pediatric high grade glioma cell line tumor iv 25 pmol control sirna vs gpc16 mll1 mll2 sirna disease state pediatric high grade glioma tumor iv primary derived stem cells (gpc16) 250 pmol mll1/mll2 |
| GSE138863_2_v_1_disulfiram_human | gpc16 control cell line/source tumor grade iv primary derived stem cells disease state pediatric high glioma vs sf188 dsf cell line/source tumor grade iv line disease state pediatric high glioma disulfiram treated (1 microm) |
| GSE138863_2_v_0_disulfiram_human | gpc16 control cell line/source tumor grade iv primary derived stem cells disease state pediatric high glioma vs gpc16 dsf cell line/source tumor grade iv primary derived stem cells disease state pediatric high glioma disulfiram treated (0.32 microm) |
| GSE168458_4_v_3_disulfiram_mouse | (lung d21) strain c57bl/6 sex female lung infection state infected untreated timepoint d21 vs (lung d21) strain c57bl/6 sex female lung infection state infected disulfiram timepoint d21 |
| GSE199899_1_v_0_diethylnitrosamine_mouse | nonden l wd rep strain c57bl/6j liver untreated diet western vs den wd rep strain c57bl/6j tumor diet western |
| GSE199899_1_v_2_diethylnitrosamine_mouse | nonden l wd rep strain c57bl/6j liver untreated diet western vs den pt wd rep strain c57bl/6j peritumoral diet western |
| GSE199899_3_v_2_diethylnitrosamine_mouse | den l cd rep strain c57bl/6j liver diet control vs den pt wd rep strain c57bl/6j peritumoral diet western |
| GSE199899_3_v_0_diethylnitrosamine_mouse | den l cd rep strain c57bl/6j liver diet control vs den wd rep strain c57bl/6j tumor diet western |
| GSE199899_4_v_0_diethylnitrosamine_mouse | nonden l cd rep strain c57bl/6j liver untreated diet control vs den wd rep strain c57bl/6j tumor diet western |
| GSE199899_4_v_2_diethylnitrosamine_mouse | nonden l cd rep strain c57bl/6j liver untreated diet control vs den pt wd rep strain c57bl/6j peritumoral diet western |
| GSE143316_0_v_6_somatostatin_mouse | ecs+sst wt cells rep sst interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 vs sst conditionalko nova2 rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 |
| GSE143316_3_v_6_somatostatin_mouse | sst wt cells rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 vs sst conditionalko nova2 rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 |
| GSE143316_3_v_4_somatostatin_mouse | sst wt cells rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 vs ecs+sst conditionaldoubleko nova1nova2 rep sst interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 |
| GSE143316_0_v_5_somatostatin_mouse | ecs+sst wt cells rep sst interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 vs sst conditionaldoubleko nova1nova2 rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 |
| GSE143316_0_v_1_somatostatin_mouse | ecs+sst wt cells rep sst interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 vs sst conditionalko nova1 rep interneuron strain swiss webster+c57bl/6+c57bl/6j age p8 somatosensory cortex s1 |
| GSE213110_2_v_1_myriocin_mouse | quadriceps dmso skeletal muscle type c57l/6jrj vs quadriceps myriocin skeletal muscle type c57l/6jrj |
| GSE220806_1_v_3_progesterone_human | control p4 2 condition progesterone treated cells derived unripend cervix human uterine cervical fibroblast passage 4 8 vs ci p4 condition progesterone treated cells derived cervical insufficiency human uterine fibroblast passage 4 8 |
| GSE157960_2_v_3_progesterone_mouse | b fallopian tube disease state normal tubes dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group bilateral ovariectomy dko replicate vs fallopian tube disease state early stage tumors dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group dko replicate |
| GSE80098,GSE80366_0_v_1_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells t47d 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer |
| GSE80098,GSE80366_0_v_4_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells t47d(pr deficient) 12 hours rnaseq type er+/pr deficient cell models line t47d er/pr status drug 10 nm hormone exposure time breast cancer |
| GSE219103,GSE219104_0_v_1_progesterone_mouse | uterus pregnancy day 4 wt uterine cell strain c57bl/6 mice age 8âx80x9310 weeks old vs uterus pregnancy day 4 cfp1 cko uterine cell strain c57bl/6 mice age 8âx80x9310 weeks old |
| GSE220806_0_v_3_progesterone_human | control notx condition untreated cells derived unripend cervix human uterine cervical fibroblast passage 4 8 vs ci p4 condition progesterone treated cells derived cervical insufficiency human uterine fibroblast passage 4 8 |
| GSE68229_0_v_1_progesterone_human | control lcm dissected vaginal epithelium contraception none race age epithelial cells vs dmpa lcm dissected vaginal epithelium contraception race african american age epithelial cells |
| GSE131640_5_v_3_progesterone_human | normal id ' age cancer menopause n/ length e 28 days p +/ tpa mammary gland vs brca e+p+tpa id ' age cancer menopause length e 28 days p +/ tpa 14 (tpa added day 14) mammary gland |
| GSE211151_3_v_0_progesterone_human | vehicle nap bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells control (nap) 24 hrs vs psat1 p4 bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells recombinant human progesterone 24 hrs |
| GSE72895,GSE72896_0_v_1_progesterone_mouse | control age 8 weeks strain c57bl/6j /variation foxo1f/f developmental stage pseudo pregnancy day 4.5 uterus vs conditional foxo1 knock age 8 weeks strain c57bl/6j /variation pgrcre/+ foxo1f/f developmental stage pseudo pregnancy day 4.5 uterus |
| GSE211151_1_v_4_progesterone_human | vehicle nap etoh bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells control (70% etoh) 24 hrs vs psat1 bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells recombinant human 24 hrs |
| GSE208096_1_v_0_progesterone_mouse | control uterus wt vs cko uterus |
| GSE195503_3_v_0_progesterone_human | rna seq cell line 12z esr1 endometriotic epithelial cells control vehicle nontgvehicle vs rna seq cell line 12z esr1 endometriotic epithelial cells arid1a knockdown vehicle arid1avehicle |
| GSE80098,GSE80366_0_v_6_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells t47d sifoxa1 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer |
| GSE134896_0_v_7_progesterone_human | control htert hm^(/b) p4 fsk il 1beta myometrium vs fsk p4 il 1beta htert hm^(/b) yes myometrium |
| GSE80098,GSE80366_0_v_8_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells mcf7 12 hours rnaseq type er+/pr deficient cell models line er/pr status drug 10 nm hormone exposure time breast cancer |
| GSE157960_0_v_3_progesterone_mouse | fallopian tube disease state normal tubes dicer fl/fl pten f/f/ strain c57bl/129sv conditional ko( cre activity) group dko control replicate vs fallopian tube disease state early stage tumors dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group dko replicate |
| GSE157960_2_v_1_progesterone_mouse | b fallopian tube disease state normal tubes dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group bilateral ovariectomy dko replicate vs bp fallopian tube disease state early stage tumors dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group bilateral ovariectomy dko p4 replicate |
| GSE134896_0_v_3_progesterone_human | control htert hm^(/b) p4 fsk il 1beta myometrium vs fskl p4 htert hm^(/b) yes fsk il 1beta myometrium |
| GSE195503_3_v_2_progesterone_human | rna seq cell line 12z esr1 endometriotic epithelial cells control vehicle nontgvehicle vs rna seq cell line 12z esr1 endometriotic epithelial cells arid1a knockdown 10 nm estradiol arid1ae2 |
| GSE211151_1_v_0_progesterone_human | vehicle nap etoh bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells control (70% etoh) 24 hrs vs psat1 p4 bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells recombinant human progesterone 24 hrs |
| GSE80098,GSE80366_0_v_2_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells vehicle 12 hours rnaseq type er+/pr+ cell models line er/pr status drug hormone exposure time breast cancer |
| GSE157960_0_v_1_progesterone_mouse | fallopian tube disease state normal tubes dicer fl/fl pten f/f/ strain c57bl/129sv conditional ko( cre activity) group dko control replicate vs bp fallopian tube disease state early stage tumors dicer fl/fl pten f/f/ amhr2 cre/+ strain c57bl/129sv conditional ko group bilateral ovariectomy dko p4 replicate |
| GSE195503_1_v_2_progesterone_human | rna seq cell line 12z esr1 endometriotic epithelial cells control 10 nm estradiol nontge2 vs rna seq cell line 12z esr1 endometriotic epithelial cells arid1a knockdown 10 nm estradiol arid1ae2 |
| GSE138050,GSE148257_1_v_2_progesterone_human | sictrl preparation primary p1 cells id uterine leiomyoma knockdown vs sipgr preparation primary p1 cells id uterine leiomyoma knockdown sipr |
| GSE195503_1_v_0_progesterone_human | rna seq cell line 12z esr1 endometriotic epithelial cells control 10 nm estradiol nontge2 vs rna seq cell line 12z esr1 endometriotic epithelial cells arid1a knockdown vehicle arid1avehicle |
| GSE80098,GSE80366_0_v_5_progesterone_human | cells t47d sicontrol 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer vs cells zr75 12 hours rnaseq type er+/pr+ cell models line er/pr status drug 10 nm hormone exposure time breast cancer |
| GSE211151_3_v_4_progesterone_human | vehicle nap bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells control (nap) 24 hrs vs psat1 bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells recombinant human 24 hrs |
| GSE211151_2_v_4_progesterone_human | control bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells medium vs psat1 bio cell line ishikawa celss endomerial epithelial adenocarcinoma cells recombinant human 24 hrs |
| GSE131640_0_v_3_progesterone_human | normal e+p+tpa id ' age cancer n/ menopause length e 28 days p +/ tpa 14 (tpa added day 14) mammary gland vs brca e+p+tpa id ' age cancer menopause length e 28 days p +/ tpa 14 (tpa added day 14) mammary gland |
| GSE131640_2_v_3_progesterone_human | normal e+p id ' age cancer n/ menopause length e 28 days p +/ tpa 0 mammary gland vs brca e+p+tpa id ' age cancer menopause length e 28 days p +/ tpa 14 (tpa added day 14) mammary gland |
| GSE227127_1_v_0_diclofenac_human | te11 cells vehicle control rep cell line esophageal squamous carcinoma 0.07% dmso vs te11 cells diclofenac rep cell line esophageal squamous carcinoma 200 âµm |
| GSE225982_2_v_0_ezetimibe_human | primary lung fibroblast positive control biol rep tgfî²1 + / ezetimibe vs primary lung fibroblast ezetimibe treated biol rep tgfî²1 + / |
| GSE225982_1_v_0_ezetimibe_human | primary lung fibroblast negative control biol rep tgfî²1 / ezetimibe vs primary lung fibroblast ezetimibe treated biol rep tgfî²1 + / |
| GSE197850_4_v_0_glucagon_human | cardiomyocytes untreated induced pluripotent stem cells derived (ipsc cms) vs 7 36 cardiomyocytes diabetic modeling+glp 17 induced pluripotent stem cells derived (ipsc cms) |
| GSE110673,GSE110674_4_v_3_glucagon_mouse | liver zonation wt infusion 150 ug/ gcg vs liver zonation ko infusion gcg |
| GSE197850_4_v_3_glucagon_human | cardiomyocytes untreated induced pluripotent stem cells derived (ipsc cms) vs 9 36 cardiomyocytes diabetic modeling+glp 19 induced pluripotent stem cells derived (ipsc cms) |
| GSE109285_5_v_2_glucagon_mouse | transgenic ctl nodt conditions glucagon venus mice d050416 pancreatic alpha cells mature î± vs transgenic b cell reference conditions insulin mcherry mice d050417 pancreatic beta cells mature î² |
| GSE109285_5_v_4_glucagon_mouse | transgenic ctl nodt conditions glucagon venus mice d050416 pancreatic alpha cells mature î± vs transgenic apdx1oe nodt conditions glucagon rtta teto cre r26yfp cag pdx1 mice d050416 pancreatic alpha cells î± ectopically expressing |
| GSE89636_2_v_0_glucagon_mouse | sample pancreatic islets isotype control strain c57bl/6 condition antibody vs sample pancreatic islets r1193 strain c57bl/6 condition regn1193 (gcgr blocking antibody) |
| GSE184210_0_v_2_glucagon_mouse | min6 cells dmso cell line beta 48h vs min6 cells foxoi cell line beta 48h 1âµm |
| GSE109285_3_v_2_glucagon_mouse | transgenic ctl dt conditions glucagon venus rip dtr mice d050416 pancreatic alpha cells î± 30 days vs transgenic b cell reference conditions insulin mcherry mice d050417 pancreatic beta cells mature î² |
| GSE197850_4_v_2_glucagon_human | cardiomyocytes untreated induced pluripotent stem cells derived (ipsc cms) vs cardiomyocytes diabetic modeling induced pluripotent stem cells derived (ipsc cms) |
| GSE110673,GSE110674_1_v_3_glucagon_mouse | liver zonation wt infusion 30 ug/ gcg vs liver zonation ko infusion gcg |
| GSE109285_3_v_0_glucagon_mouse | transgenic ctl dt conditions glucagon venus rip dtr mice d050416 pancreatic alpha cells î± 30 days vs transgenic apdx1oe dt conditions glucagon rtta teto cre r26yfp cagpdx1 rip dtr mice d050416 pancreatic alpha cells î± expressing pdx1 30 days |
| GSE184210_0_v_1_glucagon_mouse | min6 cells dmso cell line beta 48h vs min6 cells foxoi loperamide cell line beta 48h 1âµm + 5âµm |
| GSE110673,GSE110674_4_v_5_glucagon_mouse | liver zonation wt infusion 150 ug/ gcg vs liver zonation ko infusion 30 gcg ug/ |
| GSE184210_0_v_3_glucagon_mouse | min6 cells dmso cell line beta 48h vs min6 cells loperamide cell line beta 48h 5âµm |
| GSE110673,GSE110674_1_v_5_glucagon_mouse | liver zonation wt infusion 30 ug/ gcg vs liver zonation ko infusion 30 gcg ug/ |
| GSE109285_3_v_4_glucagon_mouse | transgenic ctl dt conditions glucagon venus rip dtr mice d050416 pancreatic alpha cells î± 30 days vs transgenic apdx1oe nodt conditions glucagon rtta teto cre r26yfp cag pdx1 mice d050416 pancreatic alpha cells î± ectopically expressing |
| GSE171352_2_v_3_glucagon_human | pancreatic islets disease state ctrl replicate age sex male vs pancreatic islets disease state t1d replicate age sex male |
| GSE134636_2_v_1_dieldrin_mouse | p3 e1 sn r mouse midbrain strain c57bl/6 age 12 weeks old sex male exposure type developmental control vs p3 e1 sn r mouse midbrain strain c57bl/6 age 12 weeks old sex female exposure type developmental dieldrin |
| GSE165122_0_v_1_metformin_mouse | sstcre ctrl duodenal organoids control transgenic line sst cre tdrfp vs sstcre met duodenal organoids metformin transgenic line sst cre tdrfp |
| GSE165122_2_v_1_metformin_mouse | gipcre ctrl duodenal organoids control transgenic line gip cre tdrfp vs sstcre met duodenal organoids metformin transgenic line sst cre tdrfp |
| GSE146982_7_v_5_metformin_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE157050,GSE157051_2_v_3_metformin_mouse | wt input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old wild type tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin rna fraction polya vs tsc input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old tsc2 fl/fl albcreer tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin rna fraction polya |
| GSE134191_3_v_1_metformin_mouse | mo5 met /variation wild type cell markers cd45 cd3 vs mo5 apd1 /variation cbf{beta}2 knockout cell markers cd45 cd3 |
| GSE157049,GSE157051_6_v_4_metformin_mouse | liver wt met strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection vs liver adel sal strain c57bl/6 (f3 generation) age 8 month old sex male ampka1 fl/fl ampka2 albcreer diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin saline 4h avertin sublethal dose 10' prior collection |
| GSE133087_1_v_0_metformin_human | d0 developmental stage hpscs untreated vs met developmental stage pancreatic 100 microm metformin hpscs derived organoid |
| GSE138789_0_v_1_metformin_human | ctrl dc strain vub03 hes cell line dm1 mutated mesodermal precursor cells (mpc) vs b 25mm dc strain vub03 hes cell line dm1 mutated mesodermal precursor cells (mpc) |
| GSE146982_4_v_5_metformin_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_4_v_6_metformin_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE176118_0_v_1_metformin_mouse | sample 1422 hs age postnatal day 16 diet ncd control inguinal mammary gland vs sample 1422 hs age postnatal day 16 diet hfd metformin inguinal mammary gland |
| GSE146982_4_v_2_metformin_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE133087_3_v_0_metformin_human | d35 developmental stage pancreatic beta like cells untreated hpscs derived organoid vs met developmental stage pancreatic 100 microm metformin hpscs derived organoid |
| GSE190076_0_v_1_metformin_human | protocol cell vitro time 48 hours line huh 7 agent control vs protocol cell vitro time 48 hours line huh 7 agent metformin |
| GSE157049,GSE157051_6_v_3_metformin_mouse | liver wt met strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection vs liver tsc met strain c57bl/6 (f3 generation) age 8 month old sex male tsc2 fl/fl albcreer diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection |
| GSE179531_1_v_0_metformin_mouse | murine preadipocyte cells cell line 3t3 l1 strain c57bl/6 untreated vs murine preadipocyte cells cell line 3t3 l1 strain c57bl/6 dexamethasone/3 isobutyl 1 methylxanthine/insulin |
| GSE138789_0_v_2_metformin_human | ctrl dc strain vub03 hes cell line dm1 mutated mesodermal precursor cells (mpc) vs b 10mm dc strain vub03 hes cell line dm1 mutated mesodermal precursor cells (mpc) |
| GSE133087_3_v_2_metformin_human | d35 developmental stage pancreatic beta like cells untreated hpscs derived organoid vs d20 met developmental stage endocrine progenitor 100 microm metformin hpscs derived organoid |
| GSE146982_0_v_5_metformin_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_3_v_1_metformin_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE217783,GSE217784_1_v_0_metformin_mouse | fgsc c female germline stem cell (fgscs) passages >20 strain c57bl/6 none control cells vs fgsc female germline stem cell (fgscs) passages >20 strain c57bl/6 1î¼m metformin 24h treated cells |
| GSE140714,GSE140716_1_v_0_metformin_human | ctrl origin china adipose derived mesenchymal stem cells age adult none human vs met origin china adipose derived mesenchymal stem cells age adult metformin 6 days human |
| GSE139948_3_v_4_metformin_mouse | c57bl 6 wt neg met sample group mouse spleen vs d41 cd8 tcm sample group + bcg met pop3 spleen |
| GSE146982_7_v_1_metformin_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE146982_0_v_2_metformin_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE133087_5_v_0_metformin_human | d20 developmental stage endocrine progenitor untreated hpscs derived organoid vs met developmental stage pancreatic 100 microm metformin hpscs derived organoid |
| GSE207122_1_v_0_metformin_human | cal27 cells control pbs replicate tongue cell line epithelial disease squamous carcinoma time 48h vs cal27 cells metformin 30mm replicate tongue cell line epithelial disease squamous carcinoma time 48h |
| GSE134191_2_v_1_metformin_mouse | cd8tic none /variation wild type cd8 tumor infiltrating cell markers cd45+cd8+ vs mo5 apd1 /variation cbf{beta}2 knockout cell markers cd45 cd3 |
| GSE157049,GSE157051_6_v_2_metformin_mouse | liver wt met strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection vs liver sal strain c57bl/6 (f3 generation) age 8 month old sex male raptor s722a s792a diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin saline 4h avertin sublethal dose 10' prior collection |
| GSE157050,GSE157051_2_v_1_metformin_mouse | wt input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old wild type tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin rna fraction polya vs aa input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old raptor s722a s792a tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin 15 minute pre 1nm rna fraction polya |
| GSE201098_1_v_0_metformin_mouse | control oocyte vs metformin oocyte |
| GSE146982_0_v_6_metformin_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE146982_0_v_1_metformin_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE196343_1_v_0_metformin_human | c42 cells control pbs replicate experimental condition 24 hour cell line c4 2 prostate cancer culture vs c42 cells replicate experimental condition 24 hour cell line c4 2 prostate cancer culture |
| GSE134191_6_v_1_metformin_mouse | cd8tic met /variation wild type cd8 tumor infiltrating cell markers cd45+cd8+ vs mo5 apd1 /variation cbf{beta}2 knockout cell markers cd45 cd3 |
| GSE146982_3_v_5_metformin_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE165122_2_v_3_metformin_mouse | gipcre ctrl duodenal organoids control transgenic line gip cre tdrfp vs gipcre met duodenal organoids metformin transgenic line gip cre tdrfp |
| GSE198254_1_v_0_metformin_mouse | mc3t3 e1 cells nc cell line osteoblasts growth protocol osteogenic medium control vs mc3t3 e1 cells met cell line osteoblasts growth protocol osteogenic medium metformin |
| GSE134191_2_v_5_metformin_mouse | cd8tic none /variation wild type cd8 tumor infiltrating cell markers cd45+cd8+ vs cd8tic apd1 /variation cbf{beta}2 knockout cd8 tumor infiltrating cell markers cd45+cd8+ |
| GSE140715,GSE140716_0_v_1_metformin_mouse | ctrl b strain c57bl/6 blood age adult pbs 30 days vs met b strain c57bl/6 blood age adult metformin 30 days |
| GSE139948_3_v_2_metformin_mouse | c57bl 6 wt neg met sample group mouse spleen vs d41 cd8 tcm sample group bcg met pop3 spleen |
| GSE157049,GSE157051_6_v_1_metformin_mouse | liver wt met strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection vs liver aatsc met strain c57bl/6 (f3 generation) age 8 month old sex male raptor s722a s792a tsc2 fl/fl albcreer diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection |
| GSE157049,GSE157051_6_v_5_metformin_mouse | liver wt met strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection vs liver adel met strain c57bl/6 (f3 generation) age 8 month old sex male ampka1 fl/fl ampka2 albcreer diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection |
| GSE110524_2_v_4_metformin_mouse | rnaseq strain c57bl/6 liver age 39 week wild type vs rnaseq strain c57bl/6 liver age 39 week ncoa5+/ |
| GSE139948_3_v_6_metformin_mouse | c57bl 6 wt neg met sample group mouse spleen vs d41 cd8 tcm sample group + bcg met pop3 spleen |
| GSE146982_3_v_2_metformin_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE157050,GSE157051_2_v_9_metformin_mouse | wt input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old wild type tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin rna fraction polya vs ampk input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old ampka1 fl/fl ampka2 albcreer tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin 15 minute pre 1nm rna fraction polya |
| GSE146982_7_v_6_metformin_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE181521_0_v_1_metformin_human | plc control cell line plc/prf/5 vs plc metformin cell line plc/prf/5 |
| GSE133087_1_v_2_metformin_human | d0 developmental stage hpscs untreated vs d20 met developmental stage endocrine progenitor 100 microm metformin hpscs derived organoid |
| GSE134191_6_v_5_metformin_mouse | cd8tic met /variation wild type cd8 tumor infiltrating cell markers cd45+cd8+ vs cd8tic apd1 /variation cbf{beta}2 knockout cd8 tumor infiltrating cell markers cd45+cd8+ |
| GSE157050,GSE157051_2_v_4_metformin_mouse | wt input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old wild type tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin rna fraction polya vs aatsc input strain c57bl/6 (f3 generation) primary hepatocytes age 8 16 weeks old raptor s722a s792a tsc2 fl/fl albcreer tamoxifen 3x 14 17 days prior hepatocyte isolation metformin serum starved insulin 15 minute pre 1nm rna fraction polya |
| GSE209938_0_v_1_metformin_human | pdac pancreatic ductal adenocarcinoma (pdac) wt vs pdac sh pancreatic ductal adenocarcinoma (pdac) pc knockdown |
| GSE176118_2_v_1_metformin_mouse | sample 1422 hs age postnatal day 16 diet hfd control inguinal mammary gland vs sample 1422 hs age postnatal day 16 diet hfd metformin inguinal mammary gland |
| GSE146982_3_v_6_metformin_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE139948_3_v_1_metformin_mouse | c57bl 6 wt neg met sample group mouse spleen vs cxcr3 ko neg met sample group mouse spleen |
| GSE247159_8_v_3_metformin_human | 1 ped apos n1 brain cell line oligodendrocyte lineage control vs ped aneg met brain cell line oligodendrocyte lineage metformin |
| GSE134191_3_v_5_metformin_mouse | mo5 met /variation wild type cell markers cd45 cd3 vs cd8tic apd1 /variation cbf{beta}2 knockout cd8 tumor infiltrating cell markers cd45+cd8+ |
| GSE165122_0_v_3_metformin_mouse | sstcre ctrl duodenal organoids control transgenic line sst cre tdrfp vs gipcre met duodenal organoids metformin transgenic line gip cre tdrfp |
| GSE247159_2_v_3_metformin_human | 1 adult apos n1 brain cell line oligodendrocyte lineage control vs ped aneg met brain cell line oligodendrocyte lineage metformin |
| GSE157049,GSE157051_7_v_1_metformin_mouse | liver wt sal strain c57bl/6 (f3 generation) age 8 month old sex male wild type diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete tsc2 ampk fasting overnight fast 1h refed metformin saline 4h avertin sublethal dose 10' prior collection vs liver aatsc met strain c57bl/6 (f3 generation) age 8 month old sex male raptor s722a s792a tsc2 fl/fl albcreer diet 45% high fat 12 weeks tamoxifen treated 3x 7 hfd delete ampk fasting overnight fast 1h refed metformin 200 mpk 4 hours avertin sublethal dose 10' prior collection |
| GSE146982_4_v_1_metformin_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE110524_2_v_5_metformin_mouse | rnaseq strain c57bl/6 liver age 39 week wild type vs rnaseq strain c57bl/6 liver age 20 week ncoa5+/ |
| GSE152246_0_v_1_dihydrotestosterone_human | ctrl pdx hci 009 tnbc mouse strain nod scid gamma vehicle control cellulose pellet 9wk derived xenograft tumors vs dht pdx hci 009 tnbc mouse strain nod scid gamma hormone slow release 8mg pellet 9wk derived xenograft tumors |
| GSE126219_0_v_1_haloperidol_mouse | lsk dmso strain c57bl/6 age 8 12 weeks cells femur/tibia vs lsk halo haloperidol strain c57bl/6 age 8 12 weeks cells femur/tibia |
| GSE239844_11_v_5_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_11_v_2_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE93124_0_v_1_crizotinib_human | sw480 72h dmso cell line agent control vs sw480 72h r crizo 2um cell line agent (r) crizotinib |
| GSE239844_1_v_10_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_8_v_5_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_11_v_0_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_11_v_9_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_4_v_10_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_4_v_12_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_8_v_9_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_1_v_12_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_6_v_2_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE239844_6_v_12_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_7_v_10_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_7_v_5_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_6_v_9_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_8_v_0_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_4_v_0_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_4_v_2_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE239844_6_v_5_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_7_v_2_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE239844_7_v_0_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_1_v_2_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE239844_6_v_0_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_11_v_10_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_8_v_2_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs hcc78 cell line lung adenocarcinoma slc34a2 ros1 250 nm crizotinib |
| GSE210150_0_v_1_crizotinib_human | control ccc heh 2 cells agent 12 hours vs crizo ccc heh 2 cells agent crizotinib treated 12 hours |
| GSE239844_1_v_9_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE186767_1_v_0_crizotinib_human | h3122 con cell line cells phenotype control vs h3122 cr cell line cells phenotype crizotinib resistant |
| GSE239844_7_v_12_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_1_v_5_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_11_v_12_crizotinib_human | cuto33 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_6_v_10_crizotinib_human | cuto38 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_8_v_12_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs cuto37 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_4_v_5_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto27 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_8_v_10_crizotinib_human | cuto28 cell line lung adenocarcinoma tpm3 ros1 dmso vs cuto28 cell line lung adenocarcinoma tpm3 ros1 250 nm crizotinib |
| GSE239844_7_v_9_crizotinib_human | cuto37 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_1_v_0_crizotinib_human | cuto23 cell line lung adenocarcinoma cd74 ros1 dmso vs cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE239844_4_v_9_crizotinib_human | cuto27 cell line lung adenocarcinoma cd74 ros1 dmso vs cuto38 cell line lung adenocarcinoma cd74 ros1 250 nm crizotinib |
| GSE200099_3_v_1_honokiol_human | u937 dmso [uc cell line u 937 acute myeloid leukemia complex karyotype vs thp1 honokiol 1 [th cell line thp acute myeloid leukemia complex karyotype |
| GSE200099_2_v_1_honokiol_human | thp1 dmso 1 [tc cell line thp acute myeloid leukemia complex karyotype vs thp1 honokiol 1 [th cell line thp acute myeloid leukemia complex karyotype |
| GSE200099_2_v_0_honokiol_human | thp1 dmso 1 [tc cell line thp acute myeloid leukemia complex karyotype vs u937 honokiol [uh cell line u 937 acute myeloid leukemia complex karyotype |
| GSE200099_3_v_0_honokiol_human | u937 dmso [uc cell line u 937 acute myeloid leukemia complex karyotype vs u937 honokiol [uh cell line u 937 acute myeloid leukemia complex karyotype |
| GSE171837_3_v_2_bortezomib_human | amo1 sting wt cell line multiple myeloma bone marrow cells vs amo1 sting ko btz cell line multiple myeloma bone marrow cells |
| GSE171837_0_v_2_bortezomib_human | amo1 sting wt btz cell line multiple myeloma bone marrow cells vs amo1 sting ko btz cell line multiple myeloma bone marrow cells |
| GSE171837_0_v_1_bortezomib_mouse | amo1 sting wt btz cell line multiple myeloma bone marrow cells vs amo1 sting ko cell line multiple myeloma bone marrow cells |
| GSE123638,GSE123639_3_v_1_bortezomib_human | dox cell line t47d shrna induced shpsmd2 agent dmso breast vs dox bortz cell line t47d shrna induced shpsmd2 agent 20nm bortezomib breast |
| GSE123638,GSE123639_0_v_1_bortezomib_human | control bortz cell line t47d shrna uninduced shpsmd2 agent 20nm bortezomib breast vs dox bortz cell line t47d shrna induced shpsmd2 agent 20nm bortezomib breast |
| GSE171837_3_v_1_bortezomib_mouse | amo1 sting wt cell line multiple myeloma bone marrow cells vs amo1 sting ko cell line multiple myeloma bone marrow cells |
| GSE171837_0_v_3_bortezomib_mouse | imc mice 5tgm1 wt treated btz tumor injected vs imc mice 5tgm1 calr ko treated btz tumor injected |
| GSE171837_1_v_2_bortezomib_human | cnt imc mice 5tgm1 wt tumor injected vs imc mice 5tgm1 calr ko cnt tumor injected |
| GSE171837_0_v_1_bortezomib_human | amo1 sting wt btz cell line multiple myeloma bone marrow cells vs amo1 sting ko cell line multiple myeloma bone marrow cells |
| GSE171837_3_v_1_bortezomib_human | amo1 sting wt cell line multiple myeloma bone marrow cells vs amo1 sting ko cell line multiple myeloma bone marrow cells |
| GSE164508_1_v_0_bortezomib_mouse | liver control sample strain c57bl/6 cells vs liver treated sample strain c57bl/6 bortezomib cells |
| GSE123638,GSE123639_2_v_1_bortezomib_human | control cell line t47d shrna uninduced shpsmd2 agent dmso breast vs dox bortz cell line t47d shrna induced shpsmd2 agent 20nm bortezomib breast |
| GSE171837_0_v_3_bortezomib_human | imc mice 5tgm1 wt treated btz tumor injected vs imc mice 5tgm1 calr ko treated btz tumor injected |
| GSE171837_3_v_2_bortezomib_mouse | amo1 sting wt cell line multiple myeloma bone marrow cells vs amo1 sting ko btz cell line multiple myeloma bone marrow cells |
| GSE171837_1_v_2_bortezomib_mouse | cnt imc mice 5tgm1 wt tumor injected vs imc mice 5tgm1 calr ko cnt tumor injected |
| GSE171837_0_v_2_bortezomib_mouse | amo1 sting wt btz cell line multiple myeloma bone marrow cells vs amo1 sting ko btz cell line multiple myeloma bone marrow cells |
| GSE206984_1_v_0_bortezomib_human | human dmso glioblastoma (gbm) cell line ln229 untreated vs human bl glioblastoma (gbm) cell line ln229 treated unit bortezomib panobinostst concentration 7.5 nm 15 |
| GSE205332_1_v_0_queuine_human | hepg2 ngm untreated cell line hepatocellular carcinoma cells control vs hepg2 treated cell line hepatocellular carcinoma cells q arsenic |
| GSE205332_2_v_0_queuine_human | hepg2 dfbs untreated cell line hepatocellular carcinoma cells q depleted vs hepg2 treated cell line hepatocellular carcinoma cells q arsenic |
| GSE205332_3_v_0_queuine_human | hepg2 ngm treated cell line hepatocellular carcinoma cells control arsenic vs hepg2 treated cell line hepatocellular carcinoma cells q arsenic |
| GSE158969_1_v_2_trastuzumab_human | untreated control mrna sample replicate cell line bt 474 breast cancer origin female caucasian ductal carcinoma vs biosimilar treated mrna sample replicate cell line bt 474 breast cancer origin female caucasian ductal carcinoma 6 days |
| GSE158969_1_v_0_trastuzumab_human | untreated control mrna sample replicate cell line bt 474 breast cancer origin female caucasian ductal carcinoma vs herceptin treated mrna sample replicate cell line bt 474 breast cancer origin female caucasian ductal carcinoma 6 days |
| GSE91383_0_v_1_trastuzumab_human | genecount ipsc derived cardiomyocytes untreated dose na cellular dynamics vs genecount ipsc derived cardiomyocytes trastuzumab dose 100ug/ml cellular dynamics |
| GSE131887_5_v_2_doxycycline_mouse | pb31 dox # cell line betatc3 plasmid pb 31 group control cells replicate ãx9ftc3 vs pb31 mir23b cluster 7 days # cell line betatc3 plasmid pb 31 mir 23b group dox replicate ãx9ftc3 cells |
| GSE131887_1_v_3_doxycycline_mouse | pb31 7 days # cell line betatc3 plasmid pb 31 group control cells dox replicate ãx9ftc3 vs pb31 mir137 7 days # cell line betatc3 plasmid pb 31 mir 137 group dox replicate ãx9ftc3 cells |
| GSE131887_5_v_3_doxycycline_mouse | pb31 dox # cell line betatc3 plasmid pb 31 group control cells replicate ãx9ftc3 vs pb31 mir137 7 days # cell line betatc3 plasmid pb 31 mir 137 group dox replicate ãx9ftc3 cells |
| GSE131887_1_v_4_doxycycline_mouse | pb31 7 days # cell line betatc3 plasmid pb 31 group control cells dox replicate ãx9ftc3 vs pb31 mir23b cluster dox # cell line betatc3 plasmid pb 31 mir 23b group replicate ãx9ftc3 cells |
| GSE233140_0_v_1_doxycycline_human | dox placenta cell line trophoblast stem cells wild type doxycycline treated (6 days) vs dn maml1 placenta cell line trophoblast stem cells non treated |
| GSE208634_1_v_3_doxycycline_human | ln 229 tre r132h cells control biol rep cell line glioblastoma idh1wt without doxycycline vsvîx9451 infection vs ln 229 tre r132h cells doxycycline biol rep cell line glioblastoma idh1mut without vsvîx9451 infection |
| GSE233140_2_v_1_doxycycline_human | placenta cell line trophoblast stem cells wild type non treated vs dn maml1 placenta cell line trophoblast stem cells non treated |
| GSE128076_2_v_0_doxycycline_human | day wt rep2 cell line hek 293 transgene flag cherry hcf 2 addition doxycycline rna seq human embryonic kidney vs day fn3nc rep2 cell line hek 293 transgene flag cherry hcf 2 fn3nc* addition doxycycline rna seq human embryonic kidney |
| GSE131887_5_v_4_doxycycline_mouse | pb31 dox # cell line betatc3 plasmid pb 31 group control cells replicate ãx9ftc3 vs pb31 mir23b cluster dox # cell line betatc3 plasmid pb 31 mir 23b group replicate ãx9ftc3 cells |
| GSE224576_1_v_0_doxycycline_human | u2af1wt cell line k562 wt vs u2af1s34f cell line k562 s34 |
| GSE208634_1_v_2_doxycycline_human | ln 229 tre r132h cells control biol rep cell line glioblastoma idh1wt without doxycycline vsvîx9451 infection vs ln 229 tre r132h cells vsvîx9451 biol rep cell line glioblastoma idh1wt without doxycycline infection |
| GSE128076_2_v_3_doxycycline_human | day wt rep2 cell line hek 293 transgene flag cherry hcf 2 addition doxycycline rna seq human embryonic kidney vs day fn3nc rep1 cell line hek 293 transgene flag cherry hcf 2 fn3nc* addition doxycycline rna seq human embryonic kidney |
| GSE131887_1_v_2_doxycycline_mouse | pb31 7 days # cell line betatc3 plasmid pb 31 group control cells dox replicate ãx9ftc3 vs pb31 mir23b cluster 7 days # cell line betatc3 plasmid pb 31 mir 23b group dox replicate ãx9ftc3 cells |
| GSE131887_1_v_0_doxycycline_mouse | pb31 7 days # cell line betatc3 plasmid pb 31 group control cells dox replicate ãx9ftc3 vs pb31 mir137 dox # cell line betatc3 plasmid pb 31 mir 137 group replicate ãx9ftc3 cells |
| GSE208634_1_v_0_doxycycline_human | ln 229 tre r132h cells control biol rep cell line glioblastoma idh1wt without doxycycline vsvîx9451 infection vs ln 229 tre r132h cells doxycycline+vsvîx9451 biol rep cell line glioblastoma idh1mut doxycycline vsvîx9451 infection |
| GSE128076_1_v_0_doxycycline_human | day wt rep1 cell line hek 293 transgene flag cherry hcf 2 addition doxycycline rna seq human embryonic kidney vs day fn3nc rep2 cell line hek 293 transgene flag cherry hcf 2 fn3nc* addition doxycycline rna seq human embryonic kidney |
| GSE108326_1_v_0_doxycycline_mouse | tet mll af9 aml untreated day replicate strain c57/bl6 primary cells obtained spleen terminally sick mice agent days gender female vs tet mll af9 aml dox treated day replicate strain c57/bl6 primary cells obtained spleen terminally sick mice agent days gender female |
| GSE128076_1_v_3_doxycycline_human | day wt rep1 cell line hek 293 transgene flag cherry hcf 2 addition doxycycline rna seq human embryonic kidney vs day fn3nc rep1 cell line hek 293 transgene flag cherry hcf 2 fn3nc* addition doxycycline rna seq human embryonic kidney |
| GSE233140_2_v_3_doxycycline_human | placenta cell line trophoblast stem cells wild type non treated vs dn maml1 dox placenta cell line trophoblast stem cells doxycycline treated (6 days) |
| GSE244233_1_v_0_quercetin_human | cell line hep3b control vs cell line hep3b pentamethylquercetin(pmq)(100 î¼m) 24 h |
| GSE169356_2_v_1_ivermectin_human | c4 2 dmso sample type human prostate cancer cell line cells vs 22rv1 ivm8 sample type human prostate cancer cell line 8 um ivermectin 48 hours cells |
| GSE169356_2_v_4_ivermectin_human | c4 2 dmso sample type human prostate cancer cell line cells vs 22rv1 ivm12 sample type human prostate cancer cell line 12 um ivermectin 48 hours cells |
| GSE169356_2_v_5_ivermectin_human | c4 2 dmso sample type human prostate cancer cell line cells vs c4 2 ivm8 sample type human prostate cancer cell line 8 um ivermectin 48 hours cells |
| GSE169356_0_v_3_ivermectin_human | 22rv1 dmso sample type human prostate cancer cell line cells vs c4 2 ivm12 sample type human prostate cancer cell line 12 um ivermectin 48 hours cells |
| GSE169356_0_v_1_ivermectin_human | 22rv1 dmso sample type human prostate cancer cell line cells vs 22rv1 ivm8 sample type human prostate cancer cell line 8 um ivermectin 48 hours cells |
| GSE169356_0_v_5_ivermectin_human | 22rv1 dmso sample type human prostate cancer cell line cells vs c4 2 ivm8 sample type human prostate cancer cell line 8 um ivermectin 48 hours cells |
| GSE169356_0_v_4_ivermectin_human | 22rv1 dmso sample type human prostate cancer cell line cells vs 22rv1 ivm12 sample type human prostate cancer cell line 12 um ivermectin 48 hours cells |
| GSE169356_2_v_3_ivermectin_human | c4 2 dmso sample type human prostate cancer cell line cells vs c4 2 ivm12 sample type human prostate cancer cell line 12 um ivermectin 48 hours cells |
| GSE184892_4_v_5_trehalose_human | 3d fibroblasts treated without trehalose primary fibroblast untreated vs 3d fibroblasts treated trehalose 72 hr primary fibroblast |
| GSE184892_4_v_3_trehalose_human | 3d fibroblasts treated without trehalose primary fibroblast untreated vs 3d fibroblasts final lse trehalose primary fibroblast treated 14 days |
| GSE184892_7_v_5_trehalose_human | 2d fibroblasts treated without trehalose primary fibroblast untreated vs 3d fibroblasts treated trehalose 72 hr primary fibroblast |
| GSE184892_6_v_5_trehalose_human | 3d keratinocyte final lse without trehalose primary untreated vs 3d fibroblasts treated trehalose 72 hr primary fibroblast |
| GSE184892_6_v_1_trehalose_human | 3d keratinocyte final lse without trehalose primary untreated vs 2d fibroblasts treated trehalose 24 hr primary fibroblast |
| GSE184892_7_v_2_trehalose_human | 2d fibroblasts treated without trehalose primary fibroblast untreated vs 3d keratinocyte final lse trehalose primary treated 14 days |
| GSE184892_6_v_2_trehalose_human | 3d keratinocyte final lse without trehalose primary untreated vs 3d keratinocyte final lse trehalose primary treated 14 days |
| GSE184892_7_v_3_trehalose_human | 2d fibroblasts treated without trehalose primary fibroblast untreated vs 3d fibroblasts final lse trehalose primary fibroblast treated 14 days |
| GSE184892_0_v_3_trehalose_human | 3d fibroblasts final lse without trehalose primary fibroblast untreated vs 3d fibroblasts final lse trehalose primary fibroblast treated 14 days |
| GSE184892_0_v_5_trehalose_human | 3d fibroblasts final lse without trehalose primary fibroblast untreated vs 3d fibroblasts treated trehalose 72 hr primary fibroblast |
| GSE184892_4_v_1_trehalose_human | 3d fibroblasts treated without trehalose primary fibroblast untreated vs 2d fibroblasts treated trehalose 24 hr primary fibroblast |
| GSE184892_6_v_3_trehalose_human | 3d keratinocyte final lse without trehalose primary untreated vs 3d fibroblasts final lse trehalose primary fibroblast treated 14 days |
| GSE184892_0_v_2_trehalose_human | 3d fibroblasts final lse without trehalose primary fibroblast untreated vs 3d keratinocyte final lse trehalose primary treated 14 days |
| GSE184892_0_v_1_trehalose_human | 3d fibroblasts final lse without trehalose primary fibroblast untreated vs 2d fibroblasts treated trehalose 24 hr primary fibroblast |
| GSE184892_7_v_1_trehalose_human | 2d fibroblasts treated without trehalose primary fibroblast untreated vs 2d fibroblasts treated trehalose 24 hr primary fibroblast |
| GSE184892_4_v_2_trehalose_human | 3d fibroblasts treated without trehalose primary fibroblast untreated vs 3d keratinocyte final lse trehalose primary treated 14 days |
| GSE151466_1_v_2_losartan_mouse | control (ang ii control) strain c57bl/6 group heart vs ang ehp strain c57bl/6 group ii + 101 heart |
| GSE151466_1_v_0_losartan_mouse | control (ang ii control) strain c57bl/6 group heart vs ang los strain c57bl/6 group ii + losartan heart |
| GSE192362_1_v_0_erastin_human | bxpc3 cells dmso disease state pancreatic cancer pancereatic cell line vs bxpc3 cells erastin+vitamin c disease state pancreatic cancer pancereatic cell line |
| GSE164874_5_v_10_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 15 (kctip) rep cell line ipsc age + media culture |
| GSE164874_5_v_3_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 7 (kcti) rep cell line ipsc age + media culture |
| GSE164874_5_v_0_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs primary differentiation day 0 rep cell line ipsc age + media culture |
| GSE164874_5_v_13_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 15 (kcti) rep cell line ipsc age + media culture |
| GSE164874_5_v_9_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs primary differentiation day 8 rep cell line ipsc age + media culture |
| GSE164874_5_v_14_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs primary differentiation day 32 rep cell line ipsc age + media culture |
| GSE164874_5_v_7_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs dmdi skgm 7 days kc rep cell line ncrm1 age + media day (kc) ipsc culture |
| GSE164874_5_v_1_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs dmdii skgm 7 days kc rep cell line ncrm1 age + media day (kc) ipsc culture |
| GSE164874_5_v_4_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 2 (skgm) rep cell line ipsc age + media culture |
| GSE164874_5_v_8_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs primary differentiation day 24 rep cell line ipsc age + media culture |
| GSE164874_5_v_6_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs primary differentiation day 16 rep cell line ipsc age + media culture |
| GSE164874_5_v_12_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 7 (kc) rep cell line ipsc age + media culture |
| GSE164874_5_v_2_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 15 (kc) rep cell line ipsc age + media culture |
| GSE164874_5_v_11_prednisolone_human | wt skgm 7 days kc rep cell line ncrm1 wildtype age + media day (kc) ipsc culture vs secondary differentiation day 7 (kctip) rep cell line ipsc age + media culture |
| GSE235701,GSE261434_0_v_1_enasidenib_human | l2975 dmso chondrosarcoma cell line cells idh2 mutant time 48 h vs sw1353 enasidenib chondrosarcoma cell line cells idh2 mutant 20 um time 48 h |
| GSE235701,GSE261434_0_v_3_enasidenib_human | l2975 dmso chondrosarcoma cell line cells idh2 mutant time 48 h vs l2975 enasidenib chondrosarcoma cell line cells idh2 mutant 20 um time 48 h |
| GSE235701,GSE261434_2_v_3_enasidenib_human | sw1353 dmso chondrosarcoma cell line cells idh2 mutant time 48 h vs l2975 enasidenib chondrosarcoma cell line cells idh2 mutant 20 um time 48 h |
| GSE235701,GSE261434_2_v_1_enasidenib_human | sw1353 dmso chondrosarcoma cell line cells idh2 mutant time 48 h vs sw1353 enasidenib chondrosarcoma cell line cells idh2 mutant 20 um time 48 h |
| GSE235605,GSE235701_0_v_1_enasidenib_human | control chondrosarcoma cell line cds17#1 cells idh2 mutant dmso time 48 h vs enasidenib chondrosarcoma cell line cds17#1 cells idh2 mutant 20 um time 48 h |
| GSE157036,GSE166411_3_v_4_halofuginone_human | veroe6 dmso cell line vero e6 vs veroe6 sersa cell line vero e6 |
| GSE157036,GSE166411_3_v_0_halofuginone_human | veroe6 dmso cell line vero e6 vs veroe6 hf cell line vero e6 |
| GSE157036,GSE166411_3_v_1_halofuginone_human | veroe6 dmso cell line vero e6 vs veroe6 borrelidin cell line vero e6 |
| GSE75209,GSE75212_0_v_1_halofuginone_mouse | t4.control 4 bone marrow macrophages gender male strain c57bl/6 age 12 weeks old time dose (nm) 0 control replicate bmdm vs halofuginone 2mm proline bone marrow macrophages gender male strain c57bl/6 age 12 weeks old time 4 dose (nm) replicate bmdm |
| GSE196701_1_v_0_atorvastatin_mouse | strain c57 blks/l age 50 weeks old underwent 40 normal saline kidney vs strain c57 blks/l age 50 weeks old underwent 40 atorvastatin kidney |
| GSE161825_1_v_0_tipranavir_human | gcsc control gastric adenocarcinoma derived cancer stem cell group untreated vs gcsc tip gastric adenocarcinoma derived cancer stem cell group tipranavir treated 24 hours |
| GSE246576,GSE246826_0_v_1_dapagliflozin_mouse | mouse ctrl kidney wt normal vs mouse db kidney db/db dapagliflozin |
| GSE209548,GSE209549_2_v_3_dapagliflozin_mouse | wt cd replicate cardiomyocytes chow diet time 7 weeks vs apoe ko hfd replicate cardiomyocytes high fat diet time 7 weeks |
| GSE228727_2_v_0_dapagliflozin_mouse | wt kidney sex male / strain c57blks/j 0.5% methylcellulose time 22 week old vs db/db vehicle kidney sex male strain c57blks/j 0.5% methylcellulose time 22 week old |
| GSE228727_2_v_1_dapagliflozin_mouse | wt kidney sex male / strain c57blks/j 0.5% methylcellulose time 22 week old vs db/db dapa kidney sex male strain c57blks/j 1mg/kg dapagliflozin solving 0.5% methylcellulose time 22 week old |
| GSE209548,GSE209549_0_v_3_dapagliflozin_mouse | wt hfd replicate cardiomyocytes high fat diet time 7 weeks vs apoe ko hfd replicate cardiomyocytes high fat diet time 7 weeks |
| GSE153923_1_v_0_dapagliflozin_mouse | sex female left ventricle strain c57bl6/j diet control (lfd) saline age 18 22 months vs sex female left ventricle strain c57bl6/j diet high fat (hfd) angii age 18 22 months |
| GSE246576,GSE246826_2_v_1_dapagliflozin_mouse | mouse db kidney db/db normal vs mouse db kidney db/db dapagliflozin |
| GSE176093_0_v_3_mineral oil_mouse | b6 oil liver wild type (oil) vs lcn2 neg oil liver / (oil) |
| GSE176093_2_v_3_mineral oil_mouse | b6 8w ccl4 liver wild type (ccl4) vs lcn2 neg oil liver / (oil) |
| GSE176093_0_v_1_mineral oil_mouse | b6 oil liver wild type (oil) vs lcn2 neg 8w ccl4 liver / (ccl4) |
| GSE137177_2_v_4_folic acid_mouse | lowfa moderate fa wt f3 e8.5 embryo diet 2 ppm (moderate) gender mouse head vs lowfa moderate fa mutant f3 e8.5 embryo diet 2 ppm (moderate) homozygous ift88 null gender mouse head |
| GSE152441,GSE152442_0_v_2_folic acid_human | u937+fa dmso cell line u937 hematopoietic cells disease state aml cultured fa treated vs u937 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE116299_4_v_1_folic acid_mouse | cntrl 10dcast strain c57bl/6j type ventral prostates experimental groups control diet 10d post castration vs fol 10dcast strain c57bl/6j type ventral prostates experimental groups folate diet 10d post castration |
| GSE116299_4_v_5_folic acid_mouse | cntrl 10dcast strain c57bl/6j type ventral prostates experimental groups control diet 10d post castration vs fol 3dcast strain c57bl/6j type ventral prostates experimental groups folate diet 3d post castration |
| GSE152441,GSE152442_7_v_4_folic acid_human | ims m2 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs ims m2+fa otx cell line m2 hematopoietic cells disease state aml cultured fa treated |
| GSE152441,GSE152442_6_v_4_folic acid_human | u937 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs ims m2+fa otx cell line m2 hematopoietic cells disease state aml cultured fa treated |
| GSE116299_0_v_5_folic acid_mouse | cntrl 3dcast strain c57bl/6j type ventral prostates experimental groups control diet 3d post castration vs fol 3dcast strain c57bl/6j type ventral prostates experimental groups folate diet 3d post castration |
| GSE137177_2_v_0_folic acid_mouse | lowfa moderate fa wt f3 e8.5 embryo diet 2 ppm (moderate) gender mouse head vs enriched fa mutant f3 e8.5 embryo diet 10 ppm (enriched) homozygous ift88 null gender mouse head |
| GSE152441,GSE152442_1_v_2_folic acid_human | ims m2+fa dmso cell line m2 hematopoietic cells disease state aml cultured fa treated vs u937 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE152441,GSE152442_7_v_3_folic acid_human | ims m2 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs ims m2 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE152441,GSE152442_7_v_5_folic acid_human | ims m2 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs u937+fa otx cell line u937 hematopoietic cells disease state aml cultured fa treated |
| GSE116299_0_v_1_folic acid_mouse | cntrl 3dcast strain c57bl/6j type ventral prostates experimental groups control diet 3d post castration vs fol 10dcast strain c57bl/6j type ventral prostates experimental groups folate diet 10d post castration |
| GSE152441,GSE152442_0_v_4_folic acid_human | u937+fa dmso cell line u937 hematopoietic cells disease state aml cultured fa treated vs ims m2+fa otx cell line m2 hematopoietic cells disease state aml cultured fa treated |
| GSE152441,GSE152442_0_v_3_folic acid_human | u937+fa dmso cell line u937 hematopoietic cells disease state aml cultured fa treated vs ims m2 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE152441,GSE152442_7_v_2_folic acid_human | ims m2 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs u937 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE137177_1_v_4_folic acid_mouse | highfa enriched fa wt f3 e8.5 embryo diet 10 ppm (enriched) gender mouse head vs lowfa moderate fa mutant f3 e8.5 embryo diet 2 ppm (moderate) homozygous ift88 null gender mouse head |
| GSE152441,GSE152442_1_v_4_folic acid_human | ims m2+fa dmso cell line m2 hematopoietic cells disease state aml cultured fa treated vs ims m2+fa otx cell line m2 hematopoietic cells disease state aml cultured fa treated |
| GSE116299_4_v_3_folic acid_mouse | cntrl 10dcast strain c57bl/6j type ventral prostates experimental groups control diet 10d post castration vs fol intact strain c57bl/6j type ventral prostates experimental groups folate diet |
| GSE152441,GSE152442_1_v_5_folic acid_human | ims m2+fa dmso cell line m2 hematopoietic cells disease state aml cultured fa treated vs u937+fa otx cell line u937 hematopoietic cells disease state aml cultured fa treated |
| GSE137177_1_v_0_folic acid_mouse | highfa enriched fa wt f3 e8.5 embryo diet 10 ppm (enriched) gender mouse head vs enriched fa mutant f3 e8.5 embryo diet 10 ppm (enriched) homozygous ift88 null gender mouse head |
| GSE152441,GSE152442_1_v_3_folic acid_human | ims m2+fa dmso cell line m2 hematopoietic cells disease state aml cultured fa treated vs ims m2 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE152441,GSE152442_6_v_5_folic acid_human | u937 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs u937+fa otx cell line u937 hematopoietic cells disease state aml cultured fa treated |
| GSE116299_6_v_5_folic acid_mouse | cntrl intact strain c57bl/6j type ventral prostates experimental groups control diet vs fol 3dcast strain c57bl/6j type ventral prostates experimental groups folate diet 3d post castration |
| GSE116299_6_v_1_folic acid_mouse | cntrl intact strain c57bl/6j type ventral prostates experimental groups control diet vs fol 10dcast strain c57bl/6j type ventral prostates experimental groups folate diet 10d post castration |
| GSE152441,GSE152442_6_v_3_folic acid_human | u937 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs ims m2 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE116299_0_v_3_folic acid_mouse | cntrl 3dcast strain c57bl/6j type ventral prostates experimental groups control diet 3d post castration vs fol intact strain c57bl/6j type ventral prostates experimental groups folate diet |
| GSE152441,GSE152442_6_v_2_folic acid_human | u937 fa dmso cell line hematopoietic cells disease state aml cultured without treated vs u937 fa otx cell line hematopoietic cells disease state aml cultured without treated |
| GSE152441,GSE152442_0_v_5_folic acid_human | u937+fa dmso cell line u937 hematopoietic cells disease state aml cultured fa treated vs u937+fa otx cell line u937 hematopoietic cells disease state aml cultured fa treated |
| GSE189653,GSE203344_2_v_1_fluoxetine_mouse | arid1b p10 wildtype strain c57bl/6n whole brain age postnatal day 10 sex male vs arid1b p120 fluoxetine treated hetero strain c57bl/6n whole brain age postnatal day 120 sex male |
| GSE153836_11_v_2_fluoxetine_mouse | estn con d7 neural embryonic stem cells time day 7 control replicate vs estn vnx d13 neural embryonic stem cells time day 13 90 um venlafaxine replicate |
| GSE153836_14_v_1_fluoxetine_mouse | estn con d13 neural embryonic stem cells time day 13 control replicate vs estn flx d7 neural embryonic stem cells time day 7 2 um fluoxetine replicate |
| GSE189653,GSE203344_5_v_3_fluoxetine_mouse | arid1b p120 fluoxetine treated wildtype strain c57bl/6n whole brain age postnatal day 120 sex male vs arid1b p10 hetero strain c57bl/6n whole brain age postnatal day 10 sex male |
| GSE189653,GSE203344_4_v_1_fluoxetine_mouse | arid1b p120 vehicle wildtype strain c57bl/6n whole brain age postnatal day 120 sex male vs arid1b p120 fluoxetine treated hetero strain c57bl/6n whole brain age postnatal day 120 sex male |
| GSE158674_1_v_2_fluoxetine_human | dmso gbm cancer cells cell line derived neurosphere vs fluoxetine gbm cancer cells cell line derived neurosphere |
| GSE153836_11_v_5_fluoxetine_mouse | estn con d7 neural embryonic stem cells time day 7 control replicate vs estn vnx d7 neural embryonic stem cells time day 7 90 um venlafaxine replicate |
| GSE153836_14_v_2_fluoxetine_mouse | estn con d13 neural embryonic stem cells time day 13 control replicate vs estn vnx d13 neural embryonic stem cells time day 13 90 um venlafaxine replicate |
| GSE153836_14_v_5_fluoxetine_mouse | estn con d13 neural embryonic stem cells time day 13 control replicate vs estn vnx d7 neural embryonic stem cells time day 7 90 um venlafaxine replicate |
| GSE153836_11_v_9_fluoxetine_mouse | estn con d7 neural embryonic stem cells time day 7 control replicate vs estn flx d13 neural embryonic stem cells time day 13 2 um fluoxetine replicate |
| GSE189653,GSE203344_5_v_1_fluoxetine_mouse | arid1b p120 fluoxetine treated wildtype strain c57bl/6n whole brain age postnatal day 120 sex male vs arid1b p120 fluoxetine treated hetero strain c57bl/6n whole brain age postnatal day 120 sex male |
| GSE189653,GSE203344_2_v_3_fluoxetine_mouse | arid1b p10 wildtype strain c57bl/6n whole brain age postnatal day 10 sex male vs arid1b p10 hetero strain c57bl/6n whole brain age postnatal day 10 sex male |
| GSE189653,GSE203344_4_v_3_fluoxetine_mouse | arid1b p120 vehicle wildtype strain c57bl/6n whole brain age postnatal day 120 sex male vs arid1b p10 hetero strain c57bl/6n whole brain age postnatal day 10 sex male |
| GSE189653,GSE203344_2_v_0_fluoxetine_mouse | arid1b p10 wildtype strain c57bl/6n whole brain age postnatal day 10 sex male vs arid1b p120 vehicle hetero strain c57bl/6n whole brain age postnatal day 120 sex male |
| GSE188599_11_v_10_resolvin e1_mouse | ko con veh strain c57bl/6j chemr23 knockout dietary group lean (10% kcal fat) vehicle control (ethanol+pbs) whole liver vs ko hf rve1 strain c57bl/6j chemr23 knockout dietary group high fat (60% kcal fat) resolvin e1 300ng whole liver |
| GSE188599_1_v_10_resolvin e1_mouse | wt con veh strain c57bl/6j chemr23 wildtype dietary group lean (10% kcal fat) vehicle control (ethanol+pbs) whole liver vs ko hf rve1 strain c57bl/6j chemr23 knockout dietary group high fat (60% kcal fat) resolvin e1 300ng whole liver |
| GSE188599_0_v_10_resolvin e1_mouse | ko hf veh strain c57bl/6j chemr23 knockout dietary group high fat (60% kcal fat) vehicle control (ethanol+pbs) whole liver vs ko hf rve1 strain c57bl/6j chemr23 knockout dietary group high fat (60% kcal fat) resolvin e1 300ng whole liver |
| GSE102342,GSE102648_1_v_2_curcumin_mouse | control [rna seq] strain c57bl/6 colon age 18 weeks group epithelial cell vs aomdss [rna seq] strain c57bl/6 colon age 18 weeks group aom dss induced epithelial cell |
| GSE203408_1_v_3_curcumin_human | control pbmcs treated hfn individual disease state blood pbmc vs ad pbmcs treated hfn individual disease state blood pbmc |
| GSE203408_2_v_3_curcumin_human | control pbmcs 1 individual f53 disease state blood pbmc vs ad pbmcs treated hfn individual disease state blood pbmc |
| GSE102342,GSE102648_1_v_0_curcumin_mouse | control [rna seq] strain c57bl/6 colon age 18 weeks group epithelial cell vs aomdsscurcumin [rna seq] strain c57bl/6 colon age 18 weeks group aom dss induced plus curcumin epithelial cell |
| GSE203408_0_v_3_curcumin_human | ad pbmcs untreated individual disease state blood pbmc nt vs ad pbmcs treated hfn individual disease state blood pbmc |
| GSE106339_1_v_0_ghrelin_mouse | wt ovary strain c57/bl6 age 3 weeks vs goat ko ovary strain c57/bl6 age 3 weeks |
| GSE150134_1_v_0_fluorouracil_human | 480 control sw480 cells colorectal carcinoma cancer cell line vs 480 scn5a knockdown sw480 cells colorectal carcinoma cancer cell line |
| GSE196407_1_v_0_fluorouracil_mouse | salivary gland control ed mice 5 fu diet strain icr age 10 week old vs salivary gland ed mice 5 fu diet elemental strain icr age 10 week old |
| GSE168401_1_v_0_harmine_human | control cell line u2os indy cells vs cell line u2os harmine hydrochloride cells |
| GSE168401_2_v_0_harmine_human | harmine cell line u2os control cells vs cell line u2os harmine hydrochloride cells |
| GSE168401_2_v_3_harmine_human | harmine cell line u2os control cells vs indy cell line u2os cells |
| GSE168401_1_v_3_harmine_human | control cell line u2os indy cells vs indy cell line u2os cells |
| GSE162892_3_v_0_isox_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs commercially available psc derived astrocytes replicate induced pluripotent stem cell overexpressed transcription factor tf overexpression differentiation day known |
| GSE162892_4_v_0_isox_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs commercially available psc derived astrocytes replicate induced pluripotent stem cell overexpressed transcription factor tf overexpression differentiation day known |
| GSE162892_3_v_5_isox_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs als mutant isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived (als mutant) overexpressed transcription factor sox9 differentiation day 23 |
| GSE162892_4_v_5_isox_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs als mutant isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived (als mutant) overexpressed transcription factor sox9 differentiation day 23 |
| GSE162892_4_v_2_isox_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs commercially available primary human fetal astrocytes replicate overexpressed transcription factor tf overexpression differentiation day |
| GSE162892_4_v_1_isox_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs als mutant isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived (als mutant) overexpressed transcription factor sox9 differentiation day 48 |
| GSE162892_3_v_2_isox_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs commercially available primary human fetal astrocytes replicate overexpressed transcription factor tf overexpression differentiation day |
| GSE162892_3_v_1_isox_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs als mutant isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived (als mutant) overexpressed transcription factor sox9 differentiation day 48 |
| GSE159893_2_v_1_genistein_human | cervical cancer control cell line hela solvent (dmso) human vs cervical cancer tanshinone cell line hela 50 um human |
| GSE159893_2_v_0_genistein_human | cervical cancer control cell line hela solvent (dmso) human vs cervical cancer genistein cell line hela 50 um human |
| GSE194163_1_v_0_genistein_mouse | control rna seq mammary tumor strain fvb age ~25 weeks sv40 tag transgenic mice vs maternal lt ge rna seq mammary tumor strain fvb age ~25 weeks sv40 tag transgenic mice |
| GSE188458_2_v_3_hydrogen peroxide_human | h2o2 0 rep untreated cell line htert hpne pancreatic vs h2o2 24 rep 300 um cell line htert hpne pancreatic |
| GSE188458_2_v_0_hydrogen peroxide_human | h2o2 0 rep untreated cell line htert hpne pancreatic vs ncs 24 rep 400 ng/ml neocarzinostatin cell line htert hpne pancreatic |
| GSE188458_2_v_4_hydrogen peroxide_human | h2o2 0 rep untreated cell line htert hpne pancreatic vs ncs rep 400 ng/ml neocarzinostatin cell line htert hpne pancreatic |
| GSE188458_2_v_1_hydrogen peroxide_human | h2o2 0 rep untreated cell line htert hpne pancreatic vs h2o2 rep 300 um cell line htert hpne pancreatic |
| GSE239688_2_v_5_canagliflozin_human | pc3 cells treated dmso (control 24hr disease state prostate cancer cell line mcrpc vs 22rv1 cells treated canagliflozin (10um) (10cana 24hr disease state prostate cancer cell line crpc 10um |
| GSE239688_4_v_3_canagliflozin_human | 22rv1 cells treated dmso (control 24hr disease state prostate cancer cell line crpc vs 22rv1 cells treated canagliflozin (10um) + radiation (5gy) (rt(5gy)+10cana 24hr disease state prostate cancer cell line crpc 10um |
| GSE239688_4_v_1_canagliflozin_human | 22rv1 cells treated dmso (control 24hr disease state prostate cancer cell line crpc vs 22rv1 cells treated radiation (5gy) (rt(5gy 24hr disease state prostate cancer cell line crpc |
| GSE239688_2_v_3_canagliflozin_human | pc3 cells treated dmso (control 24hr disease state prostate cancer cell line mcrpc vs 22rv1 cells treated canagliflozin (10um) + radiation (5gy) (rt(5gy)+10cana 24hr disease state prostate cancer cell line crpc 10um |
| GSE239688_2_v_1_canagliflozin_human | pc3 cells treated dmso (control 24hr disease state prostate cancer cell line mcrpc vs 22rv1 cells treated radiation (5gy) (rt(5gy 24hr disease state prostate cancer cell line crpc |
| GSE239688_2_v_0_canagliflozin_human | pc3 cells treated dmso (control 24hr disease state prostate cancer cell line mcrpc vs pc3 cells treated canagliflozin (10um) (10cana 24hr disease state prostate cancer cell line mcrpc 10um |
| GSE239688_4_v_0_canagliflozin_human | 22rv1 cells treated dmso (control 24hr disease state prostate cancer cell line crpc vs pc3 cells treated canagliflozin (10um) (10cana 24hr disease state prostate cancer cell line mcrpc 10um |
| GSE102467_1_v_2_pazopanib_human | 48h dev dmso cell line vs 48h dev clof cell line |
| GSE102467_1_v_0_pazopanib_human | 48h dev dmso cell line vs 48h g401 clof cell line |
| GSE102467_3_v_2_pazopanib_human | 48h g401 dmso cell line vs 48h dev clof cell line |
| GSE102467_3_v_0_pazopanib_human | 48h g401 dmso cell line vs 48h g401 clof cell line |
| GSE182727_1_v_0_busulfan_mouse | undifferentiated spermatogonia ctrl testis strain c57bl/6j age adult (6 8 weeks) control vs undifferentiated spermatogonia bu testis strain c57bl/6j age adult (6 8 weeks) busulfan |
| GSE215461_0_v_1_topotecan_human | dmso cd4+ cell infection status model hiv latency rna extract vs tpt cd4+ cell infection status model hiv latency 10 um rna extract |
| GSE137053,GSE163076_1_v_0_topotecan_human | profiling rna rrna depleted library primary tumors [c pt tumor control mice (c pt) vs profiling rna rrna depleted library liver metastases lm mice lm) |
| GSE150669_0_v_1_roxadustat_mouse | sca1macs control 7 tage mesenchymal stem cell like kidney marker sca1+ time (day) primary mouse vs sca1macs roxa 7 tage mesenchymal stem cell like kidney marker sca1+ time (day) roxadustat primary mouse |
| GSE150669_0_v_3_roxadustat_mouse | sca1macs control 7 tage mesenchymal stem cell like kidney marker sca1+ time (day) primary mouse vs sca1macs roxa 21 tage mesenchymal stem cell like kidney marker sca1+ time (day) roxadustat primary mouse |
| GSE150669_2_v_3_roxadustat_mouse | sca1macs control 21tage mesenchymal stem cell like kidney marker sca1+ time (day) 21 primary mouse vs sca1macs roxa 21 tage mesenchymal stem cell like kidney marker sca1+ time (day) roxadustat primary mouse |
| GSE150669_2_v_1_roxadustat_mouse | sca1macs control 21tage mesenchymal stem cell like kidney marker sca1+ time (day) 21 primary mouse vs sca1macs roxa 7 tage mesenchymal stem cell like kidney marker sca1+ time (day) roxadustat primary mouse |
| GSE110303,GSE110304_1_v_2_estradiol_mouse | wt e2 (17 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 17 old agent vs ko e2 (17 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 17 old eralphako agent |
| GSE110303,GSE110304_1_v_0_estradiol_mouse | wt e2 (17 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 17 old agent vs ko plb (17 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 17 old eralphako agent |
| GSE110300,GSE110304_0_v_1_estradiol_mouse | wt (7 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 7 old agent vs ko e2 (7 week old) cells mandibular condylar fibrocartilage strain c57bl/6 age 7 old eralphako agent |
| GSE224237_1_v_0_resiquimod_mouse | control (group1 tumor c57bl/6 pbs phenotype vs anti pd 1 antibody responsive (group3 tumor c57bl/6 phenotype |
| GSE224237_1_v_2_resiquimod_mouse | control (group1 tumor c57bl/6 pbs phenotype vs anti pd 1 antibody nonresponsive (group2 tumor c57bl/6 phenotype |
| GSE234647_0_v_3_regorafenib_human | snu449 wt parental liver cell line hepatocellular carcinoma naive vs snu449 axlko plusrego liver cell line hepatocellular carcinoma axl ko regorafenib long term |
| GSE234647_1_v_3_regorafenib_human | snu449 wt plusrego liver cell line hepatocellular carcinoma regorafenib long term vs snu449 axlko plusrego liver cell line hepatocellular carcinoma axl ko regorafenib long term |
| GSE234647_1_v_2_regorafenib_human | snu449 wt plusrego liver cell line hepatocellular carcinoma regorafenib long term vs snu449 axlko parental liver cell line hepatocellular carcinoma axl ko naive |
| GSE234647_0_v_2_regorafenib_human | snu449 wt parental liver cell line hepatocellular carcinoma naive vs snu449 axlko parental liver cell line hepatocellular carcinoma axl ko naive |
| GSE173405_4_v_0_dmba_mouse | dmba treated 2we wt mouse mammary gland cells strain/ c57bl/6jx129 6x samples 2 weeks last dose vs dmba treated endpoint cip2a / mouse mammary gland cells strain/ c57bl/6jx129 6x samples sacrificed due induced tumors |
| GSE135983_0_v_1_dmba_mouse | wt sample keratinocytes strain 19(cre ert) mtmg bred fvb epidermis short term dmba/tpa treated vs ko sample keratinocytes strain 19(cre ert) mtmg itga3 fl/fl bred fvb epidermis short term dmba/tpa treated |
| GSE173405_3_v_0_dmba_mouse | control cip2a / mouse mammary gland cells strain/ c57bl/6jx129 vs dmba treated endpoint cip2a / mouse mammary gland cells strain/ c57bl/6jx129 6x samples sacrificed due induced tumors |
| GSE241108_1_v_0_sulfasalazine_human | control sirna rep cell line osc19sszr oral squamous carcinoma vs foxa1 sirna rep cell line osc19sszr oral squamous carcinoma |
| GSE211224_2_v_1_donepezil_mouse | lung control vs lung bleomycin |
| GSE211224_2_v_0_donepezil_mouse | lung control vs lung donepezil |
| GSE95688_7_v_3_glutathione_mouse | wt fibers strain/background c57bl/6 /variation lens cortical fiber cells none wild type vs legsko fibers strain/background c57bl/6 /variation lens cortical fiber cells none |
| GSE147626_2_v_0_glutathione_human | hct116 wt cell line vs u87mg ko cell line |
| GSE145311_1_v_2_glutathione_mouse | age 8 weeks induced tregs strain c57bl/6 wt mouse vs age 8 weeks induced tregs strain c57bl/6 gclc mutant mouse |
| GSE226285_3_v_1_glutathione_human | a549 shnc cell line non small lung cancer wt knockdown control none vs a549 shnr0b1 cell line non small lung cancer nr0b1 knockdown none |
| GSE242290_1_v_2_glutathione_human | wt bso biol cell line hap1 cells vs neil1 biol un cell line hap1 cells media |
| GSE147626_3_v_1_glutathione_human | u87mg wt cell line vs hct116 gsto1 ko cell line |
| GSE147626_3_v_0_glutathione_human | u87mg wt cell line vs u87mg ko cell line |
| GSE242290_1_v_6_glutathione_human | wt bso biol cell line hap1 cells vs neil3 bso biol cell line hap1 cells |
| GSE242049_1_v_0_glutathione_mouse | aml12 cells wt cell line alpha mouse liver 12 vs aml12 cells ko cell line alpha mouse liver 12 txndc5 knockdown |
| GSE242049_1_v_2_glutathione_mouse | aml12 cells wt cell line alpha mouse liver 12 vs aml12 cells ki cell line alpha mouse liver 12 txndc5 knockin |
| GSE226285_3_v_0_glutathione_human | a549 shnc cell line non small lung cancer wt knockdown control none vs a549 nr0b1 oe cell line non small lung cancer overexpression none |
| GSE242290_3_v_10_glutathione_human | wt un biol cell line hap1 cells media vs neil2 biol un cell line hap1 cells media |
| GSE231511_0_v_1_glutathione_mouse | fat normal saline supplementary adipose supplement vs fat glutathione supplementary adipose supplement |
| GSE242290_3_v_8_glutathione_human | wt un biol cell line hap1 cells media vs neil123 un biol cell line hap1 cells media |
| GSE242290_1_v_7_glutathione_human | wt bso biol cell line hap1 cells vs neil123 bso biol cell line hap1 cells |
| GSE242290_3_v_7_glutathione_human | wt un biol cell line hap1 cells media vs neil123 bso biol cell line hap1 cells |
| GSE242290_3_v_2_glutathione_human | wt un biol cell line hap1 cells media vs neil1 biol un cell line hap1 cells media |
| GSE242290_1_v_11_glutathione_human | wt bso biol cell line hap1 cells vs neil1 biol bso cell line hap1 cells |
| GSE95688_7_v_5_glutathione_mouse | wt fibers strain/background c57bl/6 /variation lens cortical fiber cells none wild type vs legsko+bso epithelia strain/background c57bl/6 /variation legsko lens buthionine sulfoximine (bso) bso treated |
| GSE145311_0_v_3_glutathione_mouse | age 8 weeks sorted regulatory cells strain c57bl/6 wt mouse vs age 8 weeks sorted regulatory cells strain c57bl/6 gclc mutant mouse |
| GSE242290_1_v_0_glutathione_human | wt bso biol cell line hap1 cells vs neil2 biol bso cell line hap1 cells |
| GSE145311_0_v_2_glutathione_mouse | age 8 weeks sorted regulatory cells strain c57bl/6 wt mouse vs age 8 weeks induced tregs strain c57bl/6 gclc mutant mouse |
| GSE242290_3_v_4_glutathione_human | wt un biol cell line hap1 cells media vs neil3 un biol cell line hap1 cells media |
| GSE95688_1_v_3_glutathione_mouse | wt epithelia strain/background c57bl/6 /variation lens none wild type vs legsko fibers strain/background c57bl/6 /variation lens cortical fiber cells none |
| GSE115919_1_v_0_glutathione_mouse | strain c57bl/6 p190 bcr abl+ leukemic b cell precursors wt vs strain c57bl/6 p190 bcr abl+ leukemic b cell precursors klf5 / |
| GSE95688_1_v_0_glutathione_mouse | wt epithelia strain/background c57bl/6 /variation lens none wild type vs legsko+bso fibers strain/background c57bl/6 /variation legsko lens cortical fiber cells buthionine sulfoximine (bso) bso treated |
| GSE145311_1_v_3_glutathione_mouse | age 8 weeks induced tregs strain c57bl/6 wt mouse vs age 8 weeks sorted regulatory cells strain c57bl/6 gclc mutant mouse |
| GSE242290_1_v_10_glutathione_human | wt bso biol cell line hap1 cells vs neil2 biol un cell line hap1 cells media |
| GSE95688_7_v_0_glutathione_mouse | wt fibers strain/background c57bl/6 /variation lens cortical fiber cells none wild type vs legsko+bso fibers strain/background c57bl/6 /variation legsko lens cortical fiber cells buthionine sulfoximine (bso) bso treated |
| GSE242290_1_v_8_glutathione_human | wt bso biol cell line hap1 cells vs neil123 un biol cell line hap1 cells media |
| GSE242290_1_v_4_glutathione_human | wt bso biol cell line hap1 cells vs neil3 un biol cell line hap1 cells media |
| GSE242290_3_v_0_glutathione_human | wt un biol cell line hap1 cells media vs neil2 biol bso cell line hap1 cells |
| GSE147626_2_v_1_glutathione_human | hct116 wt cell line vs hct116 gsto1 ko cell line |
| GSE242290_3_v_6_glutathione_human | wt un biol cell line hap1 cells media vs neil3 bso biol cell line hap1 cells |
| GSE95688_1_v_2_glutathione_mouse | wt epithelia strain/background c57bl/6 /variation lens none wild type vs legsko epithelia strain/background c57bl/6 /variation lens none |
| GSE226285_2_v_1_glutathione_human | a549 oec cell line non small lung cancer wt overexpression control none vs a549 shnr0b1 cell line non small lung cancer nr0b1 knockdown none |
| GSE226285_2_v_0_glutathione_human | a549 oec cell line non small lung cancer wt overexpression control none vs a549 nr0b1 oe cell line non small lung cancer overexpression none |
| GSE242290_3_v_11_glutathione_human | wt un biol cell line hap1 cells media vs neil1 biol bso cell line hap1 cells |
| GSE95688_7_v_2_glutathione_mouse | wt fibers strain/background c57bl/6 /variation lens cortical fiber cells none wild type vs legsko epithelia strain/background c57bl/6 /variation lens none |
| GSE95688_1_v_5_glutathione_mouse | wt epithelia strain/background c57bl/6 /variation lens none wild type vs legsko+bso epithelia strain/background c57bl/6 /variation legsko lens buthionine sulfoximine (bso) bso treated |
| GSE103068_0_v_1_volasertib_human | dmso 4h method rna seq replicate internal id mv 4 11 b cells vs volasertib 20nm 24h method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_5_v_4_volasertib_human | dmso 24h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 4h volasertib 20nm method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_5_v_3_volasertib_human | dmso 24h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 24h volasertib 20nm method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_5_v_1_volasertib_human | dmso 24h method rna seq replicate internal id mv 4 11 b cells vs volasertib 20nm 24h method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_0_v_7_volasertib_human | dmso 4h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 rep2 method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_5_v_7_volasertib_human | dmso 24h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 rep2 method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_0_v_3_volasertib_human | dmso 4h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 24h volasertib 20nm method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_0_v_4_volasertib_human | dmso 4h method rna seq replicate internal id mv 4 11 b cells vs bi00894999 4h volasertib 20nm method rna seq replicate internal id mv 4 11 b cells |
| GSE103068_5_v_8_volasertib_human | dmso 24h method rna seq replicate internal id mv 4 11 b cells vs volasertib 20nm 4h method rna seq replicate internal id mv 4 11 b cells |
| GSE108919_0_v_1_cyclosporine_human | ctrl 18h control kidney phenotype cd144+/cd31+ human peritubular microvascular endothelial cell cultured hkmec donor vs csa 18h exposed 18 hrs kidney phenotype cd144+/cd31+ human peritubular microvascular endothelial cell cultured hkmec donor |
| GSE69869_0_v_1_panobinostat_mouse | control neuroblastoma entire tumor composition cells+ stroma cells origin transgenic th mycn strain intra abdominal vehicle vs 24 neuroblastoma entire tumor composition cells+ stroma cells origin transgenic th mycn strain intra abdominal panobinostat |
| GSE142210_3_v_5_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1b fc65 origin glioblastoma cell line t98g passage 5 e64fc65 human cancer |
| GSE142210_3_v_1_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1b pano origin glioblastoma cell line t98g passage 5 panobinostat human cancer |
| GSE142210_3_v_7_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1 pano 1 origin pancreas cell line panc passage 5 panobinostat human pancreatic cancer |
| GSE142210_4_v_7_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1 pano 1 origin pancreas cell line panc passage 5 panobinostat human pancreatic cancer |
| GSE179693,GSE179694_4_v_1_panobinostat_human | 10 15 dmso cell line replicate nut carcinoma vs tc 797 4h aug2019 cell line replicate nut carcinoma |
| GSE142210_2_v_0_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1 fc65 plus pano 1 origin pancreas cell line panc passage 5 e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_4_v_0_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1 fc65 plus pano 1 origin pancreas cell line panc passage 5 e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_9_v_6_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run2 shatf3 fc26 plus pano 1 origin pancreas cell line panc passage 9 atf3 shrna e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_9_v_10_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1 fc65 1 origin pancreas cell line panc passage 5 e64fc65 human pancreatic cancer |
| GSE142210_11_v_5_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1b fc65 origin glioblastoma cell line t98g passage 5 e64fc65 human cancer |
| GSE142210_11_v_0_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1 fc65 plus pano 1 origin pancreas cell line panc passage 5 e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_9_v_7_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1 pano 1 origin pancreas cell line panc passage 5 panobinostat human pancreatic cancer |
| GSE142210_2_v_5_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1b fc65 origin glioblastoma cell line t98g passage 5 e64fc65 human cancer |
| GSE142210_11_v_6_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run2 shatf3 fc26 plus pano 1 origin pancreas cell line panc passage 9 atf3 shrna e64fc65 + panobinostat human pancreatic cancer |
| GSE80819_0_v_1_panobinostat_human | ecfc control clone id human umbilical cord blood mncs derived ecfcs passages treated dmso (control) vs ecfc drug clone id human umbilical cord blood mncs derived ecfcs passages treated 5 âµm gsk 343 72hrs 10nm panobinostat 2hrs |
| GSE102757_1_v_0_panobinostat_mouse | tall ut 2h 1 notch1 oncogenic lymphocytes treated none (untreated control) vs tall pano 2h 1 notch1 oncogenic lymphocytes treated 25nm panobinostat 2hrs |
| GSE142210_4_v_6_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run2 shatf3 fc26 plus pano 1 origin pancreas cell line panc passage 9 atf3 shrna e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_4_v_5_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1b fc65 origin glioblastoma cell line t98g passage 5 e64fc65 human cancer |
| GSE236280_0_v_1_panobinostat_human | mda231 p0 cell line mda mb 231 breast cancer dmso vs mda231 p50 cell line mda mb 231 breast cancer panobibostat |
| GSE151689_0_v_2_panobinostat_mouse | control replicate veh vs cblo137 treated replicate cbl0137 |
| GSE142210_9_v_0_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1 fc65 plus pano 1 origin pancreas cell line panc passage 5 e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_4_v_8_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1b fc65 plus pano origin glioblastoma cell line t98g passage 5 e64fc65 + panobinostat human cancer |
| GSE142210_4_v_1_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1b pano origin glioblastoma cell line t98g passage 5 panobinostat human cancer |
| GSE142210_3_v_0_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1 fc65 plus pano 1 origin pancreas cell line panc passage 5 e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_4_v_10_panobinostat_human | run1 dmso 1 origin pancreas cell line panc passage 5 human pancreatic cancer vs run1 fc65 1 origin pancreas cell line panc passage 5 e64fc65 human pancreatic cancer |
| GSE179693,GSE179694_4_v_2_panobinostat_human | 10 15 dmso cell line replicate nut carcinoma vs rna pano july2020 cell line panobinostat replicate nut carcinoma |
| GSE142210_3_v_10_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1 fc65 1 origin pancreas cell line panc passage 5 e64fc65 human pancreatic cancer |
| GSE142210_3_v_8_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run1b fc65 plus pano origin glioblastoma cell line t98g passage 5 e64fc65 + panobinostat human cancer |
| GSE142210_2_v_1_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1b pano origin glioblastoma cell line t98g passage 5 panobinostat human cancer |
| GSE142210_9_v_1_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1b pano origin glioblastoma cell line t98g passage 5 panobinostat human cancer |
| GSE151689_0_v_1_panobinostat_mouse | control replicate veh vs panobinostat replicate |
| GSE142210_2_v_6_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run2 shatf3 fc26 plus pano 1 origin pancreas cell line panc passage 9 atf3 shrna e64fc65 + panobinostat human pancreatic cancer |
| GSE236815_1_v_0_panobinostat_mouse | mouse glioma tumor idh1 wildtype adult brain tp53fl/fl stopfl/fl luc sex male stage end pq pdgfb cre vs mouse glioma tumor idh1 r132h adult brain tp53fl/fl stopfl/fl luc sex male stage end pq idh1r132h ires cre pdgfb gfp |
| GSE142210_11_v_10_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1 fc65 1 origin pancreas cell line panc passage 5 e64fc65 human pancreatic cancer |
| GSE142210_11_v_1_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1b pano origin glioblastoma cell line t98g passage 5 panobinostat human cancer |
| GSE142210_9_v_5_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1b fc65 origin glioblastoma cell line t98g passage 5 e64fc65 human cancer |
| GSE142210_9_v_8_panobinostat_human | run2 shatf3 dmso 1 origin pancreas cell line panc passage 9 atf3 shrna human pancreatic cancer vs run1b fc65 plus pano origin glioblastoma cell line t98g passage 5 e64fc65 + panobinostat human cancer |
| GSE142210_11_v_8_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1b fc65 plus pano origin glioblastoma cell line t98g passage 5 e64fc65 + panobinostat human cancer |
| GSE142210_11_v_7_panobinostat_human | run2 shctl dmso 1 origin pancreas cell line panc passage 9 scramble shrna e64fc26 + panobinostat human pancreatic cancer vs run1 pano 1 origin pancreas cell line panc passage 5 panobinostat human pancreatic cancer |
| GSE142210_2_v_8_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1b fc65 plus pano origin glioblastoma cell line t98g passage 5 e64fc65 + panobinostat human cancer |
| GSE142210_3_v_6_panobinostat_human | run1b dmso origin glioblastoma cell line t98g passage 5 human cancer vs run2 shatf3 fc26 plus pano 1 origin pancreas cell line panc passage 9 atf3 shrna e64fc65 + panobinostat human pancreatic cancer |
| GSE142210_2_v_10_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1 fc65 1 origin pancreas cell line panc passage 5 e64fc65 human pancreatic cancer |
| GSE142210_2_v_7_panobinostat_human | run2 shctl fc26 plus pano 1 origin pancreas cell line panc passage 9 scramble shrna dmso human pancreatic cancer vs run1 pano 1 origin pancreas cell line panc passage 5 panobinostat human pancreatic cancer |
| GSE175920_0_v_1_nmda_mouse | glun3a control strain c57bl/6 saline primary cortical neuron culture vs gfp bic1h strain c57bl/6 bicuculine primary cortical neuron culture |
| GSE175920_4_v_2_nmda_mouse | gfp control strain c57bl/6 saline primary cortical neuron culture vs gfp bdnf1h strain c57bl/6 bdnf primary cortical neuron culture |
| GSE175920_0_v_3_nmda_mouse | glun3a control strain c57bl/6 saline primary cortical neuron culture vs glun3a bic1h strain c57bl/6 bicuculine primary cortical neuron culture |
| GSE175920_4_v_1_nmda_mouse | gfp control strain c57bl/6 saline primary cortical neuron culture vs gfp bic1h strain c57bl/6 bicuculine primary cortical neuron culture |
| GSE175920_4_v_3_nmda_mouse | gfp control strain c57bl/6 saline primary cortical neuron culture vs glun3a bic1h strain c57bl/6 bicuculine primary cortical neuron culture |
| GSE175920_0_v_2_nmda_mouse | glun3a control strain c57bl/6 saline primary cortical neuron culture vs gfp bdnf1h strain c57bl/6 bdnf primary cortical neuron culture |
| GSE102598_1_v_2_nmda_mouse | c3h strain c3heb/fe (c3h) rip1tag2 mouse pancreatic neuroendocrine tumor background without /treated normal saline vs b6 strain c57bl/6 (b6) rip1tag2 mouse pancreatic neuroendocrine tumor background treated mk801 |
| GSE225101,GSE225102_0_v_1_nmda_mouse | mouse lv control hippocampus injection kainic acid model mbd5 lentivirus infection one month vs mouse lv mbd5 hippocampus injection kainic acid model lentivirus infection one month |
| GSE193351_4_v_9_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c hip vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week phenotype wrist |
| GSE193351_4_v_3_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c hip vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week 0 phenotype |
| GSE95771_0_v_3_ruxolitinib_mouse | bmt722 wt cd45.2+ lsk strain c57bl/6 wild type bone marrow vs bmt722 vehicle cd45.2+ lsk strain c57bl/6 bone marrow |
| GSE193351_4_v_2_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c hip vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week phenotype |
| GSE193351_1_v_3_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c thigh vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week 0 phenotype |
| GSE193351_1_v_2_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c thigh vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week phenotype |
| GSE95771_0_v_2_ruxolitinib_mouse | bmt722 wt cd45.2+ lsk strain c57bl/6 wild type bone marrow vs bmt722 ag221 cd45.2+ lsk strain c57bl/6 monotherapy bone marrow |
| GSE95771_0_v_1_ruxolitinib_mouse | bmt722 wt cd45.2+ lsk strain c57bl/6 wild type bone marrow vs bmt722 rux cd45.2+ lsk strain c57bl/6 ruxolitinib monotherapy bone marrow |
| GSE193351_1_v_0_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c thigh vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week 4 phenotype r #2 forearm responsive |
| GSE193351_4_v_0_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c hip vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week 4 phenotype r #2 forearm responsive |
| GSE193351_1_v_9_ruxolitinib_human | lp ctrl pre therapy skin disease state normal time week 0 phenotype c thigh vs lp ruxolitinib skin disease state cutaneous lichen planus (lp) time week phenotype wrist |
| GSE218500_0_v_3_ruxolitinib_mouse | cd8 prf1 unrx strain c57bl/6 prftm1sdz/j blood cd8+ cells / lcmv untreated age day 9 vs cd8 prf1 naive strain c57bl/6 prftm1sdz/j blood cd8+ cells / age day 9 |
| GSE95771_0_v_4_ruxolitinib_mouse | bmt722 wt cd45.2+ lsk strain c57bl/6 wild type bone marrow vs bmt722 combo cd45.2+ lsk strain c57bl/6 combined therapy bone marrow |
| GSE207282_1_v_0_polydatin_human | control liver cell line hepg2 hepatocellular carcinoma cells vs polydatin liver cell line hepg2 hepatocellular carcinoma cells pd |
| GSE154936_3_v_1_remdesivir_human | dmso colon human colorectal cell line 1 2500 duration vs remdesivir colon human colorectal cell line um duration |
| GSE154936_3_v_4_remdesivir_human | dmso colon human colorectal cell line 1 2500 duration vs hcq colon human colorectal cell line 100 um duration |
| GSE154936_3_v_2_remdesivir_human | dmso colon human colorectal cell line 1 2500 duration vs plc/prf/5 cas9ng mche liver human alexander hepatoma cell line duration |
| GSE186460_3_v_6_baricitinib_human | h24 noinfection p20064 epirna lung epithelial cells untreated condition 24h leucocytes transmigration nci h441 vs covid19 p20064 epirna hours minus sars lung epithelial cells post cov 2 infection condition baseline transmigration nci h441 |
| GSE186460_0_v_6_baricitinib_human | h0 noinfection epitime 0 donorna lung epithelial cells untreated condition baseline transmigration nci h441 vs covid19 p20064 epirna hours minus sars lung epithelial cells post cov 2 infection condition baseline transmigration nci h441 |
| GSE186460_3_v_2_baricitinib_human | h24 noinfection p20064 epirna lung epithelial cells untreated condition 24h leucocytes transmigration nci h441 vs h24 noinfection baricitinib p20064 epirna lung epithelial cells 24 hours infection post condition 24h leucocytes transmigration nci h441 |
| GSE186460_0_v_2_baricitinib_human | h0 noinfection epitime 0 donorna lung epithelial cells untreated condition baseline transmigration nci h441 vs h24 noinfection baricitinib p20064 epirna lung epithelial cells 24 hours infection post condition 24h leucocytes transmigration nci h441 |
| GSE217552_3_v_0_fisetin_human | heka control 1] skin cells epilife + 1%hkgs 1%pest human epidermal keratinocyte cell line (heka) vs heka + activated rapamycin [hekt17 1] skin cells epilife 1%hkgs 1%pest tnfî±+ il17a 100nm 10 ng/ml 20ng/ml human epidermal keratinocyte cell line (heka) |
| GSE217552_3_v_4_fisetin_human | heka control 1] skin cells epilife + 1%hkgs 1%pest human epidermal keratinocyte cell line (heka) vs heka + activated fisetin [hekt17 1] skin cells epilife 1%hkgs 1%pest tnfî±+ il17a 20î¼m 10 ng/ml 20ng/ml human epidermal keratinocyte cell line (heka) |
| GSE217552_3_v_5_fisetin_human | heka control 1] skin cells epilife + 1%hkgs 1%pest human epidermal keratinocyte cell line (heka) vs heka + activated fisetin rapamycin [hekt17 1] skin cells epilife 1%hkgs 1%pest tnfî±+ il17a 15î¼m 100nm 10 ng/ml 20ng/ml human epidermal keratinocyte cell line (heka) |
| GSE217552_3_v_2_fisetin_human | heka control 1] skin cells epilife + 1%hkgs 1%pest human epidermal keratinocyte cell line (heka) vs heka + activated methotrexate [hekt17 1] skin cells epilife 1%hkgs 1%pest tnfî±+ il17a 1î¼m 10 ng/ml 20ng/ml human epidermal keratinocyte cell line (heka) |
| GSE217552_3_v_1_fisetin_human | heka control 1] skin cells epilife + 1%hkgs 1%pest human epidermal keratinocyte cell line (heka) vs heka + activated 1] skin cells epilife 1%hkgs 1%pest tnfî±+ il17a 10 ng/ml 20ng/ml human epidermal keratinocyte cell line (heka) |
| GSE143462_0_v_1_omipalisib_human | con 150 1 cell line esophageal tumor kyse150 control treated vs c1 150 1 cell line esophageal tumor kyse150 omipalisib treated |
| GSE135352_2_v_3_napabucasin_human | miapaca2 nqo1 71 dmso rep cas9 expressing pancreatic cancer cell line sgrna (taagccagaacagactcggc) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 parental napabucasin rep pancreatic cancer cell line sgrna none agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_0_v_1_napabucasin_human | miapaca2 parental dmso rep pancreatic cancer cell line sgrna none agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 nqo1 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_0_v_3_napabucasin_human | miapaca2 parental dmso rep pancreatic cancer cell line sgrna none agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 parental napabucasin rep pancreatic cancer cell line sgrna none agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_0_v_4_napabucasin_human | miapaca2 parental dmso rep pancreatic cancer cell line sgrna none agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 rosa26 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_6_v_4_napabucasin_human | miapaca2 nqo1 163 dmso rep cas9 expressing pancreatic cancer cell line sgrna (gaatgacattcatgtccccg) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 rosa26 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_6_v_1_napabucasin_human | miapaca2 nqo1 163 dmso rep cas9 expressing pancreatic cancer cell line sgrna (gaatgacattcatgtccccg) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 nqo1 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_2_v_4_napabucasin_human | miapaca2 nqo1 71 dmso rep cas9 expressing pancreatic cancer cell line sgrna (taagccagaacagactcggc) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 rosa26 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_6_v_3_napabucasin_human | miapaca2 nqo1 163 dmso rep cas9 expressing pancreatic cancer cell line sgrna (gaatgacattcatgtccccg) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 parental napabucasin rep pancreatic cancer cell line sgrna none agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE135352_2_v_1_napabucasin_human | miapaca2 nqo1 71 dmso rep cas9 expressing pancreatic cancer cell line sgrna (taagccagaacagactcggc) agent vehicle control (dmso) 2 hours pancreas epithelial carcinoma vs miapaca2 nqo1 napabucasin rep cas9 expressing pancreatic cancer cell line sgrna agent 500 nm 2 hours pancreas epithelial carcinoma |
| GSE165334_3_v_0_dabrafenib_human | a375 bir dmso ctr cell line melanoma braf inhibitor resistant (bir) vs a375 bir dab200 cell line dab melanoma braf inhibitor resistant (bir) |
| GSE165334_3_v_1_dabrafenib_human | a375 bir dmso ctr cell line melanoma braf inhibitor resistant (bir) vs a375 dab200 cell line dab melanoma |
| GSE165334_2_v_0_dabrafenib_human | a375 dmso ctr cell line melanoma vs a375 bir dab200 cell line dab melanoma braf inhibitor resistant (bir) |
| GSE101239_3_v_6_valproic acid_mouse | control 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp vs vpa 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE129241_4_v_0_valproic acid_human | ctrl day1 hes derived induced neurons (hes ) control day4 vs vpa day1 hes derived induced neurons (hes ) valproic acid day4 |
| GSE187006_3_v_2_valproic acid_human | u1m forebrain organoids derived ips cell line control organoid vs u2f forebrain organoids derived ips cell line vpa organoid |
| GSE232218_1_v_0_valproic acid_human | brain organoids vehicle (day 6) cell line ipsc (aics 0023) sex male control vs brain organoids vpa400 (day 6) cell line ipsc (aics 0023) sex male vpa 400 um |
| GSE101239_3_v_1_valproic acid_mouse | control 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp vs vpa+run 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE90552_1_v_0_valproic acid_human | pbs source cd34+ hematopoietic stem progenitor cells culture period vitro 5 days control treated type expanded g csf mobilized peripheral blood vs valproic acid source cd34+ hematopoietic stem progenitor cells culture period vitro 5 days treated type expanded g csf mobilized peripheral blood |
| GSE101239_5_v_6_valproic acid_mouse | control p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp vs vpa 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE101239_5_v_1_valproic acid_mouse | control p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp vs vpa+run 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE129241_3_v_6_valproic acid_human | ctrl day50 56 hes derived induced neurons (hes ) control vs vpa day21 hes derived induced neurons (hes ) valproic acid day28 |
| GSE101239_4_v_6_valproic acid_mouse | control e15 neural stem/progenitor cells strain c57bl/6 forebrain age embryonic day15 nestin egfp vs vpa 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE101239_4_v_1_valproic acid_mouse | control e15 neural stem/progenitor cells strain c57bl/6 forebrain age embryonic day15 nestin egfp vs vpa+run 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp |
| GSE194128_1_v_0_valproic acid_mouse | d3 ctr regwme strain balb/c model precision cut liver slice none culture time 3 days vs d3 vpa vpawme strain balb/c model precision cut liver slice 2.5 mm culture time 3 days |
| GSE109140_0_v_3_valproic acid_human | high glucose replicate cell line hepg2 cells medium 20 mm control vs low glucose vpa replicate 1 cell line hepg2 cells medium 5.5 mm |
| GSE101239_3_v_0_valproic acid_mouse | control 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp vs vpa e15 neural stem/progenitor cells strain c57bl/6 forebrain age embryonic day15 nestin egfp |
| GSE109140_2_v_1_valproic acid_human | low glucose replicate cell line hepg2 cells medium 5.5 mm control vs high glucose vpa replicate 1 cell line hepg2 cells medium 20 mm |
| GSE101239_3_v_2_valproic acid_mouse | control 12w neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age 12 weeks old nestin egfp vs vpa p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp |
| GSE101239_5_v_2_valproic acid_mouse | control p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp vs vpa p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp |
| GSE129241_1_v_0_valproic acid_human | ctrl day21 hes derived induced neurons (hes ) control day28 vs vpa day1 hes derived induced neurons (hes ) valproic acid day4 |
| GSE187006_3_v_1_valproic acid_human | u1m forebrain organoids derived ips cell line control organoid vs u1m forebrain organoids derived ips cell line vpa organoid |
| GSE101239_4_v_2_valproic acid_mouse | control e15 neural stem/progenitor cells strain c57bl/6 forebrain age embryonic day15 nestin egfp vs vpa p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp |
| GSE129241_3_v_0_valproic acid_human | ctrl day50 56 hes derived induced neurons (hes ) control vs vpa day1 hes derived induced neurons (hes ) valproic acid day4 |
| GSE129241_4_v_6_valproic acid_human | ctrl day1 hes derived induced neurons (hes ) control day4 vs vpa day21 hes derived induced neurons (hes ) valproic acid day28 |
| GSE101239_5_v_0_valproic acid_mouse | control p5 neural stem/progenitor cells strain c57bl/6 hippocampal dentate gyrus age postnatal day5 nestin egfp vs vpa e15 neural stem/progenitor cells strain c57bl/6 forebrain age embryonic day15 nestin egfp |
| GSE129241_3_v_2_valproic acid_human | ctrl day50 56 hes derived induced neurons (hes ) control vs vpa day50 56 hes derived induced neurons (hes ) valproic acid |
| GSE129241_1_v_2_valproic acid_human | ctrl day21 hes derived induced neurons (hes ) control day28 vs vpa day50 56 hes derived induced neurons (hes ) valproic acid |
| GSE109140_0_v_1_valproic acid_human | high glucose replicate cell line hepg2 cells medium 20 mm control vs high glucose vpa replicate 1 cell line hepg2 cells medium 20 mm |
| GSE187006_0_v_1_valproic acid_human | u2f forebrain organoids derived ips cell line control organoid vs u1m forebrain organoids derived ips cell line vpa organoid |
| GSE129241_4_v_2_valproic acid_human | ctrl day1 hes derived induced neurons (hes ) control day4 vs vpa day50 56 hes derived induced neurons (hes ) valproic acid |
| GSE187006_0_v_2_valproic acid_human | u2f forebrain organoids derived ips cell line control organoid vs u2f forebrain organoids derived ips cell line vpa organoid |
| GSE109140_2_v_3_valproic acid_human | low glucose replicate cell line hepg2 cells medium 5.5 mm control vs low glucose vpa replicate 1 cell line hepg2 cells medium 5.5 mm |
| GSE99875_2_v_0_everolimus_human | krishnan 786 0 control cell line renal carcinoma cellline vs krishnan 786 0 everolimus 4hr cell line renal carcinoma cellline |
| GSE213650_0_v_2_everolimus_human | control 60h 0 ng epioral 3d conc everolimus (ng/ml) hours 60 vs treated 60h ng epioral 3d conc everolimus (ng/ml) hours 60 |
| GSE213650_0_v_1_everolimus_human | control 60h 0 ng epioral 3d conc everolimus (ng/ml) hours 60 vs treated 40h 64 ng epioral 3d conc everolimus (ng/ml) hours 40 |
| GSE213650_3_v_1_everolimus_human | control 40h 0 ng epioral 3d conc everolimus (ng/ml) hours 40 vs treated 40h 64 ng epioral 3d conc everolimus (ng/ml) hours 40 |
| GSE213650_3_v_2_everolimus_human | control 40h 0 ng epioral 3d conc everolimus (ng/ml) hours 40 vs treated 60h ng epioral 3d conc everolimus (ng/ml) hours 60 |
| GSE166315_5_v_0_docetaxel_mouse | human integrin î²3 rescued kockout pymt bo1 cells treated dmso rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 24hr vs human integrin î²3 rescued kockout pymt bo1 cells treated dtx rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 10nm docetaxel 24hr |
| GSE217452_2_v_0_docetaxel_human | pc3 cell line prostate cancer control vs pc3 cell line prostate cancer docetaxel resistance |
| GSE233647_2_v_0_docetaxel_human | du145dr cell line du 145dr pca central nervous system metastasis dmso lines vs du145dr ru486 cell line du 145dr pca central nervous system metastasis doc lines |
| GSE217452_3_v_0_docetaxel_human | du145 cell line prostate cancer control vs pc3 cell line prostate cancer docetaxel resistance |
| GSE166536_3_v_2_docetaxel_mouse | ko strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 knockout dmso 24hr cells vs ko strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 knockout 10nm docetaxel 24hr cells |
| GSE217452_2_v_1_docetaxel_human | pc3 cell line prostate cancer control vs du145 cell line prostate cancer docetaxel resistance |
| GSE166536_1_v_2_docetaxel_mouse | wt strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 wild type dmso 24hr cells vs ko strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 knockout 10nm docetaxel 24hr cells |
| GSE233647_4_v_0_docetaxel_human | pc3dr cell line pc3 dr pca bone metastasis dmso lines vs du145dr ru486 cell line du 145dr pca central nervous system metastasis doc lines |
| GSE166315_2_v_0_docetaxel_mouse | signaling mutant rescued integrin î²3 kockout pymt bo1 cells treated dmso rep [b3ko db3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue deficient construct (îx94î²3) 24hr vs human integrin î²3 rescued kockout pymt bo1 cells treated dtx rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 10nm docetaxel 24hr |
| GSE166315_1_v_0_docetaxel_mouse | empty vector rescued integrin î²3 kockout pymt bo1 cells treated dmso rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 24hr vs human integrin î²3 rescued kockout pymt bo1 cells treated dtx rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 10nm docetaxel 24hr |
| GSE233647_4_v_5_docetaxel_human | pc3dr cell line pc3 dr pca bone metastasis dmso lines vs du145dr cell line du 145dr pca central nervous system metastasis doc lines |
| GSE166315_1_v_4_docetaxel_mouse | empty vector rescued integrin î²3 kockout pymt bo1 cells treated dmso rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 24hr vs empty vector rescued integrin î²3 kockout pymt bo1 cells treated dtx rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 10nm docetaxel 24hr |
| GSE233647_4_v_6_docetaxel_human | pc3dr cell line pc3 dr pca bone metastasis dmso lines vs du145dr cell line du 145dr pca central nervous system metastasis ru486 lines |
| GSE233647_4_v_3_docetaxel_human | pc3dr cell line pc3 dr pca bone metastasis dmso lines vs pc3dr cell line pc3 dr pca bone metastasis ru486 lines |
| GSE166536_0_v_2_docetaxel_mouse | wt strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 wild type 10nm docetaxel 24hr cells vs ko strain balb/c 4t1 murine breast cancer (triple negative) integrin beta 3 knockout 10nm docetaxel 24hr cells |
| GSE166315_5_v_3_docetaxel_mouse | human integrin î²3 rescued kockout pymt bo1 cells treated dmso rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 24hr vs signaling mutant rescued integrin î²3 kockout pymt bo1 cells treated dtx rep [b3ko db3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue deficient construct (îx94î²3) 10nm docetaxel 24hr |
| GSE166315_1_v_3_docetaxel_mouse | empty vector rescued integrin î²3 kockout pymt bo1 cells treated dmso rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 24hr vs signaling mutant rescued integrin î²3 kockout pymt bo1 cells treated dtx rep [b3ko db3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue deficient construct (îx94î²3) 10nm docetaxel 24hr |
| GSE233647_2_v_3_docetaxel_human | du145dr cell line du 145dr pca central nervous system metastasis dmso lines vs pc3dr cell line pc3 dr pca bone metastasis ru486 lines |
| GSE166315_5_v_4_docetaxel_mouse | human integrin î²3 rescued kockout pymt bo1 cells treated dmso rep [b3ko hb3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue functional (hî²3) 24hr vs empty vector rescued integrin î²3 kockout pymt bo1 cells treated dtx rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 10nm docetaxel 24hr |
| GSE217452_3_v_1_docetaxel_human | du145 cell line prostate cancer control vs du145 cell line prostate cancer docetaxel resistance |
| GSE166315_2_v_4_docetaxel_mouse | signaling mutant rescued integrin î²3 kockout pymt bo1 cells treated dmso rep [b3ko db3 strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue deficient construct (îx94î²3) 24hr vs empty vector rescued integrin î²3 kockout pymt bo1 cells treated dtx rep [b3ko strain background c57bl/6 murine breast cancer (luminal b like) {beta}3 knockout retroviral rescue (pmx) 10nm docetaxel 24hr |
| GSE66014_0_v_1_perhexiline_human | control sample cell line cutll1 leukemia vs treated sample cell line cutll1 leukemia perhexiline |
| GSE196780_1_v_0_puerarin_mouse | dbmdmso strain c57bl/6j mice dbm dmso control kidney glomerular vs dbdbpue strain c57bl/6j mice dbdb puerarin kidney glomerular |
| GSE217622_0_v_2_ketamine_mouse | sham/saline mouse model sham (control) prelimbic cortex saline brain vs sni/saline mouse model spared nerve injury (sni) prelimbic cortex saline brain |
| GSE193177_1_v_2_st266_mouse | breast fed control strain c57bl/6 age p11 name ileum vs nec + st266 ip strain c57bl/6 age p11 name ileum |
| GSE193177_1_v_3_st266_mouse | breast fed control strain c57bl/6 age p11 name ileum vs nec + st266 oral strain c57bl/6 age p11 name ileum |
| GSE193177_1_v_0_st266_mouse | breast fed control strain c57bl/6 age p11 name ileum vs nec strain c57bl/6 age p11 name ileum |
| GSE182181_1_v_0_ricolinostat_human | rna seq control cd34+cd41+ cells sorted flow cytometry day 7 cord blood vs rna seq ricolinostat cd34+cd41+ cells sorted flow cytometry day 7 cord blood |
| GSE199660_1_v_3_secretin_mouse | sample wt limb muscle fibroadipogenic progenitor (fap) cells etoh culture media mouse originated wild type mose vs sample smn1oe k186r limb muscle fibroadipogenic progenitor (fap) cells 4 oht smnk186r overexpression vector transfected culture media mouse originated neuromuscular defects overexpressed prrx1cre bap1f/f (hereafter cko) mice |
| GSE161771_2_v_1_secretin_mouse | veh strain c57bl/6 kp1.9 lung adenocarcinoma tumor cells gender f vehicle control solution purification rbc depletion cd45+ vs csf1ri strain c57bl/6 kp1.9 lung adenocarcinoma tumor cells gender f blz945 purification rbc depletion cd45+ |
| GSE161771_0_v_1_secretin_mouse | healthy 2 strain c57bl/6 gender untreated purification rbc depletion cd45+ cells lung vs csf1ri strain c57bl/6 kp1.9 lung adenocarcinoma tumor cells gender f blz945 purification rbc depletion cd45+ |
| GSE199660_1_v_0_secretin_mouse | sample wt limb muscle fibroadipogenic progenitor (fap) cells etoh culture media mouse originated wild type mose vs sample smn1oe limb muscle fibroadipogenic progenitor (fap) cells 4 oht smn overexpression vector transfected culture media mouse originated neuromuscular defects overexpressed prrx1cre bap1f/f (hereafter cko) mice |
| GSE264621_1_v_3_secretin_human | normal pituitary cell disease healthy gland vs sparsely granulated somatotroph adenoma pituitary cell disease gland |
| GSE199660_1_v_2_secretin_mouse | sample wt limb muscle fibroadipogenic progenitor (fap) cells etoh culture media mouse originated wild type mose vs sample bap1ko limb muscle fibroadipogenic progenitor (fap) cells 4 oht culture media mouse originated neuromuscular defects prrx1cre bap1f/f (hereafter cko) mice |
| GSE182180_1_v_2_secretin_human | rna seq normalâ pituitaryâ tissuesâ vs rna seq pituitaryâ tumors |
| GSE264621_1_v_6_secretin_human | normal pituitary cell disease healthy gland vs densely granulated somatotroph adenoma pituitary cell disease gland |
| GSE157904_0_v_1_doxorubicin_mouse | untreated wt replicate input rna mass 200ng heart vehicle (saline) fvb (fvb/ntac) inbred strain (8 week) vs treated ko replicate input rna mass 200ng heart doxorubicin ( saline) oct3 (slc22a3) null mice fvb inbred strain (8 week) |
| GSE181517_0_v_1_doxorubicin_human | og 0um rarg wt/s427l vehicle (dmso) ipsc line case 003 hipsc derived cardiomyocytes vs 1um rarg doxorubicin ipsc line case 003 hipsc derived cardiomyocytes |
| GSE133683_3_v_0_doxorubicin_mouse | p21null untreated mammary tumor strain mmtv wnt1 p21 null vs p21null doxo mammary tumor strain mmtv wnt1 p21 null doxorubicin |
| GSE147834_1_v_0_doxorubicin_mouse | wt strain c57bl/6 heart age post natal week 8 duration drug wild type vs ko strain c57bl/6 heart age post natal week 8 duration drug sr a1 / |
| GSE157282_0_v_3_doxorubicin_human | control replicate cardiac muscle human ips derived cardiomyocytes vs doxorubicin replicate cardiac muscle human ips derived cardiomyocytes |
| GSE219274,GSE219276_2_v_1_doxorubicin_human | hs578t 17pko dmso 48h breast cancer cell line eukaryotic cells one copy chrom 17p knockout untreated vs hs578t 17pko dox 48h breast cancer cell line eukaryotic cells one copy chrom 17p knockout doxorubicin treated |
| GSE205550,GSE205552_2_v_1_doxorubicin_mouse | 4t1 thy1.1 control culturing condition dmem/f12+fbs cell line murine breast cancer cells transgene expression vs 4t1 thy1.1 dox culturing condition dmem/f12+fbs+doxorubicin cell line murine breast cancer cells transgene expression |
| GSE135842_0_v_3_doxorubicin_human | sgrb1+sgp130 sictl human foreskin fibroblasts (hff) crispr cas9 target sirna sicontrol doxorubicin nm biological replicate bio repeat vs sgrb1+sgp130 sip107 human foreskin fibroblasts (hff) crispr cas9 target sirna doxorubicin nm biological replicate bio repeat |
| GSE226115,GSE226116_2_v_0_doxorubicin_human | control sirna dox human cardiac microvascular endothelial cells nc doxorubicin vs sting sirna dox human cardiac microvascular endothelial cells knockdown doxorubicin |
| GSE226115,GSE226116_1_v_0_doxorubicin_human | control sirna saline human cardiac microvascular endothelial cells nc vs sting sirna dox human cardiac microvascular endothelial cells knockdown doxorubicin |
| GSE133683_3_v_5_doxorubicin_mouse | p21null untreated mammary tumor strain mmtv wnt1 p21 null vs p53null doxo mammary tumor strain mmtv wnt1 p53 null doxorubicin |
| GSE185139_1_v_2_doxorubicin_human | rna seq huh7 cells control non treated [p19760 cell line hepatocarcinoma none tretaed vs rna seq huh7 cells treated 400ug/ml go [p19760 cell line hepatocarcinoma 400 ug/ml tretaed |
| GSE157904_2_v_1_doxorubicin_mouse | untreated ko replicate input rna mass 200ng heart vehicle (saline) oct3 (slc22a3) null mice fvb inbred strain (8 week) vs treated ko replicate input rna mass 200ng heart doxorubicin ( saline) oct3 (slc22a3) null mice fvb inbred strain (8 week) |
| GSE224157_2_v_1_doxorubicin_mouse | wt dox strain c57bl/6j heart pde10a doxorubicin vs ko veh strain c57bl/6j heart pde10a knockout vehicle |
| GSE135842_2_v_3_doxorubicin_human | sgp130 sictl human foreskin fibroblasts (hff) crispr cas9 target sirna sicontrol doxorubicin nm biological replicate bio repeat vs sgrb1+sgp130 sip107 human foreskin fibroblasts (hff) crispr cas9 target sirna doxorubicin nm biological replicate bio repeat |
| GSE233112_2_v_3_doxorubicin_human | sk ov 3 cells dmso 24 hours ovarian cell line cancer diploid vs sk ov 3 cells doxorubicin 300 nm + in10018 î¼m 24 hours ovarian cell line cancer diploid |
| GSE205550,GSE205552_2_v_3_doxorubicin_mouse | 4t1 thy1.1 control culturing condition dmem/f12+fbs cell line murine breast cancer cells transgene expression vs 4t1 thy1.1 dox il17a culturing condition dmem/f12+fbs+doxorubicin+il17a cell line murine breast cancer cells transgene expression |
| GSE157282_0_v_1_doxorubicin_human | control replicate cardiac muscle human ips derived cardiomyocytes vs r 2hg exposure doxorubicin replicate cardiac muscle human ips derived cardiomyocytes |
| GSE173840_1_v_0_doxorubicin_mouse | (wild type) neutrophils strain c57bl/6j wt peripheral blood vs (knock ) neutrophils strain c57bl/6j trp53 heterozygous peripheral blood |
| GSE133683_1_v_0_doxorubicin_mouse | p53wt doxo mammary tumor strain mmtv wnt1 wild type doxorubicin vs p21null doxo mammary tumor strain mmtv wnt1 p21 null doxorubicin |
| GSE219274,GSE219276_0_v_1_doxorubicin_human | hs578t cas9 dmso 48h breast cancer cell line eukaryotic cells wt untreated vs hs578t 17pko dox 48h breast cancer cell line eukaryotic cells one copy chrom 17p knockout doxorubicin treated |
| GSE133683_1_v_5_doxorubicin_mouse | p53wt doxo mammary tumor strain mmtv wnt1 wild type doxorubicin vs p53null doxo mammary tumor strain mmtv wnt1 p53 null doxorubicin |
| GSE157904_3_v_1_doxorubicin_mouse | treated wt replicate input rna mass 200ng heart doxorubicin ( saline) fvb (fvb/ntac) inbred strain (8 week) vs treated ko replicate input rna mass 200ng heart doxorubicin ( saline) oct3 (slc22a3) null mice fvb inbred strain (8 week) |
| GSE181517_2_v_1_doxorubicin_human | rp 0um rarg wt/wt vehicle (dmso) ipsc line case 003 hipsc derived cardiomyocytes vs 1um rarg doxorubicin ipsc line case 003 hipsc derived cardiomyocytes |
| GSE210377_0_v_1_doxorubicin_mouse | b16 sgctrl dox biorep cell line b16.f10 melanoma wt .5 î¼m doxorubicin 48hrs vs b16 sgcasp3/7 dox biorep cell line b16.f10 melanoma casp3/7 knockout .5 î¼m doxorubicin 48hrs |
| GSE224157_3_v_0_doxorubicin_mouse | wt veh strain c57bl/6j heart pde10a vehicle vs 1 ko dox strain c57bl/6j heart pde10a knockout doxorubicin |
| GSE224157_3_v_1_doxorubicin_mouse | wt veh strain c57bl/6j heart pde10a vehicle vs ko veh strain c57bl/6j heart pde10a knockout vehicle |
| GSE163297_0_v_2_doxorubicin_human | sictrl [mda mda mb 231 sirna breast cancer cells vs sibckdk#1 [mda mda mb 231 sirna breast cancer cells |
| GSE71529,GSE71558_1_v_0_doxorubicin_mouse | wt mef dox background strain 129sv c57bl/6 mixed age day 13.5 passage three wildtype mouse embryo fibroblasts vs patz1 / mef dox background strain 129sv c57bl/6 mixed age day 13.5 passage three mouse embryo fibroblasts |
| GSE219274,GSE219276_3_v_1_doxorubicin_human | hs578t cas9 dox 48h breast cancer cell line eukaryotic cells wt doxorubicin treated vs hs578t 17pko dox 48h breast cancer cell line eukaryotic cells one copy chrom 17p knockout doxorubicin treated |
| GSE226114,GSE226116_2_v_0_doxorubicin_mouse | wt dox heart doxorubicin vs sting / dox heart doxorubicin |
| GSE233112_2_v_0_doxorubicin_human | sk ov 3 cells dmso 24 hours ovarian cell line cancer diploid vs sk ov 3 cells doxorubicin 300 nm 24 hours ovarian cell line cancer diploid |
| GSE163297_0_v_1_doxorubicin_human | sictrl [mda mda mb 231 sirna breast cancer cells vs sibckdk#2 [mda mda mb 231 sirna breast cancer cells |
| GSE226114,GSE226116_1_v_0_doxorubicin_mouse | wt saline heart vs sting / dox heart doxorubicin |
| GSE201409_1_v_6_coumarin_human | hepg2 coumarin 0 î¼m cell line untreated vs hepg2 coumarin î¼m rep3 cell line 24 h |
| GSE201251_2_v_5_coumarin_human | hepg2 coumarin 0 î¼m cell line cells untreated vs hepg2 coumarin î¼m cell line cells treated um 6 h |
| GSE201409_1_v_4_coumarin_human | hepg2 coumarin 0 î¼m cell line untreated vs hepg2 coumarin î¼m rep2 cell line 24 h |
| GSE201251_2_v_3_coumarin_human | hepg2 coumarin 0 î¼m cell line cells untreated vs hepg2 coumarin 100 î¼m cell line cells treated um 6 h |
| GSE201409_1_v_0_coumarin_human | hepg2 coumarin 0 î¼m cell line untreated vs hepg2 coumarin î¼m rep1 cell line 24 h |
| GSE201409_1_v_5_coumarin_human | hepg2 coumarin 0 î¼m cell line untreated vs hepg2 coumarin î¼m cell line 24 h |
| GSE117045_1_v_2_amphetamine_mouse | sc line collaborative cross gender male phenotype control saline striatum age ~6 months vs line collaborative cross gender male phenotype overactive saline striatum age ~6 months |
| GSE117045_1_v_0_amphetamine_mouse | sc line collaborative cross gender male phenotype control saline striatum age ~6 months vs ao line collaborative cross gender male phenotype overactive amphetamine striatum age ~6 months |
| GSE117045_3_v_0_amphetamine_mouse | ac line collaborative cross gender male phenotype control amphetamine striatum age ~6 months vs ao line collaborative cross gender male phenotype overactive amphetamine striatum age ~6 months |
| GSE117045_3_v_2_amphetamine_mouse | ac line collaborative cross gender male phenotype control amphetamine striatum age ~6 months vs line collaborative cross gender male phenotype overactive saline striatum age ~6 months |
| GSE161959_1_v_0_atovaquone_human | reh cells c cell line tumor b origin peripheral blood first relapse control childhood vs reh cells ato cell line tumor b origin peripheral blood first relapse atovaquone childhood |
| GSE230174_0_v_1_glycerol_human | hep3b cells shcontrol cell line human hepatocellular carcinoma (hcc) control vs hep3b cells shdagla cell line human hepatocellular carcinoma (hcc) dagla knockdown |
| GSE246660_1_v_0_glycerol_human | yuuki condition panc 10.05 ctrl cell line control pancreatic cancer vs yuuki condition panc 10.05 lmo3 overexpression cell line plmo3 transgene pancreatic cancer |
| GSE216326_2_v_1_sulodexide_mouse | liver cell line c57bl/6 control vs liver cell line c57bl/6 sulodexide treated taa |
| GSE216326_2_v_0_sulodexide_mouse | liver cell line c57bl/6 control vs liver cell line c57bl/6 vehicle treated taa |
| GSE146687_2_v_4_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 24h 1 ewing sarcoma tumor es4 xenograft eribulin mg/kg harvest time 24 hour |
| GSE146687_2_v_5_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 irn 144h ewing sarcoma tumor es4 xenograft irinotecan 2.5mg/kg harvest time 144 hour |
| GSE146687_2_v_0_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 1502irn 24h ewing sarcoma tumor es4 xenograft eribulin (1mg/kg) + irinotecan (2.5 mg/kg) harvest time 24 hour |
| GSE146687_2_v_6_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 1502irn 144h ewing sarcoma tumor es4 xenograft eribulin (1mg/kg) + irinotecan (2.5 mg/kg) harvest time 144 hour |
| GSE146687_2_v_3_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 144h 1 ewing sarcoma tumor es4 xenograft eribulin mg/kg harvest time 144 hour |
| GSE146687_2_v_1_eribulin_human | 1502 control ewing sarcoma tumor es4 xenograft harvest time 24 hour vs 1502 irn 24h ewing sarcoma tumor es4 xenograft irinotecan 2.5mg/kg harvest time 24 hour |
| GSE169155_3_v_2_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE169155_3_v_7_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE169155_1_v_2_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE169155_5_v_2_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE155695,GSE155696_1_v_0_acetaminophen_mouse | wildtype npc scrna seq strain c57bl/6 neural progenitor cells (10x genomics) acetaminophen liver vs mdmxc462a npc scrna seq strain c57bl/6 cre(+) mdmx c642a(+/ ) neural progenitor cells (10x genomics) acetaminophen liver |
| GSE218879_1_v_0_acetaminophen_mouse | nc liver strain c57bl/6 control vs 2022.4.7 amsc 6h liver strain c57bl/6 500mg/kg apap treated |
| GSE95182_0_v_1_acetaminophen_mouse | neutrophils pbs livers strain c57bl/6 liver condition normal acetaminophen induced injury (aili) time 24 h following aili neutrophil selection marker cd11b+ly6clocx3cr1 gfp ly6g+ freshly isolated vs neutrophils mc 21 livers strain c57bl/6 liver condition deficient ly6chi infiltrating monocytes acetaminophen induced injury (aili) time 24 h following aili neutrophil selection marker cd11b+ly6clocx3cr1 gfp ly6g+ freshly isolated |
| GSE169155_1_v_7_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE169155_6_v_4_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id apap strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE169155_1_v_0_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id apap strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE218879_1_v_2_acetaminophen_mouse | nc liver strain c57bl/6 control vs 2022.4.7 apap 6h liver strain c57bl/6 500mg/kg treated |
| GSE169155_5_v_7_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE169155_5_v_4_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id apap strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE169155_6_v_2_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group chronic |
| GSE203131_0_v_1_acetaminophen_mouse | liver ten days tamoxifen injection wt vs liver iko ten days tamoxifen injection nek7 whole body knockout |
| GSE169155_6_v_0_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id apap strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE169155_6_v_7_acetaminophen_mouse | wildtype id saline strain c57bl/6 sex male intraperitoneal injection liver group acute vs alkbh8def id saline strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE221747_0_v_1_acetaminophen_mouse | wild type bio liver primary non parenchymal cells sex male acetaminophen (400 mg/kg .p.) vs sra / bio liver primary non parenchymal cells sex male acetaminophen (400 mg/kg .p.) |
| GSE169155_3_v_0_acetaminophen_mouse | wildtype id apap strain c57bl/6 sex male intraperitoneal injection liver group chronic vs alkbh8def id apap strain c57bl/6 sex male intraperitoneal injection liver group acute |
| GSE129153_0_v_1_forskolin_human | control vendor promocell differentiated stromal vascular fraction preadipocytes passage passages 3 5 agent untreated human primary adipocytes vs forskolin vendor promocell differentiated stromal vascular fraction preadipocytes passage passages 3 5 agent human primary adipocytes |
| GSE110178_2_v_6_tranylcypromine_mouse | h9m ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated âµm vs h9m ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_2_v_7_tranylcypromine_mouse | h9m ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated âµm vs mn1 ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_4_v_0_tranylcypromine_mouse | h9m ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells vs h9m ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_1_v_0_tranylcypromine_mouse | mn1 ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated âµm vs h9m ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_5_v_0_tranylcypromine_mouse | mn1 ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells vs h9m ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_2_v_0_tranylcypromine_mouse | h9m ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated âµm vs h9m ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_1_v_6_tranylcypromine_mouse | mn1 ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated âµm vs h9m ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_1_v_7_tranylcypromine_mouse | mn1 ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated âµm vs mn1 ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_2_v_3_tranylcypromine_mouse | h9m ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated âµm vs mn1 ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_4_v_6_tranylcypromine_mouse | h9m ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells vs h9m ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_5_v_7_tranylcypromine_mouse | mn1 ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells vs mn1 ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_5_v_3_tranylcypromine_mouse | mn1 ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells vs mn1 ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_1_v_3_tranylcypromine_mouse | mn1 ctl + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated âµm vs mn1 ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_4_v_7_tranylcypromine_mouse | h9m ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells vs mn1 ko w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) |
| GSE110178_5_v_6_tranylcypromine_mouse | mn1 ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells vs h9m ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE110178_4_v_3_tranylcypromine_mouse | h9m ctl w/ atra strain background c57bl/6 creert2 lsd1tm1schuele hoxa9/meis1 transformed myeloid progenitor cells vs mn1 ko + atra 1 strain background c57bl/6 creert2 lsd1tm1schuele transformed myeloid progenitor cells treated 4 hydroxy tamoxifen (0.1âµm) 72 hrs ( induce lsd1 ko) âµm |
| GSE239651_1_v_5_ispinesib_human | celltag1 dmso celltag cell line ts543 vs celltag1 ispinesib celltag cell line ts543 |
| GSE239651_1_v_0_ispinesib_human | celltag1 dmso celltag cell line ts543 vs celltag2 ispinesib celltag cell line ts543 |
| GSE71491_0_v_1_cyclophosphamide_mouse | gl261 tumors mice untreated pool strain (taconic) sex male age 12 weeks old tumor cell line implanted mouse rna extracted individual vs gl261 tumors mice cyclophosphamide treated (6 days 2nd cpa .p.) pool strain (taconic) sex male age 12 weeks old tumor cell line implanted mouse rna extracted individual |
| GSE190534,GSE190536_0_v_2_cyclophosphamide_mouse | e0771 cells control replicate vehicle collect 72 h cultured total rna fraction vs e0771 cells interferon beta replicate (27.8 u/ml) 4 h collect 2 later synchronized 72 controls cultured total rna fraction |
| GSE190534,GSE190536_0_v_1_cyclophosphamide_mouse | e0771 cells control replicate vehicle collect 72 h cultured total rna fraction vs e0771 cells 4hc+ifnar 1 ab replicate 4.2 um 4 hc + ifnar1 antibody h collect 68 later 72 cultured total rna fraction |
| GSE243720_1_v_0_cyclophosphamide_human | cell line cov434 granulosa cells wt vs cell line cov434 granulosa cells ctx induced |
| GSE190534,GSE190536_0_v_3_cyclophosphamide_mouse | e0771 cells control replicate vehicle collect 72 h cultured total rna fraction vs e0771 cells 4hc (4 ooh cyclophosphamide) replicate 4.2 um 4 hc h collect 68 later 72 cultured total rna fraction |
| GSE128240_0_v_1_cyclophosphamide_mouse | control strain c57bl/6 ovary age 8 9 weeks old vs ctx strain c57bl/6 ovary cyclophosphamide age 8 9 weeks old |
| GSE224311_3_v_2_chaetocin_human | bj cells ctl cell line primary fibroblasts control vs bj cells chae cell line primary fibroblasts 50 nm chaetocin 24 hours |
| GSE224311_3_v_1_chaetocin_human | bj cells ctl cell line primary fibroblasts control vs bj cells sivdr cell line primary fibroblasts vdr knockdown sirna 24 hours |
| GSE224311_3_v_0_chaetocin_human | bj cells ctl cell line primary fibroblasts control vs bj cells cal4h cell line primary fibroblasts 100 nm calcipotriol 4 hours |
| GSE224311_3_v_4_chaetocin_human | bj cells ctl cell line primary fibroblasts control vs bj cells cal24h cell line primary fibroblasts 100 nm calcipotriol 24 hours |
| GSE148200_4_v_5_gemcitabine_human | mia paca2 cell line control 24h source atcc time untreated/control 24 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 24h source derived atcc cell line time 400nm 24 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE148200_4_v_2_gemcitabine_human | mia paca2 cell line control 24h source atcc time untreated/control 24 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 6h source derived atcc cell line time 400nm 6 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE197532,GSE197533_0_v_1_gemcitabine_human | panc1gr cell line panc 1 phenotype gemcitabine resistance ctrl pancreatic cancer vs panc1gr cell line panc 1 phenotype gemcitabine resistance shsrsf3 pancreatic cancer |
| GSE165548_2_v_8_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 rtog radiotherapy + olaparib gemcitabine |
| GSE110580_1_v_0_gemcitabine_human | control panc 1 cell line pancreatic cancer phenotype vs gemcitabine resistant panc 1 gr cell line pancreatic cancer phenotype |
| GSE217105_0_v_1_gemcitabine_mouse | jy pbs tf lung interstitial macrophage im control replicate vs jy gem tf lung interstitial macrophage gemcitabine (gem) im tx replicate |
| GSE165548_2_v_13_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 proton therapy + gemcitabine |
| GSE148200_0_v_5_gemcitabine_human | gem resistant mia paca2 control 24h source derived atcc cell line time untreated/control 24 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 24h source derived atcc cell line time 400nm 24 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE148200_1_v_5_gemcitabine_human | mia paca2 cell line control 6h source atcc time untreated/control 6 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 24h source derived atcc cell line time 400nm 24 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE165548_2_v_9_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 pt proton therapy |
| GSE128099,GSE128159_1_v_2_gemcitabine_human | sum159 shctrl gem â mammary gland breast subtype triple negative cancer tumor source primary cell line transfection gemcitabine treated cells vs sum159 she4f1 gem â mammary gland breast subtype triple negative cancer tumor source primary cell line transfection /variation regulation e4f1 gemcitabine treated cells |
| GSE148200_1_v_2_gemcitabine_human | mia paca2 cell line control 6h source atcc time untreated/control 6 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 6h source derived atcc cell line time 400nm 6 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE165548_2_v_7_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 proton therapy |
| GSE128099,GSE128159_3_v_2_gemcitabine_human | sum159 shctrl nt â mammary gland breast subtype triple negative cancer tumor source primary cell line transfection untreated cells vs sum159 she4f1 gem â mammary gland breast subtype triple negative cancer tumor source primary cell line transfection /variation regulation e4f1 gemcitabine treated cells |
| GSE148200_3_v_2_gemcitabine_human | gem resistant mia paca2 control 6h source derived atcc cell line time untreated/control 6 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 6h source derived atcc cell line time 400nm 6 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE148200_0_v_2_gemcitabine_human | gem resistant mia paca2 control 24h source derived atcc cell line time untreated/control 24 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 6h source derived atcc cell line time 400nm 6 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE99187_1_v_0_gemcitabine_mouse | kpcl pcc g strain fvb/nj pancreas age around 48 days kraslsl g12d tp53f/f rosa26lsl luc pdx1 cre pancreatic tumor developed mice treated gemcitabine control igg vs kpcl pcc ga strain fvb/nj pancreas age around 48 days kraslsl g12d tp53f/f rosa26lsl luc pdx1 cre pancreatic tumor developed mice treated gemcitabine anti lif antibody |
| GSE165548_2_v_4_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 rtg radiotherapy + gemcitabine |
| GSE165548_2_v_0_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 rto radiotherapy + olaparib |
| GSE165548_2_v_1_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 pto proton therapy + olaparib |
| GSE148200_3_v_5_gemcitabine_human | gem resistant mia paca2 control 6h source derived atcc cell line time untreated/control 6 h pancreas ductal adenocarcinoma pancreatic cancer vs gem resistant mia paca2 cm03 24h source derived atcc cell line time 400nm 24 h pancreas ductal adenocarcinoma pancreatic cancer |
| GSE165548_2_v_5_gemcitabine_human | subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 ctl control irradiation vs subcutaneous human pancreatic tumour resected mice flank cell line mia paca2 rt radiotherapy |
| GSE253113_1_v_0_amiodarone_human | 1 cell line hl 60 promyelocyte control vs t0 1 cell line hl 60 promyelocyte 10um amiodarone 24h |
| GSE146612_1_v_0_amiodarone_human | a549 cell line cells dmso vs lb amd hpbcd cell line cells amiodarone+hpbcd a549 |
| GSE146612_2_v_0_amiodarone_human | lb dmso cell line cells a549 vs lb amd hpbcd cell line cells amiodarone+hpbcd a549 |
| GSE146612_1_v_3_amiodarone_human | a549 cell line cells dmso vs lb amd cell line cells amiodarone a549 |
| GSE146612_2_v_3_amiodarone_human | lb dmso cell line cells a549 vs lb amd cell line cells amiodarone a549 |
| GSE217526_0_v_1_parthenolide_human | control cell line mgc 803 human gastric cancer dmso vs parthenolide cell line mgc 803 human gastric cancer |
| GSE228017_0_v_1_parthenolide_human | mcf7 cells biological cell line breast cancer epithelial dmso vs mcf7 cells ptn biological cell line breast cancer epithelial parthenolide |
| GSE114883_1_v_4_romidepsin_human | uninf dmso individual donor cd4+ cell infection status mock infected rna extract vs inf saha individual donor cd4+ cell infection status model hiv latency rna extract |
| GSE114883_1_v_2_romidepsin_human | uninf dmso individual donor cd4+ cell infection status mock infected rna extract vs uninf saha individual donor cd4+ cell infection status mock infected rna extract |
| GSE110248_1_v_3_romidepsin_human | dmso cd4+ cells agent primary sample vs romidepsin cd4+ cells agent primary sample |
| GSE199921_1_v_0_romidepsin_mouse | mdsc sene bm derived mdscs strain â c57bl/6 untreated vs mdsc sene romi bm derived mdscs strain â c57bl/6 treated romidepsin |
| GSE114883_0_v_4_romidepsin_human | inf dmso individual donor cd4+ cell infection status model hiv latency rna extract vs inf saha individual donor cd4+ cell infection status model hiv latency rna extract |
| GSE110248_1_v_5_romidepsin_human | dmso cd4+ cells agent primary sample vs combination cd4+ cells agent primary sample |
| GSE114883_1_v_5_romidepsin_human | uninf dmso individual donor cd4+ cell infection status mock infected rna extract vs inf rmd individual donor cd4+ cell infection status model hiv latency rna extract |
| GSE110248_1_v_6_romidepsin_human | dmso cd4+ cells agent primary sample vs hut78 cell line agent |
| GSE221386_2_v_0_romidepsin_human | melanoma cells untreated cutaneous metastasis cell line primary metastatic braf wt vs melanoma cells romidepsin inf (ri) cutaneous metastasis cell line primary metastatic braf ifn |
| GSE114883_0_v_5_romidepsin_human | inf dmso individual donor cd4+ cell infection status model hiv latency rna extract vs inf rmd individual donor cd4+ cell infection status model hiv latency rna extract |
| GSE221386_3_v_0_romidepsin_human | melanoma cells romidepsin inf (ri) cutaneous metastasis cell line primary metastatic braf wt ifn vs melanoma cells romidepsin inf (ri) cutaneous metastasis cell line primary metastatic braf ifn |
| GSE114883_0_v_2_romidepsin_human | inf dmso individual donor cd4+ cell infection status model hiv latency rna extract vs uninf saha individual donor cd4+ cell infection status mock infected rna extract |
| GSE102880_0_v_1_pilocarpine_human | panc1 cells untreated sample cell line pancreatic cancer treated none vs panc1 cells treated 1mm pilocarpine 72 hours sample cell line pancreatic cancer |
| GSE124177_1_v_0_gonadotropins_human | ctrl subject status natural cycle granulosa cells pre ovulatory follicle gonadotropins patients vs gns subject status stimulated granulosa cells pre ovulatory follicle gonadotropins yes patients |
| GSE135514_8_v_5_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs dasatinib treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 15 microm |
| GSE147240_0_v_7_dasatinib_human | rd dmso disease embryonal rhabdomyosarcoma cell line vs rh30 dasatinib disease alveolar rhabdomyosarcoma cell line |
| GSE135514_2_v_5_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs dasatinib treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 15 microm |
| GSE135514_8_v_0_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs salinomycin treated cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 0.5 microm |
| GSE135514_2_v_9_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs dasatinib treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 15 microm |
| GSE147240_3_v_7_dasatinib_human | rh30 dmso disease alveolar rhabdomyosarcoma cell line vs rh30 dasatinib disease alveolar rhabdomyosarcoma cell line |
| GSE147240_3_v_6_dasatinib_human | rh30 dmso disease alveolar rhabdomyosarcoma cell line vs rd dasatinib disease embryonal rhabdomyosarcoma cell line |
| GSE135514_2_v_0_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs salinomycin treated cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 0.5 microm |
| GSE147240_3_v_1_dasatinib_human | rh30 dmso disease alveolar rhabdomyosarcoma cell line vs rh30 combination disease alveolar rhabdomyosarcoma sgi 110 + dasatinib cell line |
| GSE147240_3_v_4_dasatinib_human | rh30 dmso disease alveolar rhabdomyosarcoma cell line vs rd sgi 110 disease embryonal rhabdomyosarcoma cell line |
| GSE135514_8_v_9_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs dasatinib treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 15 microm |
| GSE135514_8_v_6_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs sal + das treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 15.5 microm |
| GSE147240_0_v_2_dasatinib_human | rd dmso disease embryonal rhabdomyosarcoma cell line vs rd combination disease embryonal rhabdomyosarcoma sgi 110 + dasatinib cell line |
| GSE135514_2_v_6_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs sal + das treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 15.5 microm |
| GSE135514_8_v_3_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs sal + das treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 15.5 microm |
| GSE97352_3_v_2_dasatinib_human | rch acv dasatinib sensitive clone [scgpm 160503 c8f37 subline cell line replicate agent vehicle (0.1 % dmso) lines vs rch acv dasatinib resistant clone 1 [scgpm 160503 c8f37 subline cell line replicate agent increasing concentrations (maximal î¼m) lines |
| GSE135514_2_v_7_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs salinomycin treated cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 0.5 microm |
| GSE135514_8_v_7_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration vs salinomycin treated cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration 0.5 microm |
| GSE97352_1_v_2_dasatinib_human | rch acv dasatinib sensitive clone [scgpm 160503 c8f37 subline cell line replicate agent vehicle (0.1 % dmso) lines vs rch acv dasatinib resistant clone 1 [scgpm 160503 c8f37 subline cell line replicate agent increasing concentrations (maximal î¼m) lines |
| GSE135514_2_v_3_dasatinib_human | control cells cell line mda mb 468 triple negative breast tumor drug incubation time 24 h concentration vs sal + das treated cells replica cell line mda mb 468 triple negative breast tumor drug incubation time 72 h concentration 15.5 microm |
| GSE241862_0_v_3_cabozantinib_mouse | intratibial tumor treated empty vector pvp harvested day 14 [lcs9550 d14 porf0 cell line tc2ras prostate adenocarcinoma control vs intratibial tumor treated empty vector cabozantinib harvested day 14 [lcs9550 d14 porf0 cabo cell line tc2ras prostate adenocarcinoma |
| GSE241862_0_v_1_cabozantinib_mouse | intratibial tumor treated empty vector pvp harvested day 14 [lcs9550 d14 porf0 cell line tc2ras prostate adenocarcinoma control vs intratibial tumor treated il 27 vector cabozantinib harvested [lcs9550 pil27 cabo cell line tc2ras prostate adenocarcinoma 27+cabo |
| GSE60939_0_v_1_cabozantinib_human | control arm derived tumor xenograft host mouse model crc pdtx dervied vs cabozantinib treated arm derived tumor xenograft host mouse model crc pdtx dervied |
| GSE241862_0_v_2_cabozantinib_mouse | intratibial tumor treated empty vector pvp harvested day 14 [lcs9550 d14 porf0 cell line tc2ras prostate adenocarcinoma control vs intratibial tumor treated il 27 vector pvp harvested [lcs9550 pil27 cell line tc2ras prostate adenocarcinoma |
| GSE207728,GSE207808_2_v_1_c646_human | 408 0gy hati d7 gbm cells pre c646 untreated cell line hk408 vs 408 8gy gbm cells radiation single dose 8 gy cell line hk408 |
| GSE76425_0_v_12_lenalidomide_human | bmpc mm n/ normal plasma cells disease state bone marrow vs b mm lenalidomide multiple myeloma cells disease state patients bone marrow |
| GSE115328_6_v_0_lenalidomide_human | osucll dmso 0 5h rep timepoint (h) 5 dose (micromolar) osu cll cell line vs osucll cc122 1 24h rep timepoint (h) 24 dose (micromolar) osu cll cell line |
| GSE76425_1_v_7_lenalidomide_human | mm control multiple myeloma cells disease state patients bone marrow vs pdlen6 mm 11 multiple myeloma cells disease state patients bone marrow |
| GSE158438_2_v_12_lenalidomide_human | blood cells cd8pos pd 1neg day 0 cd3pos untreated subject vs blood cells cd4pos pd day 7 cd3pos one week lenalidomide subject |
| GSE76425_0_v_10_lenalidomide_human | bmpc mm n/ normal plasma cells disease state bone marrow vs pdlen7 mm 30 multiple myeloma cells disease state patients bone marrow |
| GSE76425_0_v_7_lenalidomide_human | bmpc mm n/ normal plasma cells disease state bone marrow vs pdlen6 mm 11 multiple myeloma cells disease state patients bone marrow |
| GSE158438_4_v_12_lenalidomide_human | blood cells cd8pos pd 1pos day 0 cd3pos untreated subject vs blood cells cd4pos pd day 7 cd3pos one week lenalidomide subject |
| GSE158438_1_v_9_lenalidomide_human | blood cells cd4pos pd 1pos day 0 cd3pos untreated subject vs blood cells cd8pos pd day 7 cd3pos one week lenalidomide subject |
| GSE115328_6_v_2_lenalidomide_human | osucll dmso 0 5h rep timepoint (h) 5 dose (micromolar) osu cll cell line vs osucll len 1 24h rep timepoint (h) 24 dose (micromolar) osu cll cell line |
| GSE158438_5_v_9_lenalidomide_human | blood cells cd4pos pd 1neg day 0 cd3pos untreated subject vs blood cells cd8pos pd day 7 cd3pos one week lenalidomide subject |
| GSE76425_0_v_3_lenalidomide_human | bmpc mm n/ normal plasma cells disease state bone marrow vs mm multiple myeloma cells disease state patients bone marrow |
| GSE76425_0_v_5_lenalidomide_human | bmpc mm n/ normal plasma cells disease state bone marrow vs mm pd 0332991 + lenalidomide multiple myeloma cells disease state patients bone marrow |
| GSE76425_1_v_10_lenalidomide_human | mm control multiple myeloma cells disease state patients bone marrow vs pdlen7 mm 30 multiple myeloma cells disease state patients bone marrow |
| GSE115328_6_v_7_lenalidomide_human | osucll dmso 0 5h rep timepoint (h) 5 dose (micromolar) osu cll cell line vs osucll cc122 0.1 24h rep timepoint (h) 24 dose (micromolar) osu cll cell line |
| GSE158438_4_v_9_lenalidomide_human | blood cells cd8pos pd 1pos day 0 cd3pos untreated subject vs blood cells cd8pos pd day 7 cd3pos one week lenalidomide subject |
| GSE115328_1_v_5_lenalidomide_human | osucll dmso 0 24h rep timepoint (h) 24 dose (micromolar) osu cll cell line vs osucll cc122 1 5h rep timepoint (h) 5 dose (micromolar) osu cll cell line |
| GSE158438_5_v_12_lenalidomide_human | blood cells cd4pos pd 1neg day 0 cd3pos untreated subject vs blood cells cd4pos pd day 7 cd3pos one week lenalidomide subject |
| GSE173201_0_v_3_cisplatin_human | rna seq a2780 control cell line ovarian carcinoma cisplatin duration 3h vs rna seq a2780 cisplatin cell line ovarian carcinoma 200î¼m duration 3h |
| GSE216043_3_v_4_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs 2102ep cisplatin cell line embryonal carcinoma 2.5âµm 48h |
| GSE119978,GSE180930_3_v_7_cisplatin_human | dmsoplusplus cell line a549 vehicle (dmso) extract polysomes non small lung cancer vs cddpplusplus cell line a549 cisplatin extract polysomes non small lung cancer |
| GSE216043_7_v_0_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs 2102ep mln4924 cell line embryonal carcinoma 0.25âµm 48h |
| GSE235066_4_v_3_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs cisplatin rt112 cell line bladder cancer |
| GSE134029_3_v_0_cisplatin_human | igrov cp20 cells untreated biological cell line igrovf human ovarian cancer resistant cisplatin vs igrov cp20 cells treated tranilast cisplatin biological cell line igrovf human ovarian cancer resistant |
| GSE119978,GSE180930_0_v_7_cisplatin_human | h358 dmso cell line vehicle (dmso) extract total cells non small lung cancer vs cddpplusplus cell line a549 cisplatin extract polysomes non small lung cancer |
| GSE229973_3_v_7_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells magea6 ko ddp cell line esophageal squamous carcinoma knockout cisplatin |
| GSE206226_0_v_3_cisplatin_human | es2 plko cis8h cell line es 2 human ovarian cancer wt cisplatin vs es2 srms cis0h cell line es 2 human ovarian cancer knockdown pbs |
| GSE119978,GSE180930_2_v_8_cisplatin_human | ad cell line a549 vehicle (dmso) extract cytosol non small lung cancer vs ac cell line a549 cisplatin extract cytosol non small lung cancer |
| GSE216043_7_v_2_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs jar mln4924 cisplatin cell line choriocarcinoma 1âµm 4âµm 48h |
| GSE119978,GSE180930_2_v_5_cisplatin_human | ad cell line a549 vehicle (dmso) extract cytosol non small lung cancer vs h358 oxpt cell line oxaliplatin extract total cells non small lung cancer |
| GSE229973_4_v_2_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells magea6 ko cell line esophageal squamous carcinoma knockout |
| GSE119978,GSE180930_0_v_5_cisplatin_human | h358 dmso cell line vehicle (dmso) extract total cells non small lung cancer vs h358 oxpt cell line oxaliplatin extract total cells non small lung cancer |
| GSE216043_11_v_2_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs jar mln4924 cisplatin cell line choriocarcinoma 1âµm 4âµm 48h |
| GSE119978,GSE180930_2_v_7_cisplatin_human | ad cell line a549 vehicle (dmso) extract cytosol non small lung cancer vs cddpplusplus cell line a549 cisplatin extract polysomes non small lung cancer |
| GSE216043_10_v_0_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs 2102ep mln4924 cell line embryonal carcinoma 0.25âµm 48h |
| GSE165560_0_v_1_cisplatin_human | hela cells dmso cell line cervix epithelial passages 5 8 %0.1 16h vs hela cells cisplatin cell line cervix epithelial passages 5 8 80 um 16h |
| GSE181749_3_v_1_cisplatin_mouse | heart treated cddp 1st 8th 15th day wild type strain c57bl/6 vs cddp sting heart treated 1st 8th 15th day tmem173 / strain c57bl/6 |
| GSE229973_4_v_7_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells magea6 ko ddp cell line esophageal squamous carcinoma knockout cisplatin |
| GSE235066_7_v_6_cisplatin_human | cisplatin 5637 untreated cell line bladder cancer vs carboplatin 5637 cell line bladder cancer |
| GSE235066_7_v_1_cisplatin_human | cisplatin 5637 untreated cell line bladder cancer vs cisplatin 5637 cell line bladder cancer |
| GSE119978,GSE180930_2_v_4_cisplatin_human | ad cell line a549 vehicle (dmso) extract cytosol non small lung cancer vs h358 cddp cell line cisplatin extract total cells non small lung cancer |
| GSE210655_1_v_5_cisplatin_mouse | liver control vs kidney cblb502 72h 0.2mg/kg .p. |
| GSE210655_3_v_4_cisplatin_mouse | kidney control vs liver cisplatin+cblb502 72h 20mg/kg cisplatin + 0.2mg/kg cblb502 .p. |
| GSE207611,GSE207612_0_v_2_cisplatin_human | sample pancreatic cancer control ctrl replicate bxpc3 vs sample pancreatic cancer treated 6h replicate bxpc3 |
| GSE216043_3_v_5_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs jar mln4924 cell line choriocarcinoma 1âµm 48h |
| GSE207611,GSE207612_3_v_2_cisplatin_human | sample cell leukemia control ctrl replicate jurkat vs sample pancreatic cancer treated 6h replicate bxpc3 |
| GSE195786_3_v_1_cisplatin_mouse | female saline im rep strain c57bl/6 inner medulla sex control kidney vs male cisplaint im rep strain c57bl/6 inner medulla sex cisplatin kidney |
| GSE216043_3_v_0_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs 2102ep mln4924 cell line embryonal carcinoma 0.25âµm 48h |
| GSE195663_0_v_1_cisplatin_human | dms53 untreated cell line dose n/ lung vs dms53 lurbi cell line lurbinectedin dose 50nm lung |
| GSE216043_7_v_5_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs jar mln4924 cell line choriocarcinoma 1âµm 48h |
| GSE235066_4_v_6_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs carboplatin 5637 cell line bladder cancer |
| GSE195663_7_v_3_cisplatin_human | dms53 sicontrol cispt cell line cisplatin dose lung vs nci siscrambled lurbi cell line lurbinectedin dose 50nm lung |
| GSE172458_0_v_1_cisplatin_human | embryonic carcinoma origin testis dnmt3b knockdown plko.1 control derived 2102ep vs embryonic carcinoma origin testis dnmt3b knockdown dntm3b sh1 derived 2102ep |
| GSE235066_4_v_2_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs carboplatin rt112 cell line bladder cancer |
| GSE216043_7_v_4_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs 2102ep cisplatin cell line embryonal carcinoma 2.5âµm 48h |
| GSE119978,GSE180930_0_v_4_cisplatin_human | h358 dmso cell line vehicle (dmso) extract total cells non small lung cancer vs h358 cddp cell line cisplatin extract total cells non small lung cancer |
| GSE207611,GSE207612_0_v_1_cisplatin_human | sample pancreatic cancer control ctrl replicate bxpc3 vs sample cell leukemia treated 6h replicate jurkat |
| GSE176326_1_v_0_cisplatin_human | dmso cell line hela cervical cancer rna seq polya (vehicle) vs byk cell line hela cervical cancer rna seq polya byk204165 |
| GSE119978,GSE180930_3_v_8_cisplatin_human | dmsoplusplus cell line a549 vehicle (dmso) extract polysomes non small lung cancer vs ac cell line a549 cisplatin extract cytosol non small lung cancer |
| GSE173201_2_v_1_cisplatin_human | rna seq a2780cis control cell line ovarian carcinoma cisplatin duration 3h vs rna seq a2780cis cisplatin cell line ovarian carcinoma 200î¼m duration 3h |
| GSE163862_1_v_3_cisplatin_mouse | sample wildtype cisplatin strain background mixed age 8 12 weeks old kidney vs sample mutant cisplatin strain background mixed age 8 12 weeks old {gamma}gt1 cre fan1 / kidney ðx9dx9b¾gt1 |
| GSE210655_3_v_5_cisplatin_mouse | kidney control vs kidney cblb502 72h 0.2mg/kg .p. |
| GSE195786_0_v_2_cisplatin_mouse | male saline im rep strain c57bl/6 inner medulla sex control kidney vs female cisplatin im rep strain c57bl/6 inner medulla sex kidney |
| GSE216043_10_v_9_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs 2102ep mln4924 cisplatin cell line embryonal carcinoma 0.25âµm 2.5âµm 48h |
| GSE229973_3_v_6_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells magea6 ko cell line esophageal squamous carcinoma knockout |
| GSE229973_4_v_0_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells ddp cell line esophageal squamous carcinoma cisplatin |
| GSE216043_7_v_6_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs jar cisplatin cell line choriocarcinoma 4âµm 48h |
| GSE195663_0_v_2_cisplatin_human | dms53 untreated cell line dose n/ lung vs dms53 cispt cell line cisplatin dose lung |
| GSE235066_7_v_0_cisplatin_human | cisplatin 5637 untreated cell line bladder cancer vs carboplatin 5637 atri cell line bladder cancer cisplatin |
| GSE229973_3_v_5_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells ddp cell line esophageal squamous carcinoma cisplatin |
| GSE195663_7_v_5_cisplatin_human | dms53 sicontrol cispt cell line cisplatin dose lung vs dms53 sineurod1 cispt cell line cisplatin dose lung |
| GSE207611,GSE207612_3_v_1_cisplatin_human | sample cell leukemia control ctrl replicate jurkat vs sample cell leukemia treated 6h replicate jurkat |
| GSE216043_10_v_6_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs jar cisplatin cell line choriocarcinoma 4âµm 48h |
| GSE229973_3_v_2_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells magea6 ko cell line esophageal squamous carcinoma knockout |
| GSE210655_1_v_7_cisplatin_mouse | liver control vs liver cisplatin 72h 20mg/kg .p. |
| GSE134029_3_v_4_cisplatin_human | igrov cp20 cells untreated biological cell line igrovf human ovarian cancer resistant cisplatin vs igrov cp20 cells treated cisplatin biological cell line igrovf human ovarian cancer resistant |
| GSE216043_11_v_4_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs 2102ep cisplatin cell line embryonal carcinoma 2.5âµm 48h |
| GSE147613_1_v_0_cisplatin_mouse | untreated normal strain c57bl/6 gastrocnemius muscle sex female group age 4 weeks vs cisplatin strain c57bl/6 gastrocnemius muscle sex female group treated age 4 weeks |
| GSE210655_3_v_0_cisplatin_mouse | kidney control vs kidney cisplatin+cblb502 72h 20mg/kg cisplatin + 0.2mg/kg cblb502 .p. |
| GSE216043_11_v_9_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs 2102ep mln4924 cisplatin cell line embryonal carcinoma 0.25âµm 2.5âµm 48h |
| GSE181749_2_v_1_cisplatin_mouse | sting heart untreated tmem173 / strain c57bl/6 vs cddp sting heart treated 1st 8th 15th day tmem173 / strain c57bl/6 |
| GSE147613_1_v_2_cisplatin_mouse | untreated normal strain c57bl/6 gastrocnemius muscle sex female group age 4 weeks vs rp strain c57bl/6 gastrocnemius muscle sex female group cisplatin treated age 4 weeks |
| GSE119978,GSE180930_0_v_1_cisplatin_human | h358 dmso cell line vehicle (dmso) extract total cells non small lung cancer vs rc cell line a549r cisplatin extract cytosol non small lung cancer |
| GSE216043_3_v_2_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs jar mln4924 cisplatin cell line choriocarcinoma 1âµm 4âµm 48h |
| GSE216043_10_v_2_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs jar mln4924 cisplatin cell line choriocarcinoma 1âµm 4âµm 48h |
| GSE206226_2_v_3_cisplatin_human | es2 plko cis0h cell line es 2 human ovarian cancer wt pbs vs es2 srms cis0h cell line es 2 human ovarian cancer knockdown pbs |
| GSE195663_7_v_1_cisplatin_human | dms53 sicontrol cispt cell line cisplatin dose lung vs dms53 lurbi cell line lurbinectedin dose 50nm lung |
| GSE163862_0_v_3_cisplatin_mouse | sample wildtype control strain background mixed age 8 12 weeks old saline kidney vs sample mutant cisplatin strain background mixed age 8 12 weeks old {gamma}gt1 cre fan1 / kidney ðx9dx9b¾gt1 |
| GSE134029_3_v_2_cisplatin_human | igrov cp20 cells untreated biological cell line igrovf human ovarian cancer resistant cisplatin vs igrov cp20 cells treated amphotericin b cisplatin biological cell line igrovf human ovarian cancer resistant |
| GSE119978,GSE180930_3_v_4_cisplatin_human | dmsoplusplus cell line a549 vehicle (dmso) extract polysomes non small lung cancer vs h358 cddp cell line cisplatin extract total cells non small lung cancer |
| GSE235066_4_v_5_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs cisplatin 5637 atri cell line bladder cancer |
| GSE195786_3_v_2_cisplatin_mouse | female saline im rep strain c57bl/6 inner medulla sex control kidney vs female cisplatin im rep strain c57bl/6 inner medulla sex kidney |
| GSE169334,GSE169336_0_v_1_cisplatin_human | j82 ctrl rnaseq cell line bladder cancer control vs j82 foxc1 ko rnaseq cell line bladder cancer |
| GSE119978,GSE180930_6_v_8_cisplatin_human | rd cell line a549r vehicle (dmso) extract cytosol non small lung cancer vs ac cell line a549 cisplatin extract cytosol non small lung cancer |
| GSE216043_10_v_5_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs jar mln4924 cell line choriocarcinoma 1âµm 48h |
| GSE195663_7_v_2_cisplatin_human | dms53 sicontrol cispt cell line cisplatin dose lung vs dms53 cispt cell line cisplatin dose lung |
| GSE178532_1_v_3_cisplatin_human | mda mb 468 wt cell line breast cancer wild type vs mda mb 468 smarca4 ko cell line breast cancer knock |
| GSE216043_11_v_6_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs jar cisplatin cell line choriocarcinoma 4âµm 48h |
| GSE216043_3_v_9_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs 2102ep mln4924 cisplatin cell line embryonal carcinoma 0.25âµm 2.5âµm 48h |
| GSE235066_4_v_0_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs carboplatin 5637 atri cell line bladder cancer cisplatin |
| GSE161800_0_v_1_cisplatin_human | a549 cell line lung adenocarcinoma facs sorting pre sorted phenotype asynchronous untreated adenocarcinomic human alveolar basal epithelial cells vs a549 cisplatin pre cell line lung adenocarcinoma facs sorting sorted phenotype asynchronous pulse adenocarcinomic human alveolar basal epithelial cells |
| GSE181749_0_v_1_cisplatin_mouse | heart untreated wild type strain c57bl/6 vs cddp sting heart treated 1st 8th 15th day tmem173 / strain c57bl/6 |
| GSE173201_0_v_1_cisplatin_human | rna seq a2780 control cell line ovarian carcinoma cisplatin duration 3h vs rna seq a2780cis cisplatin cell line ovarian carcinoma 200î¼m duration 3h |
| GSE195663_0_v_3_cisplatin_human | dms53 untreated cell line dose n/ lung vs nci siscrambled lurbi cell line lurbinectedin dose 50nm lung |
| GSE178532_1_v_0_cisplatin_human | mda mb 468 wt cell line breast cancer wild type vs mda mb 231 smarca4 ko cell line breast cancer knock |
| GSE119978,GSE180930_0_v_8_cisplatin_human | h358 dmso cell line vehicle (dmso) extract total cells non small lung cancer vs ac cell line a549 cisplatin extract cytosol non small lung cancer |
| GSE206226_0_v_1_cisplatin_human | es2 plko cis8h cell line es 2 human ovarian cancer wt cisplatin vs es2 srms cis8h cell line es 2 human ovarian cancer knockdown cisplatin |
| GSE216043_10_v_1_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs jar dmf cell line choriocarcinoma 0.0096% 48h |
| GSE163862_2_v_3_cisplatin_mouse | sample mutant control strain background mixed age 8 12 weeks old {gamma}gt1 cre fan1 / saline kidney ðx9dx9b¾gt1 vs sample mutant cisplatin strain background mixed age 8 12 weeks old {gamma}gt1 cre fan1 / kidney ðx9dx9b¾gt1 |
| GSE210655_3_v_2_cisplatin_mouse | kidney control vs liver cblb502 72h 0.2mg/kg .p. |
| GSE216043_7_v_9_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs 2102ep mln4924 cisplatin cell line embryonal carcinoma 0.25âµm 2.5âµm 48h |
| GSE216043_10_v_4_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs 2102ep cisplatin cell line embryonal carcinoma 2.5âµm 48h |
| GSE229973_4_v_1_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells magea6 ko ddp cell line esophageal squamous carcinoma knockout cisplatin |
| GSE178532_2_v_0_cisplatin_human | mda mb 231 wt cell line breast cancer wild type vs mda mb 231 smarca4 ko cell line breast cancer knock |
| GSE178532_2_v_3_cisplatin_human | mda mb 231 wt cell line breast cancer wild type vs mda mb 468 smarca4 ko cell line breast cancer knock |
| GSE203584_1_v_0_cisplatin_mouse | kidney wt age 6 8 weeks strain c57bl/6j cisplatin (cp) disease state cp induced aki model vs kidney ko age 6 8 weeks strain c57bl/6j trpm2 cisplatin (cp) disease state cp induced aki model |
| GSE216043_7_v_1_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs jar dmf cell line choriocarcinoma 0.0096% 48h |
| GSE229973_3_v_0_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells ddp cell line esophageal squamous carcinoma cisplatin |
| GSE206226_2_v_1_cisplatin_human | es2 plko cis0h cell line es 2 human ovarian cancer wt pbs vs es2 srms cis8h cell line es 2 human ovarian cancer knockdown cisplatin |
| GSE216043_11_v_0_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs 2102ep mln4924 cell line embryonal carcinoma 0.25âµm 48h |
| GSE235066_4_v_1_cisplatin_human | carboplatin 5637 untreated cell line bladder cancer cisplatin vs cisplatin 5637 cell line bladder cancer |
| GSE173201_2_v_3_cisplatin_human | rna seq a2780cis control cell line ovarian carcinoma cisplatin duration 3h vs rna seq a2780 cisplatin cell line ovarian carcinoma 200î¼m duration 3h |
| GSE195663_0_v_5_cisplatin_human | dms53 untreated cell line dose n/ lung vs dms53 sineurod1 cispt cell line cisplatin dose lung |
| GSE210655_1_v_4_cisplatin_mouse | liver control vs liver cisplatin+cblb502 72h 20mg/kg cisplatin + 0.2mg/kg cblb502 .p. |
| GSE119978,GSE180930_6_v_4_cisplatin_human | rd cell line a549r vehicle (dmso) extract cytosol non small lung cancer vs h358 cddp cell line cisplatin extract total cells non small lung cancer |
| GSE216043_10_v_8_cisplatin_human | jar dmso dmf cell line choriocarcinoma 0.01% 0.0096% 48h vs 2102ep dmf cell line embryonal carcinoma 0.006% 48h |
| GSE216043_3_v_1_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs jar dmf cell line choriocarcinoma 0.0096% 48h |
| GSE210655_3_v_6_cisplatin_mouse | kidney control vs kidney cisplatin 72h 20mg/kg .p. |
| GSE235066_7_v_3_cisplatin_human | cisplatin 5637 untreated cell line bladder cancer vs cisplatin rt112 cell line bladder cancer |
| GSE119978,GSE180930_6_v_1_cisplatin_human | rd cell line a549r vehicle (dmso) extract cytosol non small lung cancer vs rc cell line a549r cisplatin extract cytosol non small lung cancer |
| GSE229973_3_v_1_cisplatin_human | kyse 150 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 510 cells magea6 ko ddp cell line esophageal squamous carcinoma knockout cisplatin |
| GSE216043_11_v_1_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs jar dmf cell line choriocarcinoma 0.0096% 48h |
| GSE229973_4_v_6_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells magea6 ko cell line esophageal squamous carcinoma knockout |
| GSE119978,GSE180930_3_v_1_cisplatin_human | dmsoplusplus cell line a549 vehicle (dmso) extract polysomes non small lung cancer vs rc cell line a549r cisplatin extract cytosol non small lung cancer |
| GSE161800_0_v_2_cisplatin_human | a549 cell line lung adenocarcinoma facs sorting pre sorted phenotype asynchronous untreated adenocarcinomic human alveolar basal epithelial cells vs a549 cisplatin post sort cell line lung adenocarcinoma facs sorting sorted phenotype arrested pulse adenocarcinomic human alveolar basal epithelial cells |
| GSE216043_11_v_5_cisplatin_human | 2102ep dmso cell line embryonal carcinoma 0.0025% 48h vs jar mln4924 cell line choriocarcinoma 1âµm 48h |
| GSE183041_1_v_0_cisplatin_human | sample cell line a2780 wt vs sample cell line a2780 cdk12 ko |
| GSE216043_7_v_8_cisplatin_human | jar dmso cell line choriocarcinoma 0.01% 48h vs 2102ep dmf cell line embryonal carcinoma 0.006% 48h |
| GSE119978,GSE180930_6_v_5_cisplatin_human | rd cell line a549r vehicle (dmso) extract cytosol non small lung cancer vs h358 oxpt cell line oxaliplatin extract total cells non small lung cancer |
| GSE210655_3_v_7_cisplatin_mouse | kidney control vs liver cisplatin 72h 20mg/kg .p. |
| GSE210895_1_v_0_cisplatin_mouse | eosinophils control ab primary cell sorted blood fvb/n antibody time day 21 start vs eosinophils cis+ primary cell sorted blood fvb/n cisplatin + apd1 actla4 time day 21 start |
| GSE119978,GSE180930_2_v_1_cisplatin_human | ad cell line a549 vehicle (dmso) extract cytosol non small lung cancer vs rc cell line a549r cisplatin extract cytosol non small lung cancer |
| GSE119978,GSE180930_3_v_5_cisplatin_human | dmsoplusplus cell line a549 vehicle (dmso) extract polysomes non small lung cancer vs h358 oxpt cell line oxaliplatin extract total cells non small lung cancer |
| GSE119978,GSE180930_6_v_7_cisplatin_human | rd cell line a549r vehicle (dmso) extract cytosol non small lung cancer vs cddpplusplus cell line a549 cisplatin extract polysomes non small lung cancer |
| GSE146072_0_v_1_cisplatin_mouse | sg con strain c57bl/6 lung cell line 889 control mouse vs sg kiaa1522 strain c57bl/6 lung cell line 889 downregulated mouse |
| GSE235066_7_v_2_cisplatin_human | cisplatin 5637 untreated cell line bladder cancer vs carboplatin rt112 cell line bladder cancer |
| GSE195786_0_v_1_cisplatin_mouse | male saline im rep strain c57bl/6 inner medulla sex control kidney vs male cisplaint im rep strain c57bl/6 inner medulla sex cisplatin kidney |
| GSE216043_3_v_6_cisplatin_human | 2102ep dmso dmf cell line embryonal carcinoma 0.0025% 0.006% 48h vs jar cisplatin cell line choriocarcinoma 4âµm 48h |
| GSE229973_4_v_5_cisplatin_human | kyse 510 cells nc cell line esophageal squamous carcinoma wt sgnc vs kyse 150 cells ddp cell line esophageal squamous carcinoma cisplatin |
| GSE210655_1_v_0_cisplatin_mouse | liver control vs kidney cisplatin+cblb502 72h 20mg/kg cisplatin + 0.2mg/kg cblb502 .p. |
| GSE134029_3_v_1_cisplatin_human | igrov cp20 cells untreated biological cell line igrovf human ovarian cancer resistant cisplatin vs igrov cp20 cells treated telmisartan cisplatin biological cell line igrovf human ovarian cancer resistant |
| GSE210655_1_v_2_cisplatin_mouse | liver control vs liver cblb502 72h 0.2mg/kg .p. |
| GSE210655_1_v_6_cisplatin_mouse | liver control vs kidney cisplatin 72h 20mg/kg .p. |
| GSE108084_3_v_2_epinephrine_human | iose11 cell line normal immortalized ovarian surface epithelial cells passage length 1 h vs ifte283 (rep cell line immortalized fallopian tube surface epithelial cells passage length 1 h |
| GSE168097_1_v_2_epinephrine_human | iftsec283 p53r175h treated vehicle control (replicate cell line fallopian tube secretory cells mock water 137 days overexpressing vs iftsec283 p53r175h treated 10î¼m ne (replicate cell line fallopian tube secretory cells 10 î¼m 137 days overexpressing |
| GSE168097_0_v_2_epinephrine_human | iftsec283 treated 10î¼m ne (replicate cell line fallopian tube secretory cells 10 î¼m 137 days wild type vs iftsec283 p53r175h treated 10î¼m ne (replicate cell line fallopian tube secretory cells 10 î¼m 137 days overexpressing |
| GSE168097_3_v_2_epinephrine_human | iftsec283 treated vehicle control (replicate cell line fallopian tube secretory cells mock water 137 days wild type vs iftsec283 p53r175h treated 10î¼m ne (replicate cell line fallopian tube secretory cells 10 î¼m 137 days overexpressing |
| GSE152699,GSE152723_0_v_1_vemurafenib_human | melanoma untreated m0 cell line m14s brafv600e vs melanoma verafinib m20 cell line m14s brafv600e 2 âµm 20 days |
| GSE178267_2_v_4_vemurafenib_human | ut cell line parental vem resistant clone vemurafenib replicates replicate 0.1% dmso diluent control 24 hours vs 8505c vem2um cell line parental vem resistant clone replicates replicate 2 um vemurafenib (plx4032) 24 hours |
| GSE107370_2_v_0_vemurafenib_human | bcorl1 wt a375 cells cell line /variation overexpression vs bcorl1 q1076h a375 cells cell line /variation overexpression |
| GSE152699,GSE152723_3_v_2_vemurafenib_human | melanoma untreated a0 cell line a375s brafv600e vs melanoma verafinib a20 cell line a375s brafv600e 2 âµm 20 days |
| GSE178267_2_v_0_vemurafenib_human | ut cell line parental vem resistant clone vemurafenib replicates replicate 0.1% dmso diluent control 24 hours vs wro vem2um cell line parental vem resistant clone replicates replicate 2 um vemurafenib (plx4032) 24 hours |
| GSE152699,GSE152723_0_v_2_vemurafenib_human | melanoma untreated m0 cell line m14s brafv600e vs melanoma verafinib a20 cell line a375s brafv600e 2 âµm 20 days |
| GSE152699,GSE152723_3_v_1_vemurafenib_human | melanoma untreated a0 cell line a375s brafv600e vs melanoma verafinib m20 cell line m14s brafv600e 2 âµm 20 days |
| GSE232836_2_v_1_morphine_mouse | h2o saline nucleus accumbens (brain) sex male bulk microbiome status normal vs abx saline nucleus accumbens (brain) sex male bulk microbiome status depleted |
| GSE229978_4_v_2_morphine_mouse | h2o saline nucleus accumbens (brain) bulk normal microbiome vs gf morphine nucleus accumbens (brain) bulk microbiome (20mg/kg/day/7 days) |
| GSE229978_4_v_7_morphine_mouse | h2o saline nucleus accumbens (brain) bulk normal microbiome vs gf saline nucleus accumbens (brain) bulk microbiome |
| GSE232836_2_v_6_morphine_mouse | h2o saline nucleus accumbens (brain) sex male bulk microbiome status normal vs abx morphine nucleus accumbens (brain) sex male bulk microbiome status depleted (20mg/kg/day/7 days) |
| GSE229978_4_v_8_morphine_mouse | h2o saline nucleus accumbens (brain) bulk normal microbiome vs abx saline nucleus accumbens (brain) bulk depleted microbiome |
| GSE229978_4_v_1_morphine_mouse | h2o saline nucleus accumbens (brain) bulk normal microbiome vs abx morphine nucleus accumbens (brain) bulk depleted microbiome (20mg/kg/day/7 days) |
| GSE202434,GSE202438_8_v_0_talazoparib_human | hs766t cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_15_v_0_talazoparib_human | panc1 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_15_v_5_talazoparib_human | panc1 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_13_v_5_talazoparib_human | panc1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_7_v_0_talazoparib_human | psn1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_7_v_1_talazoparib_human | psn1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_10_v_0_talazoparib_human | sw1990 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_6_v_5_talazoparib_human | hs766t cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_3_v_11_talazoparib_human | panc1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_13_v_0_talazoparib_human | panc1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_12_v_1_talazoparib_human | psn1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_13_v_1_talazoparib_human | panc1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_7_v_5_talazoparib_human | psn1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_9_v_0_talazoparib_human | sw1990 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_6_v_0_talazoparib_human | hs766t cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_8_v_11_talazoparib_human | hs766t cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_15_v_1_talazoparib_human | panc1 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_6_v_11_talazoparib_human | hs766t cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_6_v_14_talazoparib_human | hs766t cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_2_v_14_talazoparib_human | psn1 cells talazoparib treated replicate cell line pancreatic cancer wt 50 nm time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_4_v_11_talazoparib_human | hcc1806 cells parental replicate cell line breast cancer wt none time day 0 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_8_v_1_talazoparib_human | hs766t cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_2_v_1_talazoparib_human | psn1 cells talazoparib treated replicate cell line pancreatic cancer wt 50 nm time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_15_v_11_talazoparib_human | panc1 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_12_v_0_talazoparib_human | psn1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_13_v_14_talazoparib_human | panc1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_13_v_11_talazoparib_human | panc1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_9_v_1_talazoparib_human | sw1990 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_12_v_5_talazoparib_human | psn1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_12_v_14_talazoparib_human | psn1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_10_v_11_talazoparib_human | sw1990 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_6_v_1_talazoparib_human | hs766t cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_4_v_0_talazoparib_human | hcc1806 cells parental replicate cell line breast cancer wt none time day 0 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_10_v_1_talazoparib_human | sw1990 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_7_v_14_talazoparib_human | psn1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_8_v_5_talazoparib_human | hs766t cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_7_v_11_talazoparib_human | psn1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_2_v_0_talazoparib_human | psn1 cells talazoparib treated replicate cell line pancreatic cancer wt 50 nm time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_8_v_14_talazoparib_human | hs766t cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_2_v_11_talazoparib_human | psn1 cells talazoparib treated replicate cell line pancreatic cancer wt 50 nm time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_15_v_14_talazoparib_human | panc1 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_12_v_11_talazoparib_human | psn1 cells parental replicate cell line pancreatic cancer wt none time day 0 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_3_v_1_talazoparib_human | panc1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_3_v_5_talazoparib_human | panc1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_3_v_0_talazoparib_human | panc1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs hcc1806 cells talar cultured drug free media replicate cell line breast cancer df none time day 0 |
| GSE202434,GSE202438_3_v_14_talazoparib_human | panc1 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_2_v_5_talazoparib_human | psn1 cells talazoparib treated replicate cell line pancreatic cancer wt 50 nm time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_4_v_14_talazoparib_human | hcc1806 cells parental replicate cell line breast cancer wt none time day 0 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_4_v_5_talazoparib_human | hcc1806 cells parental replicate cell line breast cancer wt none time day 0 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_9_v_14_talazoparib_human | sw1990 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_4_v_1_talazoparib_human | hcc1806 cells parental replicate cell line breast cancer wt none time day 0 vs panc1 cells talar replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_9_v_11_talazoparib_human | sw1990 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs hcc1806 cells talar maintained drug media replicate cell line breast cancer talazoparib 50 nm time 4 months |
| GSE202434,GSE202438_10_v_5_talazoparib_human | sw1990 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_9_v_5_talazoparib_human | sw1990 cells talazoparib treated replicate cell line pancreatic cancer wt 100 nm time day 3 vs psn1 cells talar cultured drug free media replicate cell line pancreatic cancer df none time day 0 |
| GSE202434,GSE202438_10_v_14_talazoparib_human | sw1990 cells dmso treated replicate cell line pancreatic cancer wt time day 3 vs psn1 cells talar maintained drug media replicate cell line pancreatic cancer talazoparib 50 nm time 4 months |
| GSE131649_4_v_0_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin cell line k562 replicate sledai b3 |
| GSE131649_2_v_9_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin + scrambled shrna cell line k562 replicate sledai c3 |
| GSE131649_4_v_3_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + arid3a shrna cell line k562 replicate sledai d2 |
| GSE131649_4_v_5_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin cell line k562 replicate sledai b2 |
| GSE131649_4_v_11_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + arid3a shrna cell line k562 replicate sledai |
| GSE131649_2_v_11_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin + arid3a shrna cell line k562 replicate sledai |
| GSE131649_6_v_3_hemin_human | untreated cell line k562 replicate sledai vs hemin + arid3a shrna cell line k562 replicate sledai d2 |
| GSE131649_2_v_5_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin cell line k562 replicate sledai b2 |
| GSE131649_2_v_3_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin + arid3a shrna cell line k562 replicate sledai d2 |
| GSE131649_6_v_9_hemin_human | untreated cell line k562 replicate sledai vs hemin + scrambled shrna cell line k562 replicate sledai c3 |
| GSE245354_6_v_4_hemin_human | ctrl 1.5 hr [5958 np pulmonary microvascular endothelial cells vs hb2+ 1.5 hr [5958 np pulmonary microvascular endothelial cells |
| GSE131649_6_v_5_hemin_human | untreated cell line k562 replicate sledai vs hemin cell line k562 replicate sledai b2 |
| GSE131649_4_v_7_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin cell line k562 replicate sledai b |
| GSE131649_4_v_9_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + scrambled shrna cell line k562 replicate sledai c3 |
| GSE131649_6_v_1_hemin_human | untreated cell line k562 replicate sledai vs hemin + scrambled shrna cell line k562 replicate sledai c |
| GSE131649_6_v_10_hemin_human | untreated cell line k562 replicate sledai vs hemin + arid3a shrna cell line k562 replicate sledai d3 |
| GSE131649_4_v_10_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + arid3a shrna cell line k562 replicate sledai d3 |
| GSE131649_2_v_0_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin cell line k562 replicate sledai b3 |
| GSE131649_2_v_7_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin cell line k562 replicate sledai b |
| GSE131649_6_v_11_hemin_human | untreated cell line k562 replicate sledai vs hemin + arid3a shrna cell line k562 replicate sledai |
| GSE245354_6_v_1_hemin_human | ctrl 1.5 hr [5958 np pulmonary microvascular endothelial cells vs hemin 30 min [5958 np pulmonary microvascular endothelial cells |
| GSE131649_6_v_8_hemin_human | untreated cell line k562 replicate sledai vs hemin + scrambled shrna cell line k562 replicate sledai c2 |
| GSE131649_4_v_1_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + scrambled shrna cell line k562 replicate sledai c |
| GSE131649_2_v_8_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin + scrambled shrna cell line k562 replicate sledai c2 |
| GSE131649_6_v_0_hemin_human | untreated cell line k562 replicate sledai vs hemin cell line k562 replicate sledai b3 |
| GSE131649_2_v_1_hemin_human | untreated cell line k562 replicate sledai a2 vs hemin + scrambled shrna cell line k562 replicate sledai c |
| GSE131649_6_v_7_hemin_human | untreated cell line k562 replicate sledai vs hemin cell line k562 replicate sledai b |
| GSE245354_6_v_5_hemin_human | ctrl 1.5 hr [5958 np pulmonary microvascular endothelial cells vs hemin 1.5 hr [5958 np pulmonary microvascular endothelial cells |
| GSE131649_4_v_8_hemin_human | untreated cell line k562 replicate sledai a3 vs hemin + scrambled shrna cell line k562 replicate sledai c2 |
| GSE42805,GSE42811_1_v_3_cocaine_mouse | mrna seq sal passages 8 10 weeks strain c57bl/6 repeated saline .p. injection 1w control nucleus accumbens nac dissection 3 5 animals vs mrna seq coc passages 8 10 weeks strain c57bl/6 repeated cocaine .p. injection 1w 20mg/kg nucleus accumbens nac dissection 3 5 animals |
| GSE200189,GSE200255_1_v_4_cocaine_mouse | wt female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE234767,GSE234769_3_v_1_cocaine_human | h9 cerebral organoids control resub cell line hesc (nih 0062) neural cultures vs h9 cerebral organoids cocaine resub cell line hesc (nih 0062) neural cultures |
| GSE200189,GSE200255_7_v_5_cocaine_mouse | wt female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE200189,GSE200255_0_v_2_cocaine_mouse | wt male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE224096_2_v_0_cocaine_human | neuron uthbc subject id uthbc0090 ipsc cell line untreated ethnicity black sex male age time death 58 postmortem interval (hours) 29.7 rna integrity number brain cerebellar ph na consenus diagnosis cocaine use disorder vs ba9 uthbc subject id brain brodmann area 9 cell line na ethnicity sex age time death postmortem interval (hours) rna integrity number cerebellar ph consenus diagnosis cocaine use disorder |
| GSE141624_1_v_6_cocaine_mouse | saline self administration ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum group control 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) vs cocaine self administration nonescalating group ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) |
| GSE200189,GSE200255_0_v_3_cocaine_mouse | wt male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE208141,GSE208142_2_v_3_cocaine_mouse | thalami saline injected maged1 wt mice rnaseq replicate thalamus cell line neural 2 4 months old vs thalami cocaine injected maged1 cko mice rnaseq replicate thalamus cell line neural 2 4 months old maged1cko |
| GSE89572_1_v_0_cocaine_mouse | chronic control strain c57bl/6 brain compartment prefrontal cortex drug time final dose age 10 weeks vs cocaine strain c57bl/6 brain compartment prefrontal cortex drug time final dose age 10 weeks |
| GSE200189,GSE200255_6_v_4_cocaine_mouse | wt male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE141624_3_v_0_cocaine_mouse | saline self administration withdrawl ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum group control approx. 1 month following extended line drd1 trap cp73 sample type immunopurified (ip) vs cocaine self administration escalating group ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) |
| GSE200189,GSE200255_1_v_2_cocaine_mouse | wt female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE141667_3_v_10_cocaine_mouse | saline self administration withdrawl ip background strain fvb/n swiss webster x 9 generations c57bl/6 minimum protocol control group approx. 1 month following line drd1 trap cp73 application rna seq sample type immunopurified (ip) accumbens nucleus vs cocaine self administration nonescalating group withdrawl ip background strain fvb/n swiss webster x 9 generations c57bl/6 minimum protocol approx. 1 month following line drd1 trap cp73 application rna seq sample type immunopurified (ip) accumbens nucleus |
| GSE234767,GSE234769_0_v_1_cocaine_human | h9 cerebral organoids control +ros inhibitor resub cell line hesc (nih 0062) neural cultures vs h9 cerebral organoids cocaine resub cell line hesc (nih 0062) neural cultures |
| GSE141624_1_v_2_cocaine_mouse | saline self administration ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum group control 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) vs cocaine self administration escalating group withdrawl ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum approx. 1 month following line drd1 trap cp73 sample type immunopurified (ip) |
| GSE141204_2_v_1_cocaine_mouse | yoked control line chat trap dw167 whole striatum sample type immunopurified (ip) vs cocaine self administration line chat trap dw167 whole striatum sample type immunopurified (ip) |
| GSE200189,GSE200255_0_v_5_cocaine_mouse | wt male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE200189,GSE200255_7_v_3_cocaine_mouse | wt female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE42805,GSE42811_1_v_0_cocaine_mouse | mrna seq sal passages 8 10 weeks strain c57bl/6 repeated saline .p. injection 1w control nucleus accumbens nac dissection 3 5 animals vs acute coc passages 8 10 weeks strain c57bl/6 repeated saline .p. injection 6 days followed cocaine 1 day 20mg/kg nac dissection 3 5 animals |
| GSE234767,GSE234769_0_v_4_cocaine_human | h9 cerebral organoids control +ros inhibitor resub cell line hesc (nih 0062) neural cultures vs h9 cerebral organoids dopamine resub cell line hesc (nih 0062) neural cultures |
| GSE200189,GSE200255_0_v_4_cocaine_mouse | wt male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE200189,GSE200255_7_v_2_cocaine_mouse | wt female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE200189,GSE200255_6_v_5_cocaine_mouse | wt male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE141667_3_v_2_cocaine_mouse | saline self administration withdrawl ip background strain fvb/n swiss webster x 9 generations c57bl/6 minimum protocol control group approx. 1 month following line drd1 trap cp73 application rna seq sample type immunopurified (ip) accumbens nucleus vs cocaine self administration nonescalating group withdrawl ip background strain fvb/n swiss webster x 9 generations c57bl/6 minimum protocol approx. 1 month following line drd1 trap cp73 application rna seq sample type immunopurified (ip) accumbens nucleus |
| GSE141624_1_v_7_cocaine_mouse | saline self administration ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum group control 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) vs cocaine self administration nonescalating group withdrawl ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum approx. 1 month following line drd1 trap cp73 sample type immunopurified (ip) |
| GSE200189,GSE200255_7_v_4_cocaine_mouse | wt female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex vs itat female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE42805,GSE42811_2_v_3_cocaine_mouse | acute sal passages 8 10 weeks strain c57bl/6 repeated saline .p. injection 1w control nac dissection 3 5 animals vs mrna seq coc passages 8 10 weeks strain c57bl/6 repeated cocaine .p. injection 1w 20mg/kg nucleus accumbens nac dissection 3 5 animals |
| GSE200189,GSE200255_6_v_2_cocaine_mouse | wt male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat male coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE224096_1_v_0_cocaine_human | npc uthbc subject id uthbc0097 ipsc cell line untreated ethnicity white sex female age time death 36 postmortem interval (hours) 24.4 rna integrity number brain cerebellar ph na consenus diagnosis opioid use disorder severe borderline personality vs ba9 uthbc subject id brain brodmann area 9 cell line na ethnicity sex age time death postmortem interval (hours) rna integrity number cerebellar ph consenus diagnosis cocaine use disorder |
| GSE200189,GSE200255_1_v_5_cocaine_mouse | wt female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat female coc (rna seq) brain hippocampus strain c57bl/6j cocaine .p. sex |
| GSE224096_3_v_0_cocaine_human | neuron uthbc subject id uthbc0097 ipsc cell line untreated ethnicity white sex female age time death 36 postmortem interval (hours) 24.4 rna integrity number brain cerebellar ph na consenus diagnosis opioid use disorder severe borderline personality vs ba9 uthbc subject id brain brodmann area 9 cell line na ethnicity sex age time death postmortem interval (hours) rna integrity number cerebellar ph consenus diagnosis cocaine use disorder |
| GSE234767,GSE234769_3_v_4_cocaine_human | h9 cerebral organoids control resub cell line hesc (nih 0062) neural cultures vs h9 cerebral organoids dopamine resub cell line hesc (nih 0062) neural cultures |
| GSE200189,GSE200255_6_v_3_cocaine_mouse | wt male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE141624_3_v_6_cocaine_mouse | saline self administration withdrawl ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum group control approx. 1 month following extended line drd1 trap cp73 sample type immunopurified (ip) vs cocaine self administration nonescalating group ip dorsal striatum strain fvb/n swiss webster x 9 generations c57bl/6 minimum 24 hours following extended line drd1 trap cp73 sample type immunopurified (ip) |
| GSE200189,GSE200255_1_v_3_cocaine_mouse | wt female sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex vs itat male sal (rna seq) brain hippocampus strain c57bl/6j saline .p. sex |
| GSE137928_0_v_1_blebbistatin_mouse | control strain icr submandibular gland age e13 embryo vs blebbistatin strain icr submandibular gland age e13 embryo |
| GSE220520_1_v_0_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rvd1 replicate liver strain c57bl/6 sex male |
| GSE255988_2_v_0_ethanol_human | microglia control cell line lprs vs microglia 75mm ethanol cell line 75 mm |
| GSE220520_3_v_8_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1 pair fed lps replicate liver strain c57bl/6 sex male |
| GSE227891_5_v_0_ethanol_mouse | astrocyte control trap cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction (translating rna) vs astrocyte ethanol trap cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction (translating rna) |
| GSE220520_1_v_2_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1+/ pair fed replicate liver strain c57bl/6 sex male |
| GSE220520_5_v_9_ethanol_mouse | wild type pair fed lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rve1 replicate liver strain c57bl/6 sex male |
| GSE220520_6_v_0_ethanol_mouse | wild type etoh replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rvd1 replicate liver strain c57bl/6 sex male |
| GSE220520_5_v_4_ethanol_mouse | wild type pair fed lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps replicate liver strain c57bl/6 sex male |
| GSE220520_3_v_0_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rvd1 replicate liver strain c57bl/6 sex male |
| GSE232624_4_v_5_ethanol_human | fibroblasts control 6h skin cell line ctr vs fibroblasts cbd 3um 12h skin cell line cbd3 |
| GSE220520_3_v_9_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rve1 replicate liver strain c57bl/6 sex male |
| GSE220520_1_v_7_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1 etoh replicate liver strain c57bl/6 sex male |
| GSE220520_3_v_4_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps replicate liver strain c57bl/6 sex male |
| GSE220520_6_v_8_ethanol_mouse | wild type etoh replicate liver strain c57bl/6 sex male vs fat1 pair fed lps replicate liver strain c57bl/6 sex male |
| GSE129370_2_v_3_ethanol_mouse | wt liver sample pair fed strain c57bl/6 age 3 months agent /variation wildtype sex female vs ko liver sample ethanol fed strain c57bl/6 age 3 months agent /variation sirt6 specific knockout sex female |
| GSE220520_1_v_8_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1 pair fed lps replicate liver strain c57bl/6 sex male |
| GSE100217_2_v_0_ethanol_mouse | strain/background c57bl/6 /variation wt brain sex male age postnatal day 7 saline somatosensory cortex vs strain/background c57bl/6 /variation p53 ko brain sex male age postnatal day 7 etoh somatosensory cortex |
| GSE220520_5_v_2_ethanol_mouse | wild type pair fed lps replicate liver strain c57bl/6 sex male vs fat1+/ pair fed replicate liver strain c57bl/6 sex male |
| GSE220520_6_v_4_ethanol_mouse | wild type etoh replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps replicate liver strain c57bl/6 sex male |
| GSE227891_2_v_0_ethanol_mouse | astrocyte control input cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction vs astrocyte ethanol trap cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction (translating rna) |
| GSE241036_0_v_1_ethanol_mouse | liver cells wt vs hepatocytes dko liver sms1/sms2 |
| GSE220520_6_v_2_ethanol_mouse | wild type etoh replicate liver strain c57bl/6 sex male vs fat1+/ pair fed replicate liver strain c57bl/6 sex male |
| GSE241036_4_v_1_ethanol_mouse | hepatocytes wt liver vs hepatocytes dko liver sms1/sms2 |
| GSE222445_2_v_1_ethanol_mouse | cbl brain cerebellum strain c57bl/6j age adult control vs cbl brain cerebellum strain c57bl/6j age adult ethanol |
| GSE220520_6_v_9_ethanol_mouse | wild type etoh replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rve1 replicate liver strain c57bl/6 sex male |
| GSE92457_7_v_8_ethanol_mouse | 2 c th strain c57bl/6j brain region prefrontal cortex control (water) total homogenate vs 2 e strain c57bl/6j brain region prefrontal cortex ethanol astrocyte |
| GSE100217_1_v_3_ethanol_mouse | strain/background c57bl/6 /variation wt brain sex male age postnatal day 7 etoh somatosensory cortex vs strain/background c57bl/6 /variation p53 ko brain sex male age postnatal day 7 saline somatosensory cortex |
| GSE227891_5_v_3_ethanol_mouse | astrocyte control trap cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction (translating rna) vs astrocyte ethanol input cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction |
| GSE92457_9_v_10_ethanol_mouse | 2 c strain c57bl/6j brain region prefrontal cortex control (water) astrocyte vs 2 e th strain c57bl/6j brain region prefrontal cortex ethanol total homogenate |
| GSE232624_4_v_2_ethanol_human | fibroblasts control 6h skin cell line ctr vs fibroblasts etoh 025% skin cell line etoh025 |
| GSE100217_2_v_3_ethanol_mouse | strain/background c57bl/6 /variation wt brain sex male age postnatal day 7 saline somatosensory cortex vs strain/background c57bl/6 /variation p53 ko brain sex male age postnatal day 7 saline somatosensory cortex |
| GSE100217_1_v_0_ethanol_mouse | strain/background c57bl/6 /variation wt brain sex male age postnatal day 7 etoh somatosensory cortex vs strain/background c57bl/6 /variation p53 ko brain sex male age postnatal day 7 etoh somatosensory cortex |
| GSE220520_1_v_9_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rve1 replicate liver strain c57bl/6 sex male |
| GSE241036_4_v_2_ethanol_mouse | hepatocytes wt liver vs liver cells smsrko |
| GSE227891_2_v_3_ethanol_mouse | astrocyte control input cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction vs astrocyte ethanol input cortex cell line primary culture b6 fvb tg(aldh1l1 egfp/rpl10a)jd130htz/j fraction |
| GSE220520_5_v_7_ethanol_mouse | wild type pair fed lps replicate liver strain c57bl/6 sex male vs fat1 etoh replicate liver strain c57bl/6 sex male |
| GSE232624_4_v_3_ethanol_human | fibroblasts control 6h skin cell line ctr vs fibroblasts cbd 075um skin cell line cbd075 |
| GSE220520_1_v_4_ethanol_mouse | wild type etoh lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps replicate liver strain c57bl/6 sex male |
| GSE232624_4_v_1_ethanol_human | fibroblasts control 6h skin cell line ctr vs fibroblasts etoh 075um skin cell line |
| GSE241036_0_v_2_ethanol_mouse | liver cells wt vs liver cells smsrko |
| GSE129370_2_v_1_ethanol_mouse | wt liver sample pair fed strain c57bl/6 age 3 months agent /variation wildtype sex female vs ko liver sample pair fed strain c57bl/6 age 3 months agent /variation sirt6 specific knockout sex female |
| GSE220520_3_v_2_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1+/ pair fed replicate liver strain c57bl/6 sex male |
| GSE241036_4_v_3_ethanol_mouse | hepatocytes wt liver vs hepatocytes tko liver sms1/sms2/smsr |
| GSE129370_0_v_3_ethanol_mouse | wt liver sample ethanol fed strain c57bl/6 age 3 months agent /variation wildtype sex female vs ko liver sample ethanol fed strain c57bl/6 age 3 months agent /variation sirt6 specific knockout sex female |
| GSE92457_9_v_8_ethanol_mouse | 2 c strain c57bl/6j brain region prefrontal cortex control (water) astrocyte vs 2 e strain c57bl/6j brain region prefrontal cortex ethanol astrocyte |
| GSE92457_9_v_12_ethanol_mouse | 2 c strain c57bl/6j brain region prefrontal cortex control (water) astrocyte vs 2 e th strain c57bl/6j brain region prefrontal cortex ethanol total homogenate |
| GSE241036_0_v_3_ethanol_mouse | liver cells wt vs hepatocytes tko liver sms1/sms2/smsr |
| GSE220520_3_v_7_ethanol_mouse | wild type pair fed replicate liver strain c57bl/6 sex male vs fat1 etoh replicate liver strain c57bl/6 sex male |
| GSE180304_3_v_1_ethanol_mouse | wild type (wt) (cat +/+) gavage ethanol femoral shaft rna vs catalase knockout (ko) (cat / ) gavage pbs femoral shaft rna |
| GSE129370_0_v_1_ethanol_mouse | wt liver sample ethanol fed strain c57bl/6 age 3 months agent /variation wildtype sex female vs ko liver sample pair fed strain c57bl/6 age 3 months agent /variation sirt6 specific knockout sex female |
| GSE220520_5_v_0_ethanol_mouse | wild type pair fed lps replicate liver strain c57bl/6 sex male vs fat1+/ etoh lps + rvd1 replicate liver strain c57bl/6 sex male |
| GSE174498,GSE174500_3_v_8_asparaginase_human | cem nt cell line control replicate vs rs411 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_2_v_8_asparaginase_human | 697 nt cell line control replicate vs rs411 lasp cell line treated 4hrs replicate |
| GSE92364_1_v_3_asparaginase_mouse | wt asnase strain background c57bl/6j /variation wild type age 8 16 wk old gender treated asparaginase liver vs gcn2 / asnase strain background c57bl/6j /variation deletion age 8 16 wk old gender treated asparaginase liver |
| GSE174498,GSE174500_5_v_7_asparaginase_human | reh nt cell line control replicate vs nalm6 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_0_v_4_asparaginase_human | nalm6 nt cell line control replicate vs lasp cell line treated 4hrs replicate |
| GSE92364_1_v_5_asparaginase_mouse | wt asnase strain background c57bl/6j /variation wild type age 8 16 wk old gender treated asparaginase liver vs atf4 / asnase strain background c57bl/6j /variation deletion age 8 16 wk old gender treated asparaginase liver |
| GSE174498,GSE174500_5_v_8_asparaginase_human | reh nt cell line control replicate vs rs411 lasp cell line treated 4hrs replicate |
| GSE92364_1_v_2_asparaginase_mouse | wt asnase strain background c57bl/6j /variation wild type age 8 16 wk old gender treated asparaginase liver vs atf4 / pbs strain background c57bl/6j /variation deletion age 8 16 wk old gender treated phosphate buffered saline liver |
| GSE92364_0_v_3_asparaginase_mouse | wt pbs strain background c57bl/6j /variation wild type age 8 16 wk old gender treated phosphate buffered saline liver vs gcn2 / asnase strain background c57bl/6j /variation deletion age 8 16 wk old gender treated asparaginase liver |
| GSE174498,GSE174500_0_v_1_asparaginase_human | nalm6 nt cell line control replicate vs dnd41 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_3_v_1_asparaginase_human | cem nt cell line control replicate vs dnd41 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_5_v_4_asparaginase_human | reh nt cell line control replicate vs lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_2_v_7_asparaginase_human | 697 nt cell line control replicate vs nalm6 lasp cell line treated 4hrs replicate |
| GSE92364_0_v_5_asparaginase_mouse | wt pbs strain background c57bl/6j /variation wild type age 8 16 wk old gender treated phosphate buffered saline liver vs atf4 / asnase strain background c57bl/6j /variation deletion age 8 16 wk old gender treated asparaginase liver |
| GSE92364_0_v_4_asparaginase_mouse | wt pbs strain background c57bl/6j /variation wild type age 8 16 wk old gender treated phosphate buffered saline liver vs gcn2 / pbs strain background c57bl/6j /variation deletion age 8 16 wk old gender treated phosphate buffered saline liver |
| GSE92364_1_v_4_asparaginase_mouse | wt asnase strain background c57bl/6j /variation wild type age 8 16 wk old gender treated asparaginase liver vs gcn2 / pbs strain background c57bl/6j /variation deletion age 8 16 wk old gender treated phosphate buffered saline liver |
| GSE174498,GSE174500_3_v_7_asparaginase_human | cem nt cell line control replicate vs nalm6 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_0_v_8_asparaginase_human | nalm6 nt cell line control replicate vs rs411 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_2_v_4_asparaginase_human | 697 nt cell line control replicate vs lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_5_v_1_asparaginase_human | reh nt cell line control replicate vs dnd41 lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_3_v_4_asparaginase_human | cem nt cell line control replicate vs lasp cell line treated 4hrs replicate |
| GSE174498,GSE174500_2_v_1_asparaginase_human | 697 nt cell line control replicate vs dnd41 lasp cell line treated 4hrs replicate |
| GSE158632_2_v_1_oxyquinoline_human | caco 2 control mrna cell line cells vs ht 29 cocl2 mrna 24 hours cell line cells |
| GSE158632_3_v_5_oxyquinoline_human | ht 29 control mrna cell line cells vs caco 2 cocl2 mrna 24 hours cell line cells |
| GSE158632_2_v_5_oxyquinoline_human | caco 2 control mrna cell line cells vs caco 2 cocl2 mrna 24 hours cell line cells |
| GSE158632_3_v_0_oxyquinoline_human | ht 29 control mrna cell line cells vs ht 29 oxy mrna oxyquinoline 24 hours cell line cells |
| GSE158632_2_v_0_oxyquinoline_human | caco 2 control mrna cell line cells vs ht 29 oxy mrna oxyquinoline 24 hours cell line cells |
| GSE158632_3_v_1_oxyquinoline_human | ht 29 control mrna cell line cells vs ht 29 cocl2 mrna 24 hours cell line cells |
| GSE158632_3_v_4_oxyquinoline_human | ht 29 control mrna cell line cells vs caco 2 oxy mrna oxyquinoline 24 hours cell line cells |
| GSE158632_2_v_4_oxyquinoline_human | caco 2 control mrna cell line cells vs caco 2 oxy mrna oxyquinoline 24 hours cell line cells |
| GSE178340_5_v_9_carfilzomib_human | ctrl2 s2 human multiple myeloma cell line mm.1s dmso mm vs atra2 s5 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_1_v_9_carfilzomib_human | ctrl3 s3 human multiple myeloma cell line mm.1s dmso mm vs atra2 s5 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_7_v_9_carfilzomib_human | ctrl1 s1 human multiple myeloma cell line mm.1s dmso mm vs atra2 s5 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_5_v_4_carfilzomib_human | ctrl2 s2 human multiple myeloma cell line mm.1s dmso mm vs atra3 s6 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_7_v_4_carfilzomib_human | ctrl1 s1 human multiple myeloma cell line mm.1s dmso mm vs atra3 s6 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_7_v_2_carfilzomib_human | ctrl1 s1 human multiple myeloma cell line mm.1s dmso mm vs cfz s7 human multiple myeloma cell line mm.1s mm |
| GSE178340_7_v_3_carfilzomib_human | ctrl1 s1 human multiple myeloma cell line mm.1s dmso mm vs atra cfz s8 human multiple myeloma cell line mm.1s atra+cfz mm |
| GSE178340_5_v_2_carfilzomib_human | ctrl2 s2 human multiple myeloma cell line mm.1s dmso mm vs cfz s7 human multiple myeloma cell line mm.1s mm |
| GSE178340_5_v_3_carfilzomib_human | ctrl2 s2 human multiple myeloma cell line mm.1s dmso mm vs atra cfz s8 human multiple myeloma cell line mm.1s atra+cfz mm |
| GSE178340_7_v_6_carfilzomib_human | ctrl1 s1 human multiple myeloma cell line mm.1s dmso mm vs atra1 s4 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_1_v_4_carfilzomib_human | ctrl3 s3 human multiple myeloma cell line mm.1s dmso mm vs atra3 s6 human multiple myeloma cell line mm.1s atra mm |
| GSE178340_1_v_3_carfilzomib_human | ctrl3 s3 human multiple myeloma cell line mm.1s dmso mm vs atra cfz s8 human multiple myeloma cell line mm.1s atra+cfz mm |
| GSE178340_5_v_6_carfilzomib_human | ctrl2 s2 human multiple myeloma cell line mm.1s dmso mm vs atra1 s4 human multiple myeloma cell line mm.1s atra mm |
| GSE143406_1_v_0_carfilzomib_human | dmso 1 cell line arp human multiple myeloma (mm) passage 12 vs car 1 cell line arp human multiple myeloma (mm) passage 12 carfilzomib (cfz) cfz |
| GSE178340_1_v_2_carfilzomib_human | ctrl3 s3 human multiple myeloma cell line mm.1s dmso mm vs cfz s7 human multiple myeloma cell line mm.1s mm |
| GSE178340_1_v_6_carfilzomib_human | ctrl3 s3 human multiple myeloma cell line mm.1s dmso mm vs atra1 s4 human multiple myeloma cell line mm.1s atra mm |
| GSE176305_0_v_3_rotenone_human | mia paca2 dmso vs mia paca2 pp |
| GSE176305_0_v_2_rotenone_human | mia paca2 dmso vs mia paca2 oligo |
| GSE176305_0_v_1_rotenone_human | mia paca2 dmso vs mia paca2 roten |
| GSE155836,GSE155839_3_v_1_alvocidib_human | gsc1517 control rna seq glioblastoma stem cells dmso derived vs shcont rna seq glioblastoma stem cells derived |
| GSE155836,GSE155839_3_v_2_alvocidib_human | gsc1517 control rna seq glioblastoma stem cells dmso derived vs gsc1517 alvocidib rna seq glioblastoma stem cells derived |
| GSE217162_0_v_2_nivolumab_mouse | vehicle control tumor sub cutaneous cell line meva2.1.dova mouse brafv600e pten / cdkn2a (tumor line) vs domatinostat tumor sub cutaneous cell line meva2.1.dova mouse brafv600e pten / cdkn2a (tumor line) |
| GSE77108_6_v_1_saha_human | diabetic dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_6_v_9_saha_human | diabetic dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_0_v_2_saha_human | healthy c646 human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_5_v_7_saha_human | healthy dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_0_v_7_saha_human | healthy c646 human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_0_v_1_saha_human | healthy c646 human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_4_v_7_saha_human | healthy saha human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_3_v_1_saha_human | healthy nt sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_0_v_9_saha_human | healthy c646 human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_5_v_2_saha_human | healthy dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_3_v_7_saha_human | healthy nt sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE169691_1_v_2_saha_mouse | wt et lps il4 strain background 129 age 8 10 weeks animals splenic b cells vs strain background c57bl6 age 8 10 weeks animals femoral b cells |
| GSE77108_8_v_1_saha_human | healthy ep300 sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_5_v_1_saha_human | healthy dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_6_v_7_saha_human | diabetic dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_8_v_2_saha_human | healthy ep300 sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_3_v_2_saha_human | healthy nt sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_8_v_7_saha_human | healthy ep300 sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic saha human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_4_v_9_saha_human | healthy saha human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_8_v_9_saha_human | healthy ep300 sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_4_v_2_saha_human | healthy saha human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_5_v_9_saha_human | healthy dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_3_v_9_saha_human | healthy nt sirna human aortic endothelial cell disease state passages 5 9 cells vs diabetic nt sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_6_v_2_saha_human | diabetic dmso human aortic endothelial cell disease state passages 5 9 cells vs diabetic c646 human aortic endothelial cell disease state passages 5 9 cells |
| GSE77108_4_v_1_saha_human | healthy saha human aortic endothelial cell disease state passages 5 9 cells vs diabetic ep300 sirna human aortic endothelial cell disease state passages 5 9 cells |
| GSE210682_2_v_1_methadone_human | ipsc cell line control (vehicle) biological replicate cortical organoids vs ipsc cell line b methadone biological replicate cortical organoids |
| GSE210682_0_v_1_methadone_human | ipsc cell line b control (vehicle) biological replicate cortical organoids vs ipsc cell line b methadone biological replicate cortical organoids |
| GSE210682_0_v_3_methadone_human | ipsc cell line b control (vehicle) biological replicate cortical organoids vs ipsc cell line methadone biological replicate cortical organoids |
| GSE210682_2_v_3_methadone_human | ipsc cell line control (vehicle) biological replicate cortical organoids vs ipsc cell line methadone biological replicate cortical organoids |
| GSE150688_2_v_0_ursolic acid_mouse | con colon strain c57bl/6 untreated mouse vs dss colon strain c57bl/6 treated mouse |
| GSE225735_0_v_4_aldosterone_human | nci h295r control overexpression cell line adrenocortical carcinoma wt empty vector vs nci h295r nfatc4 ko cell line adrenocortical carcinoma knock |
| GSE236437_2_v_1_aldosterone_human | wt doxycycline 24h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 vs mutant doxycycline 0h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 |
| GSE236437_2_v_3_aldosterone_human | wt doxycycline 24h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 vs mutant doxycycline 24h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 |
| GSE225735_2_v_4_aldosterone_human | nci h295r ko control cell line adrenocortical carcinoma wt vs nci h295r nfatc4 ko cell line adrenocortical carcinoma knock |
| GSE225735_1_v_4_aldosterone_human | nci h295r constitutively active nfatc4 overexpression cell line adrenocortical carcinoma wt vs nci h295r nfatc4 ko cell line adrenocortical carcinoma knock |
| GSE236437_0_v_3_aldosterone_human | wt doxycycline 0h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 vs mutant doxycycline 24h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 |
| GSE236437_0_v_1_aldosterone_human | wt doxycycline 0h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 vs mutant doxycycline 0h rep adrenal cortex cell line hac15 adrenocortical carcinoma slc30a1 |
| GSE193541_0_v_3_nifurtimox_human | control chrysin rep cell line a549 adenocarcinomic human alveolar basal epithelial cells dmso vs nifurtimox 30um rep cell line a549 adenocarcinomic human alveolar basal epithelial cells |
| GSE193541_1_v_2_nifurtimox_human | control nifurtimox rep cell line a549 adenocarcinomic human alveolar basal epithelial cells dmso vs chrysin 30um rep cell line a549 adenocarcinomic human alveolar basal epithelial cells |
| GSE193541_0_v_2_nifurtimox_human | control chrysin rep cell line a549 adenocarcinomic human alveolar basal epithelial cells dmso vs chrysin 30um rep cell line a549 adenocarcinomic human alveolar basal epithelial cells |
| GSE193541_1_v_3_nifurtimox_human | control nifurtimox rep cell line a549 adenocarcinomic human alveolar basal epithelial cells dmso vs nifurtimox 30um rep cell line a549 adenocarcinomic human alveolar basal epithelial cells |
| GSE176008_8_v_1_azacitidine_human | wt1 human ipscs differentiation stage ipsc wild type sorting method facs tra 1+ vs mt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 mutant type sorting method facs |
| GSE158738_0_v_1_azacitidine_human | dmso control acute myeloid leukemia cell line molm 13 time 4su labeling 60 min harvest cells vs c646 replicate acute myeloid leukemia cell line molm 13 time 4su labeling 60 min harvest cells |
| GSE176008_0_v_1_azacitidine_human | wt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 wild type sorting method facs vs mt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 mutant type sorting method facs |
| GSE176008_7_v_2_azacitidine_human | wt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 wild type sorting method facs vs mt1 human ipscs differentiation stage ipsc mutant type sorting method facs tra 1+ |
| GSE176008_8_v_2_azacitidine_human | wt1 human ipscs differentiation stage ipsc wild type sorting method facs tra 1+ vs mt1 human ipscs differentiation stage ipsc mutant type sorting method facs tra 1+ |
| GSE169617_1_v_3_azacitidine_human | flowcell cell line sex female tp53 mutation untreated ovarian cancer vs azacitidine carboplatin flowcell cell line sex female tp53 mutation treated 5âµm 20âµm ovarian cancer |
| GSE176008_0_v_3_azacitidine_human | wt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 wild type sorting method facs vs mt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 mutant type sorting method facs |
| GSE176008_4_v_3_azacitidine_human | wt1 cd34+ human ipsc derived cells differentiation stage day8 wild type sorting method facs vs mt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 mutant type sorting method facs |
| GSE176008_7_v_1_azacitidine_human | wt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 wild type sorting method facs vs mt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 mutant type sorting method facs |
| GSE176008_4_v_2_azacitidine_human | wt1 cd34+ human ipsc derived cells differentiation stage day8 wild type sorting method facs vs mt1 human ipscs differentiation stage ipsc mutant type sorting method facs tra 1+ |
| GSE212330_1_v_0_azacitidine_human | dmso cell line u937 aml vs aza tak cell line u937 aml azacitidine + 981 |
| GSE169617_1_v_2_azacitidine_human | flowcell cell line sex female tp53 mutation untreated ovarian cancer vs tyknu flowcell cell line sex female tp53 mutation tp53c.524g> p.arg175his kinase nras c.35g> p.gly12asp c.181c> p.gln61lys ovarian cancer |
| GSE212330_1_v_3_azacitidine_human | dmso cell line u937 aml vs aza cell line u937 aml azacitidine |
| GSE176008_4_v_1_azacitidine_human | wt1 cd34+ human ipsc derived cells differentiation stage day8 wild type sorting method facs vs mt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 mutant type sorting method facs |
| GSE212330_1_v_2_azacitidine_human | dmso cell line u937 aml vs tak cell line u937 aml 981 |
| GSE176008_8_v_3_azacitidine_human | wt1 human ipscs differentiation stage ipsc wild type sorting method facs tra 1+ vs mt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 mutant type sorting method facs |
| GSE176008_0_v_5_azacitidine_human | wt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 wild type sorting method facs vs mt1 cd34+ human ipsc derived cells differentiation stage day8 mutant type sorting method facs |
| GSE176008_8_v_5_azacitidine_human | wt1 human ipscs differentiation stage ipsc wild type sorting method facs tra 1+ vs mt1 cd34+ human ipsc derived cells differentiation stage day8 mutant type sorting method facs |
| GSE176008_7_v_3_azacitidine_human | wt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 wild type sorting method facs vs mt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 mutant type sorting method facs |
| GSE176008_7_v_5_azacitidine_human | wt1 cd43+cd34+cd38 lin human ipsc derived hematopoietic progenitor cells differentiation stage day15 wild type sorting method facs vs mt1 cd34+ human ipsc derived cells differentiation stage day8 mutant type sorting method facs |
| GSE176008_0_v_2_azacitidine_human | wt1 erythroblasts human ipsc derived cd235a+ differentiation stage day34 wild type sorting method facs vs mt1 human ipscs differentiation stage ipsc mutant type sorting method facs tra 1+ |
| GSE114013,GSE114014_1_v_4_itraconazole_human | sw948 cont cell line dmso colorectal cancer vs ht55 itra cell line itraconazole colorectal cancer |
| GSE114013,GSE114014_0_v_4_itraconazole_human | ht55 cont cell line dmso colorectal cancer vs ht55 itra cell line itraconazole colorectal cancer |
| GSE114013,GSE114014_0_v_3_itraconazole_human | ht55 cont cell line dmso colorectal cancer vs sw948 itra cell line itraconazole colorectal cancer |
| GSE114013,GSE114014_1_v_3_itraconazole_human | sw948 cont cell line dmso colorectal cancer vs sw948 itra cell line itraconazole colorectal cancer |
| GSE191037_0_v_1_itraconazole_human | c0 cell line a431 agent control vs t1 cell line a431 agent itraconazole |
| GSE136340_1_v_2_darunavir_human | ctrlv ntreat virus vsv pseudotyped egfp lentivirus drug none condition control day 4 conditionally immortalized renal tubular epithelial cells (hpt1b) vs hiv drvtreat 4d virus vsv pseudotyped gag/pol deleted drug darunavir 5um x (day 4 7 post transduction condition day + conditionally immortalized renal tubular epithelial cells (hpt1b) |
| GSE136340_1_v_4_darunavir_human | ctrlv ntreat virus vsv pseudotyped egfp lentivirus drug none condition control day 4 conditionally immortalized renal tubular epithelial cells (hpt1b) vs hiv ntreat virus vsv pseudotyped gag/pol deleted drug none condition day conditionally immortalized renal tubular epithelial cells (hpt1b) |
| GSE136340_5_v_4_darunavir_human | ctrlv ntreat 4d virus vsv pseudotyped egfp lentivirus drug none condition control day 7 conditionally immortalized renal tubular epithelial cells (hpt1b) vs hiv ntreat virus vsv pseudotyped gag/pol deleted drug none condition day conditionally immortalized renal tubular epithelial cells (hpt1b) |
| GSE136340_3_v_4_darunavir_human | ctrlv drvtreat 4d virus vsv pseudotyped egfp lentivirus drug darunavir 5um x (day 4 7 post transduction condition control day + conditionally immortalized renal tubular epithelial cells (hpt1b) vs hiv ntreat virus vsv pseudotyped gag/pol deleted drug none condition day conditionally immortalized renal tubular epithelial cells (hpt1b) |
| GSE206400_1_v_4_nusinersen_mouse | spinal cord unaffected heterozygouse littermates (wt) p7 smn +/ hsmn2 /+ vs spinal cord ms023 nusinersen treated sma mice p7 smn / hsmn2 /+ one subc injection p0 30 mg/kg daily (p1 p6) oral 2 |
| GSE206400_3_v_2_nusinersen_mouse | spinal cord untreated sma mice p7 smn / hsmn2 /+ vs spinal cord nusinersen treated sma mice p7 smn / hsmn2 /+ one subc injection p0 30 mg/kg |
| GSE206400_3_v_0_nusinersen_mouse | spinal cord untreated sma mice p7 smn / hsmn2 /+ vs spinal cord ms023 treated sma mice p7 smn / hsmn2 /+ daily (p1 p6) oral 2 mg/kg |
| GSE206400_1_v_0_nusinersen_mouse | spinal cord unaffected heterozygouse littermates (wt) p7 smn +/ hsmn2 /+ vs spinal cord ms023 treated sma mice p7 smn / hsmn2 /+ daily (p1 p6) oral 2 mg/kg |
| GSE206400_1_v_2_nusinersen_mouse | spinal cord unaffected heterozygouse littermates (wt) p7 smn +/ hsmn2 /+ vs spinal cord nusinersen treated sma mice p7 smn / hsmn2 /+ one subc injection p0 30 mg/kg |
| GSE206400_3_v_4_nusinersen_mouse | spinal cord untreated sma mice p7 smn / hsmn2 /+ vs spinal cord ms023 nusinersen treated sma mice p7 smn / hsmn2 /+ one subc injection p0 30 mg/kg daily (p1 p6) oral 2 |
| GSE252857_1_v_3_prednisone_mouse | heartklf15 wt + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle vs heartklf15 ko + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle |
| GSE252857_2_v_0_prednisone_mouse | heartklf15 wt + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone vs heartklf15 ko + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone |
| GSE252857_2_v_3_prednisone_mouse | heartklf15 wt + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone vs heartklf15 ko + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle |
| GSE252857_1_v_0_prednisone_mouse | heartklf15 wt + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle vs heartklf15 ko + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone |
| GSE252826_3_v_1_prednisone_mouse | wt myocardium age 4 months old sex male cardiomyocyte gr prednisone vs grko myocardium age 4 months old sex male cardiomyocyte gr ko prednisone |
| GSE252826_0_v_1_prednisone_mouse | wt myocardium age 4 months old sex male cardiomyocyte gr vehicle vs grko myocardium age 4 months old sex male cardiomyocyte gr ko prednisone |
| GSE120612_7_v_0_etoposide_human | nalm6 control cell line acute lymphoblastic leukemia () pre b vs nalm6 etoposide cell line acute lymphoblastic leukemia () pre b |
| GSE67266_2_v_4_etoposide_mouse | wt eto 1h rep etoposide (20âµm) replicate /variation vs mk2/2 ko mock 6h rep mock/dmso replicate /variation mk2/3 |
| GSE67266_5_v_1_etoposide_mouse | wt mock 6h rep mock/dmso replicate /variation vs mk2/2 ko eto rep etoposide (20âµm) replicate /variation mk2/3 |
| GSE67266_7_v_4_etoposide_mouse | wt eto 6h rep etoposide (20âµm) replicate /variation vs mk2/2 ko mock 6h rep mock/dmso replicate /variation mk2/3 |
| GSE120612_7_v_2_etoposide_human | nalm6 control cell line acute lymphoblastic leukemia () pre b vs thp1 etoposide cell line acute monocytic leukemia monocyte |
| GSE120612_6_v_0_etoposide_human | thp1 control cell line acute monocytic leukemia monocyte vs nalm6 etoposide cell line acute lymphoblastic leukemia () pre b |
| GSE67266_7_v_3_etoposide_mouse | wt eto 6h rep etoposide (20âµm) replicate /variation vs mk2/2 ko mock 1h rep mock/dmso replicate /variation mk2/3 |
| GSE120612_4_v_1_etoposide_human | jurkat control cell line acute leukemia lymphocyte vs 697 cell line acute lymphoblastic leukemia () pre b |
| GSE67266_5_v_3_etoposide_mouse | wt mock 6h rep mock/dmso replicate /variation vs mk2/2 ko mock 1h rep mock/dmso replicate /variation mk2/3 |
| GSE120612_7_v_1_etoposide_human | nalm6 control cell line acute lymphoblastic leukemia () pre b vs 697 cell line acute lymphoblastic leukemia () pre b |
| GSE120612_6_v_1_etoposide_human | thp1 control cell line acute monocytic leukemia monocyte vs 697 cell line acute lymphoblastic leukemia () pre b |
| GSE120612_7_v_3_etoposide_human | nalm6 control cell line acute lymphoblastic leukemia () pre b vs u937 etoposide cell line histiocytic leukemia monocyte |
| GSE67266_7_v_1_etoposide_mouse | wt eto 6h rep etoposide (20âµm) replicate /variation vs mk2/2 ko eto rep etoposide (20âµm) replicate /variation mk2/3 |
| GSE120612_4_v_3_etoposide_human | jurkat control cell line acute leukemia lymphocyte vs u937 etoposide cell line histiocytic leukemia monocyte |
| GSE120612_6_v_5_etoposide_human | thp1 control cell line acute monocytic leukemia monocyte vs ramos cell line burkitt' lymphoma (american) b lymphocyte |
| GSE120612_7_v_5_etoposide_human | nalm6 control cell line acute lymphoblastic leukemia () pre b vs ramos cell line burkitt' lymphoma (american) b lymphocyte |
| GSE120612_4_v_5_etoposide_human | jurkat control cell line acute leukemia lymphocyte vs ramos cell line burkitt' lymphoma (american) b lymphocyte |
| GSE120612_4_v_2_etoposide_human | jurkat control cell line acute leukemia lymphocyte vs thp1 etoposide cell line acute monocytic leukemia monocyte |
| GSE67266_2_v_1_etoposide_mouse | wt eto 1h rep etoposide (20âµm) replicate /variation vs mk2/2 ko eto rep etoposide (20âµm) replicate /variation mk2/3 |
| GSE120612_6_v_3_etoposide_human | thp1 control cell line acute monocytic leukemia monocyte vs u937 etoposide cell line histiocytic leukemia monocyte |
| GSE120612_4_v_0_etoposide_human | jurkat control cell line acute leukemia lymphocyte vs nalm6 etoposide cell line acute lymphoblastic leukemia () pre b |
| GSE67266_2_v_3_etoposide_mouse | wt eto 1h rep etoposide (20âµm) replicate /variation vs mk2/2 ko mock 1h rep mock/dmso replicate /variation mk2/3 |
| GSE120612_6_v_2_etoposide_human | thp1 control cell line acute monocytic leukemia monocyte vs thp1 etoposide cell line acute monocytic leukemia monocyte |
| GSE67266_5_v_4_etoposide_mouse | wt mock 6h rep mock/dmso replicate /variation vs mk2/2 ko mock 6h rep mock/dmso replicate /variation mk2/3 |
| GSE82104,GSE82299_1_v_2_acriflavine_human | panc1 cell line panc 1 pancreatic cancer (atcc crl 1469) none control vs panc1 cobalt cell line panc 1 pancreatic cancer (atcc crl 1469) + acf acriflavin |
| GSE82104,GSE82299_1_v_0_acriflavine_human | panc1 cell line panc 1 pancreatic cancer (atcc crl 1469) none control vs panc1 cell line panc 1 pancreatic cancer (atcc crl 1469) cobalt |
| GSE82110,GSE82299_1_v_0_acriflavine_human | jdk275 cell line hepg2 none control vs jdk275 cell line hepg2 5 âµm acf acftreatment 5âµm |
| GSE176555,GSE176556_1_v_0_acriflavine_human | dmso huvec human umbilical vein endothelial cells vs acriflavine huvec human umbilical vein endothelial cells |
| GSE139540_0_v_2_menadione_human | cap h2 shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs cap d3 shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE139540_4_v_2_menadione_human | cap d3 shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs cap d3 shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE139540_4_v_1_menadione_human | cap d3 shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs non target shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE139540_0_v_1_menadione_human | cap h2 shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs non target shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE139540_3_v_1_menadione_human | non target shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs non target shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE139540_3_v_2_menadione_human | non target shrna [ml dmso cell line ht 29 human colon adenocarcinoma (ht 29) cells vs cap d3 shrna [ml 50um menadione cell line ht 29 human colon adenocarcinoma (ht 29) cells |
| GSE197342_1_v_0_berberine_mouse | colorectum strain c57bl/6 bbr 7d disease state control group normal mice receiving berberine vs colorectum strain c57bl/6 dss 7d disease state colitis group mice |
| GSE197342_2_v_0_berberine_mouse | colorectum strain c57bl/6 water 7d disease state control group normal mice vs colorectum strain c57bl/6 dss 7d disease state colitis group mice |
| GSE57871_8_v_10_vorinostat_human | mock dmso rep2 cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sigli1 vorinostat cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_6_v_2_vorinostat_human | sipsmd13 dmso 8hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 8hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_11_v_10_vorinostat_human | mock dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sigli1 vorinostat cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_8_v_12_vorinostat_human | mock dmso rep2 cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_1_v_12_vorinostat_human | sigli1 dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_1_v_2_vorinostat_human | sigli1 dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 8hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_6_v_10_vorinostat_human | sipsmd13 dmso 8hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sigli1 vorinostat cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_11_v_12_vorinostat_human | mock dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_6_v_9_vorinostat_human | sipsmd13 dmso 8hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs mock vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_1_v_9_vorinostat_human | sigli1 dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs mock vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_8_v_9_vorinostat_human | mock dmso rep2 cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs mock vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_5_v_12_vorinostat_human | sipsdm13 dmso 12hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_1_v_10_vorinostat_human | sigli1 dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sigli1 vorinostat cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_5_v_2_vorinostat_human | sipsdm13 dmso 12hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 8hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_5_v_10_vorinostat_human | sipsdm13 dmso 12hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sigli1 vorinostat cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_11_v_2_vorinostat_human | mock dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 8hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_5_v_9_vorinostat_human | sipsdm13 dmso 12hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs mock vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_8_v_2_vorinostat_human | mock dmso rep2 cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 8hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE57871_6_v_12_vorinostat_human | sipsmd13 dmso 8hr cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs sipsmd13 vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE102187_0_v_1_vorinostat_human | unreated cd4 cell state untreated (dmso) rna extract vs vorinostat cd4 cell state (saha) rna extract |
| GSE57871_11_v_9_vorinostat_human | mock dmso cell line vorinostat resistant hct116 timepoint colorectal carcinoma vs mock vorinostat 12hr cell line resistant hct116 timepoint colorectal carcinoma |
| GSE180321_0_v_1_imperatorin_human | sample control group cell line human osteosarcoma 143b non (control) vs sample imper group cell line human osteosarcoma 143b 125 î¼m imp 24h imperatorin 24 h |
| GSE236497,GSE236500_1_v_0_pemrametostat_human | cell line mcf 7 rbko er+ breast cancer cells rb1 knockout dmso vs cell line mcf 7 rbko er+ breast cancer cells rb1 knockout pemrametostat |
| GSE120370_4_v_6_thrombin_mouse | kpc par1 ko1 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc par1 ko1 thrombin strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE120370_0_v_6_thrombin_mouse | kpc par1 ko8 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc par1 ko1 thrombin strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE120370_4_v_1_thrombin_mouse | kpc par1 ko1 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc par1 ko8 thrombin strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE120370_0_v_3_thrombin_mouse | kpc par1 ko8 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc thrombin strain c57bl/6 kras g12d trp53 r172h elas creer 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE120370_0_v_1_thrombin_mouse | kpc par1 ko8 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc par1 ko8 thrombin strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE120370_4_v_3_thrombin_mouse | kpc par1 ko1 control strain c57bl/6 kras g12d trp53 r172h elas creer f2r ko 24h vehicle pancreatic ductal adenocarcinoma cell line vs kpc thrombin strain c57bl/6 kras g12d trp53 r172h elas creer 24h 1u/ml pancreatic ductal adenocarcinoma cell line |
| GSE71972_11_v_10_histamine_human | control immediately exercise [con immediate] subject id group vastus lateralis muscle biopsy vs histamine blockade post exercise [hist post] subject id group received combined h1/h2 receptor prior 3 hours vastus lateralis muscle biopsy |
| GSE71972_9_v_12_histamine_human | control pre exercise [con pre] subject id group vastus lateralis muscle biopsy vs histamine blockade immediately exercise [hist immediate] subject id group received combined h1/h2 receptor prior vastus lateralis muscle biopsy |
| GSE71972_11_v_6_histamine_human | control immediately exercise [con immediate] subject id group vastus lateralis muscle biopsy vs histamine blockade pre exercise [hist pre] subject id group received combined h1/h2 receptor prior vastus lateralis muscle biopsy |
| GSE71972_9_v_10_histamine_human | control pre exercise [con pre] subject id group vastus lateralis muscle biopsy vs histamine blockade post exercise [hist post] subject id group received combined h1/h2 receptor prior 3 hours vastus lateralis muscle biopsy |
| GSE93918_2_v_3_clozapine_mouse | strain/background c57bl/6 wild type sex male clozapine (10mg/kg) prefrontal cortex vs strain/background c57bl/6 hdac2(loxp loxp) camkiia cre(+ ) sex male vehicle prefrontal cortex |
| GSE93918_2_v_0_clozapine_mouse | strain/background c57bl/6 wild type sex male clozapine (10mg/kg) prefrontal cortex vs strain/background c57bl/6 hdac2(loxp loxp) camkiia cre(+ ) sex male clozapine (10mg/kg) prefrontal cortex |
| GSE93918_1_v_3_clozapine_mouse | strain/background c57bl/6 wild type sex male vehicle prefrontal cortex vs strain/background c57bl/6 hdac2(loxp loxp) camkiia cre(+ ) sex male vehicle prefrontal cortex |
| GSE93918_1_v_0_clozapine_mouse | strain/background c57bl/6 wild type sex male vehicle prefrontal cortex vs strain/background c57bl/6 hdac2(loxp loxp) camkiia cre(+ ) sex male clozapine (10mg/kg) prefrontal cortex |
| GSE153907,GSE153908_0_v_1_azathioprine_human | untreated derived rimary glioblastoma cells tumor subtype primary vs treated azathioprine derived rimary glioblastoma cells tumor subtype primary |
| GSE192860_0_v_1_trifluoperazine_human | control biological nasopharyngeal carcinoma cells passage p3 p10 vs tfp 72 hr biological nasopharyngeal carcinoma cells passage p3 p10 |
| GSE158834_2_v_5_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_0_v_4_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_8_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE148321,GSE169423_0_v_3_palmitic acid_human | untreated notsorted scc 25 4d oscc cells vs treated4 notsorted scc 25 post pa 4d oscc cells |
| GSE158834_10_v_4_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_8_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_5_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_12_v_3_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_8_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_4_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_4_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE205913_1_v_0_palmitic acid_human | huvecs nc sample cell line primary cells human umbilical vein endothelial untreated vs huvecs pa sample cell line primary cells human umbilical vein endothelial palmitic acid |
| GSE148321,GSE169423_2_v_1_palmitic acid_human | untreated 14days scc 25 14d oscc cells vs treated4 14days scc 25 post pa 14d oscc cells |
| GSE158834_1_v_6_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_3_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_4_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_8_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_3_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_9_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_6_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE199644_3_v_2_palmitic acid_mouse | hepatic progenitor cells ptpn1+/+ agent control liver vs hepatic progenitor cells ptpn1 / agent palmitic acid 400 microm 8h liver |
| GSE158834_1_v_8_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_5_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_0_v_5_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE199644_3_v_1_palmitic acid_mouse | hepatic progenitor cells ptpn1+/+ agent control liver vs hepatic progenitor cells ptpn1+/+ agent palmitic acid 400 microm 8h liver |
| GSE158834_12_v_6_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_13_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_13_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_8_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_6_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_9_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_13_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_5_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_7_v_9_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_6_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_9_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_9_palmitic acid_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_5_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_7_v_6_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE148321,GSE169423_0_v_1_palmitic acid_human | untreated notsorted scc 25 4d oscc cells vs treated4 14days scc 25 post pa 14d oscc cells |
| GSE158834_11_v_4_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE148321,GSE169423_2_v_3_palmitic acid_human | untreated 14days scc 25 14d oscc cells vs treated4 notsorted scc 25 post pa 4d oscc cells |
| GSE158834_2_v_4_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_13_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_3_palmitic acid_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_3_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_9_palmitic acid_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_8_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_5_palmitic acid_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_0_v_9_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_13_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_6_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_3_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_3_palmitic acid_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_13_palmitic acid_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_13_palmitic acid_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE130956_0_v_1_icaritin_human | dp 0574 untreated melanoma cancer cell line (mbm) vs dp 0574 treated melanoma cancer cell line (mbm) icaritin |
| GSE130956_0_v_3_icaritin_human | dp 0574 untreated melanoma cancer cell line (mbm) vs wp 0614 treated melanoma cancer cell line (mbm) icaritin |
| GSE130956_2_v_1_icaritin_human | wp 0614 untreated melanoma cancer cell line (mbm) vs dp 0574 treated melanoma cancer cell line (mbm) icaritin |
| GSE158431_2_v_0_pioglitazone_mouse | sample control 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample pioglitazone 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE140607_0_v_6_pioglitazone_mouse | hfd diet wt strain c57bl6/j gender male age 5 months liver high fat vs piohfd diet ko strain c57bl6/j gender male age 5 months liver high fat pioglitazone |
| GSE171269_1_v_2_pioglitazone_mouse | normal liver strain c57bl/6j wild type mice vs model liver strain db/db mice |
| GSE158431_2_v_3_pioglitazone_mouse | sample control 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample pioglitazone+gentamicin 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE158431_5_v_1_pioglitazone_mouse | sample control 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample gentamicin 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE171269_1_v_4_pioglitazone_mouse | normal liver strain c57bl/6j wild type mice vs model pgz liver strain db/db mice |
| GSE140607_2_v_6_pioglitazone_mouse | control diet ko strain c57bl6/j gender male age 5 months liver vs piohfd diet ko strain c57bl6/j gender male age 5 months liver high fat pioglitazone |
| GSE140607_5_v_6_pioglitazone_mouse | control diet wt strain c57bl6/j gender male age 5 months liver vs piohfd diet ko strain c57bl6/j gender male age 5 months liver high fat pioglitazone |
| GSE158431_5_v_4_pioglitazone_mouse | sample control 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample pioglitazone 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE171269_1_v_0_pioglitazone_mouse | normal liver strain c57bl/6j wild type mice vs model dle liver strain db/db mice |
| GSE140607_1_v_6_pioglitazone_mouse | pio diet wt strain c57bl6/j gender male age 5 months liver control pioglitazone vs piohfd diet ko strain c57bl6/j gender male age 5 months liver high fat pioglitazone |
| GSE140607_3_v_6_pioglitazone_mouse | hfd pio diet wt strain c57bl6/j gender male age 5 months liver high fat pioglitazone vs piohfd diet ko strain c57bl6/j gender male age 5 months liver high fat pioglitazone |
| GSE158431_5_v_7_pioglitazone_mouse | sample control 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample pioglitazone+gentamicin 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE171269_1_v_3_pioglitazone_mouse | normal liver strain c57bl/6j wild type mice vs model wte liver strain db/db mice |
| GSE158431_2_v_6_pioglitazone_mouse | sample control 6h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc vs sample gentamicin 24h strain c57bl/6n age 5 day old (p5) organ corti (oc) time hours replicate oc |
| GSE102505_4_v_0_tunicamycin_human | u251 dmso glioblastoma derived (atcc) passages <10 0.1% (vehicle) vs u251 nh125 glioblastoma derived (atcc) passages <10 2.5 micromolar |
| GSE102505_4_v_3_tunicamycin_human | u251 dmso glioblastoma derived (atcc) passages <10 0.1% (vehicle) vs u251 tun glioblastoma derived (atcc) passages <10 1.0 mcg/ml tunicamycin |
| GSE102505_6_v_0_tunicamycin_human | nha dmso human derived glial cells passages <10 0.1% (vehicle) brain normal astrocytes vs u251 nh125 glioblastoma derived (atcc) passages <10 2.5 micromolar |
| GSE102505_6_v_3_tunicamycin_human | nha dmso human derived glial cells passages <10 0.1% (vehicle) brain normal astrocytes vs u251 tun glioblastoma derived (atcc) passages <10 1.0 mcg/ml tunicamycin |
| GSE117042_1_v_3_tunicamycin_mouse | c57 dmso strain c57bl6 wild type bone marrow derived macrophages vs 4ko(quad) tm strain c57bl6 casp1 / casp8 casp11 ripk3 bone marrow derived macrophages |
| GSE102505_5_v_3_tunicamycin_human | t4213 dmso glioma derived stem cells passages <10 0.1% (vehicle) glioblastoma vs u251 tun glioblastoma derived (atcc) passages <10 1.0 mcg/ml tunicamycin |
| GSE102505_4_v_2_tunicamycin_human | u251 dmso glioblastoma derived (atcc) passages <10 0.1% (vehicle) vs t4213 nh125 glioma derived stem cells passages <10 2.5 micromolar glioblastoma |
| GSE102505_5_v_2_tunicamycin_human | t4213 dmso glioma derived stem cells passages <10 0.1% (vehicle) glioblastoma vs t4213 nh125 glioma derived stem cells passages <10 2.5 micromolar glioblastoma |
| GSE102505_1_v_3_tunicamycin_human | nha human derived glial cells passages <10 brain normal astrocytes vs u251 tun glioblastoma derived (atcc) passages <10 1.0 mcg/ml tunicamycin |
| GSE102505_1_v_2_tunicamycin_human | nha human derived glial cells passages <10 brain normal astrocytes vs t4213 nh125 glioma derived stem cells passages <10 2.5 micromolar glioblastoma |
| GSE102505_1_v_0_tunicamycin_human | nha human derived glial cells passages <10 brain normal astrocytes vs u251 nh125 glioblastoma derived (atcc) passages <10 2.5 micromolar |
| GSE102505_6_v_2_tunicamycin_human | nha dmso human derived glial cells passages <10 0.1% (vehicle) brain normal astrocytes vs t4213 nh125 glioma derived stem cells passages <10 2.5 micromolar glioblastoma |
| GSE117042_0_v_3_tunicamycin_mouse | 4ko(quad) dmso strain c57bl6 casp1 / casp8 casp11 ripk3 bone marrow derived macrophages vs 4ko(quad) tm strain c57bl6 casp1 / casp8 casp11 ripk3 bone marrow derived macrophages |
| GSE159446,GSE159449_1_v_0_tunicamycin_mouse | dmso6h mm rna sr islamr primary hippocampal neurons div 10 agent dmso hippocampus vs tunica6h mm rna sr islamr b primary hippocampal neurons div 10 agent tunicamycin hippocampus |
| GSE102505_5_v_0_tunicamycin_human | t4213 dmso glioma derived stem cells passages <10 0.1% (vehicle) glioblastoma vs u251 nh125 glioblastoma derived (atcc) passages <10 2.5 micromolar |
| GSE129757_0_v_1_tunicamycin_human | ln308 untreated (rna seq) cell line astrocytoma derived p53 deficient glial cells time 0 h vs ln308 tunicamycin (rna seq) cell line astrocytoma derived p53 deficient glial cells time h |
| GSE60217_1_v_2_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec umbilical vein endothelial cells passage 3 rnai scrambled nucleotides (scrambled human |
| GSE60217_1_v_8_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec scrambled hypoxia human umbilical vein endothelial cells passage 3 rnai nucleotides (scramble g) |
| GSE60217_1_v_7_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec siadar1 hypoxia human umbilical vein endothelial cells passage 3 rnai |
| GSE210225_0_v_1_inosine_mouse | 4t1 ntc cell line mouse breast cancer cells wt vs 4t1 ko cell line mouse breast cancer cells uba6 knockout |
| GSE60217_1_v_10_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec siadar1 basal human umbilical vein endothelial cells passage 3 rnai |
| GSE60217_1_v_9_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec scrambled basal human umbilical vein endothelial cells passage 3 rnai nucleotides (scramble g) |
| GSE60217_1_v_11_inosine_human | control peripheral blood mononuclear cells condition healthy human vs peripheral blood mononuclear cells condition chronic ischemic heart failure human |
| GSE60217_1_v_0_inosine_human | control peripheral blood mononuclear cells condition healthy human vs huvec umbilical vein endothelial cells passage 3 rnai human |
| GSE172020_0_v_3_testosterone_mouse | wt testosterone strain c57bl/6j kidney wild type vs lmon testosterone strain c57bl/6j kidney arlmon/ |
| GSE172020_0_v_2_testosterone_mouse | wt testosterone strain c57bl/6j kidney wild type vs lmon vehicle strain c57bl/6j kidney arlmon/ |
| GSE200502_0_v_1_testosterone_mouse | ovary control post biol rep strain c57bl/6nhsd age (weeks) time cessation vs ovary biol rep strain c57bl/6nhsd age (weeks) testosterone time |
| GSE207582_4_v_3_testosterone_mouse | wt orx + v prostate wild type vehicle vs noc orx + prostate arnoc/ testosterone |
| GSE172020_1_v_2_testosterone_mouse | wt vehicle strain c57bl/6j kidney wild type vs lmon vehicle strain c57bl/6j kidney arlmon/ |
| GSE207582_2_v_3_testosterone_mouse | wt orx + prostate wild type testosterone vs noc orx + prostate arnoc/ testosterone |
| GSE200502_2_v_1_testosterone_mouse | ovary control biol rep strain c57bl/6nhsd age (weeks) 16 time week6 vs ovary biol rep strain c57bl/6nhsd age (weeks) testosterone time |
| GSE172020_1_v_3_testosterone_mouse | wt vehicle strain c57bl/6j kidney wild type vs lmon testosterone strain c57bl/6j kidney arlmon/ |
| GSE207582_2_v_1_testosterone_mouse | wt orx + prostate wild type testosterone vs noc orx + v prostate arnoc/ vehicle |
| GSE111061_1_v_3_tofacitinib_human | aab n status normal control scalp skin vs 24 status aa 24wks scalp skin |
| GSE111061_1_v_0_tofacitinib_human | aab n status normal control scalp skin vs 00 status aa pre scalp skin |
| GSE165636_0_v_4_tofacitinib_human | un untreated human lymphatic endothelial cells (hlec) vs t50 vitro treated tofacitinib human lymphatic endothelial cells (hlec) |
| GSE185519_6_v_7_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs 48hr scrambled cell line molm13 shrna gilteritinib time |
| GSE185519_4_v_5_gilteritinib_human | 48hr shcdk9 cell line molm13 dmso time vs 48hr shcdk9 cell line molm13 gilteritinib time |
| GSE185519_4_v_2_gilteritinib_human | 48hr shcdk9 cell line molm13 dmso time vs dhodh cell line molm13 shdhodh gilteritinib time 96hr |
| GSE185519_3_v_2_gilteritinib_human | dhodh cell line molm13 shdhodh dmso time 96hr vs dhodh cell line molm13 shdhodh gilteritinib time 96hr |
| GSE185519_6_v_5_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs 48hr shcdk9 cell line molm13 gilteritinib time |
| GSE185519_1_v_7_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs 48hr scrambled cell line molm13 shrna gilteritinib time |
| GSE185519_4_v_0_gilteritinib_human | 48hr shcdk9 cell line molm13 dmso time vs scrambled gilteritinib cell line molm13 shrna time 96hr |
| GSE185519_3_v_5_gilteritinib_human | dhodh cell line molm13 shdhodh dmso time 96hr vs 48hr shcdk9 cell line molm13 gilteritinib time |
| GSE185519_1_v_2_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs dhodh cell line molm13 shdhodh gilteritinib time 96hr |
| GSE185519_6_v_0_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs scrambled gilteritinib cell line molm13 shrna time 96hr |
| GSE185519_4_v_7_gilteritinib_human | 48hr shcdk9 cell line molm13 dmso time vs 48hr scrambled cell line molm13 shrna gilteritinib time |
| GSE185519_3_v_0_gilteritinib_human | dhodh cell line molm13 shdhodh dmso time 96hr vs scrambled gilteritinib cell line molm13 shrna time 96hr |
| GSE185519_3_v_7_gilteritinib_human | dhodh cell line molm13 shdhodh dmso time 96hr vs 48hr scrambled cell line molm13 shrna gilteritinib time |
| GSE185519_6_v_2_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs dhodh cell line molm13 shdhodh gilteritinib time 96hr |
| GSE185519_1_v_5_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs 48hr shcdk9 cell line molm13 gilteritinib time |
| GSE185519_1_v_0_gilteritinib_human | scrambled cell line molm13 shrna dmso time vs scrambled gilteritinib cell line molm13 shrna time 96hr |
| GSE248858_4_v_7_tcpobop_mouse | vehicle 8wk male liver strain crl cd1(icr) age euthanasia 15 16 weeks sex control 8 wk dosing regimen high corn oil vs tcpobop 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE95685_4_v_5_tcpobop_mouse | female liver h vehicle g123 strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h tcpobop g123 mouse strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE248858_4_v_2_tcpobop_mouse | vehicle 8wk male liver strain crl cd1(icr) age euthanasia 15 16 weeks sex control 8 wk dosing regimen high corn oil vs tcpobop 8wk male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen low corn oil |
| GSE95685_6_v_5_tcpobop_mouse | liver h vehicle g123 mouse strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h tcpobop g123 mouse strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE95685_6_v_0_tcpobop_mouse | liver h vehicle g123 mouse strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs female liver 3 h tcpobop g123 strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE248858_4_v_3_tcpobop_mouse | vehicle 8wk male liver strain crl cd1(icr) age euthanasia 15 16 weeks sex control 8 wk dosing regimen high corn oil vs tcpobop 2wk female lowcornoil liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE248858_1_v_2_tcpobop_mouse | vehicle male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia weeks sex control 4 8 wk dosing regimen low corn oil vs tcpobop 8wk male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen low corn oil |
| GSE248858_6_v_3_tcpobop_mouse | vehicle 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 2wk female lowcornoil liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE95685_2_v_3_tcpobop_mouse | male liver 3 h vehicle g95 (control pcn treatments) strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h pcn g95 strain cd 1 (charles river) 50 mg/kg sex age 7 weeks nuclei |
| GSE248858_5_v_7_tcpobop_mouse | vehicle 2wk female lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE248858_1_v_7_tcpobop_mouse | vehicle male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia weeks sex control 4 8 wk dosing regimen low corn oil vs tcpobop 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE248858_1_v_3_tcpobop_mouse | vehicle male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia weeks sex control 4 8 wk dosing regimen low corn oil vs tcpobop 2wk female lowcornoil liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE95685_2_v_5_tcpobop_mouse | male liver 3 h vehicle g95 (control pcn treatments) strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h tcpobop g123 mouse strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE248858_5_v_3_tcpobop_mouse | vehicle 2wk female lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 2wk female lowcornoil liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE248858_4_v_0_tcpobop_mouse | vehicle 8wk male liver strain crl cd1(icr) age euthanasia 15 16 weeks sex control 8 wk dosing regimen high corn oil vs tcpobop 8wk male highcornoil [g184 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen high corn oil |
| GSE248858_5_v_0_tcpobop_mouse | vehicle 2wk female lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 8wk male highcornoil [g184 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen high corn oil |
| GSE248858_6_v_0_tcpobop_mouse | vehicle 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 8wk male highcornoil [g184 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen high corn oil |
| GSE95685_2_v_0_tcpobop_mouse | male liver 3 h vehicle g95 (control pcn treatments) strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs female liver 3 h tcpobop g123 strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE95685_6_v_3_tcpobop_mouse | liver h vehicle g123 mouse strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h pcn g95 strain cd 1 (charles river) 50 mg/kg sex age 7 weeks nuclei |
| GSE248858_6_v_7_tcpobop_mouse | vehicle 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex (3 mg/kg .p.) 2 wk dosing regimen low corn oil |
| GSE248858_6_v_2_tcpobop_mouse | vehicle 2wk male lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 8wk male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen low corn oil |
| GSE186654_0_v_3_tcpobop_mouse | humanized control [hcar veh strain pxr car cyp3a4/3a7 vehicle (2% dmso corn oil) liver vs humanized treated [hcar tcpobop strain pxr car cyp3a4/3a7 3mg/kg liver |
| GSE186654_2_v_3_tcpobop_mouse | wild type control [wt veh strain c57bl/6 ntac vehicle (2% dmso corn oil) liver vs humanized treated [hcar tcpobop strain pxr car cyp3a4/3a7 3mg/kg liver |
| GSE186654_1_v_3_tcpobop_mouse | wild type treated [wt tcpobop strain c57bl/6 ntac 3mg/kg liver vs humanized treated [hcar tcpobop strain pxr car cyp3a4/3a7 3mg/kg liver |
| GSE248858_5_v_2_tcpobop_mouse | vehicle 2wk female lowcornoil [g184 liver strain crl cd1(icr) age euthanasia 9 10 weeks sex control 2 wk dosing regimen low corn oil vs tcpobop 8wk male lowcornoil [g186 liver strain crl cd1(icr) age euthanasia 15 16 weeks sex (3 mg/kg .p.) 8 wk dosing regimen low corn oil |
| GSE95685_4_v_3_tcpobop_mouse | female liver h vehicle g123 strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs male liver 3 h pcn g95 strain cd 1 (charles river) 50 mg/kg sex age 7 weeks nuclei |
| GSE95685_4_v_0_tcpobop_mouse | female liver h vehicle g123 strain cd 1 (charles river) (1% dmso corn oil) sex age 7 weeks nuclei vs female liver 3 h tcpobop g123 strain cd 1 (charles river) mg/kg sex age 7 weeks nuclei |
| GSE149901_3_v_0_anlotinib_human | intrahepatic cholangiocarcinoma cell line hccc9810 drug control vs intrahepatic cholangiocarcinoma cell line hccc9810 drug anlotinib 5î¼m |
| GSE149901_2_v_0_anlotinib_human | intrahepatic cholangiocarcinoma cell line rbe drug control vs intrahepatic cholangiocarcinoma cell line hccc9810 drug anlotinib 5î¼m |
| GSE149901_3_v_1_anlotinib_human | intrahepatic cholangiocarcinoma cell line hccc9810 drug control vs intrahepatic cholangiocarcinoma cell line rbe drug anlotinib 5î¼m |
| GSE149901_2_v_1_anlotinib_human | intrahepatic cholangiocarcinoma cell line rbe drug control vs intrahepatic cholangiocarcinoma cell line rbe drug anlotinib 5î¼m |
| GSE193258,GSE193259_2_v_3_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc827 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE193258,GSE193259_9_v_14_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc827 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_5_v_15_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc2935 short washout [rna seq] cell line osimertinib dtps 24 hrs. |
| GSE193258,GSE193259_9_v_8_osimertinib_human | hcc827 dmso [rna seq] cell line vs h1975 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_2_v_4_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc827 washout [rna seq] cell line osimertinib dtps hrs. |
| GSE193258,GSE193259_5_v_13_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc2935 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE193258,GSE193259_2_v_12_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc2935 long washout 10d [rna seq] cell line osimertinib dtps 10 days |
| GSE193258,GSE193259_5_v_12_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc2935 long washout 10d [rna seq] cell line osimertinib dtps 10 days |
| GSE193258,GSE193259_2_v_0_osimertinib_human | hcc2935 dmso [rna seq] cell line vs pc9 washout [rna seq] cell line osimertinib dtps |
| GSE193258,GSE193259_9_v_3_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc827 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE193258,GSE193259_5_v_1_osimertinib_human | pc9 dmso [rna seq] cell line vs h1975 long washout 72h [rna seq] cell line osimertinib dtps 72 hrs. |
| GSE193258,GSE193259_2_v_8_osimertinib_human | hcc2935 dmso [rna seq] cell line vs h1975 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_5_v_6_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc2935 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE217405_0_v_1_osimertinib_mouse | megfr dmso cell line lung adenocarcinoma egfr mutant exon deletion 19 time vs megfr l860r.1 100nm osimertinib cell line lung adenocarcinoma egfr mutant l860r missense mutation time |
| GSE193258,GSE193259_5_v_8_osimertinib_human | pc9 dmso [rna seq] cell line vs h1975 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_5_v_14_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc827 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_2_v_6_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc2935 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE217405_3_v_2_osimertinib_mouse | megfr l860r.1 dmso cell line lung adenocarcinoma egfr mutant l860r missense mutation time vs megfr 100nm osimertinib cell line lung adenocarcinoma egfr mutant exon deletion 19 time |
| GSE193258,GSE193259_5_v_3_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc827 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE193258,GSE193259_2_v_1_osimertinib_human | hcc2935 dmso [rna seq] cell line vs h1975 long washout 72h [rna seq] cell line osimertinib dtps 72 hrs. |
| GSE193258,GSE193259_9_v_4_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc827 washout [rna seq] cell line osimertinib dtps hrs. |
| GSE193258,GSE193259_2_v_13_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc2935 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE217405_0_v_2_osimertinib_mouse | megfr dmso cell line lung adenocarcinoma egfr mutant exon deletion 19 time vs megfr 100nm osimertinib cell line lung adenocarcinoma egfr mutant exon deletion 19 time |
| GSE193258,GSE193259_2_v_14_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc827 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_9_v_15_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc2935 short washout [rna seq] cell line osimertinib dtps 24 hrs. |
| GSE193258,GSE193259_9_v_13_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc2935 osi dtp [rna seq] cell line osimertinib dtps 3w. |
| GSE193258,GSE193259_5_v_4_osimertinib_human | pc9 dmso [rna seq] cell line vs hcc827 washout [rna seq] cell line osimertinib dtps hrs. |
| GSE193258,GSE193259_2_v_15_osimertinib_human | hcc2935 dmso [rna seq] cell line vs hcc2935 short washout [rna seq] cell line osimertinib dtps 24 hrs. |
| GSE193258,GSE193259_9_v_0_osimertinib_human | hcc827 dmso [rna seq] cell line vs pc9 washout [rna seq] cell line osimertinib dtps |
| GSE193258,GSE193259_5_v_0_osimertinib_human | pc9 dmso [rna seq] cell line vs pc9 washout [rna seq] cell line osimertinib dtps |
| GSE193258,GSE193259_9_v_6_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc2935 osi acute [rna seq] cell line osimertinib 24 hrs. |
| GSE193258,GSE193259_9_v_12_osimertinib_human | hcc827 dmso [rna seq] cell line vs hcc2935 long washout 10d [rna seq] cell line osimertinib dtps 10 days |
| GSE193258,GSE193259_9_v_1_osimertinib_human | hcc827 dmso [rna seq] cell line vs h1975 long washout 72h [rna seq] cell line osimertinib dtps 72 hrs. |
| GSE217405_3_v_1_osimertinib_mouse | megfr l860r.1 dmso cell line lung adenocarcinoma egfr mutant l860r missense mutation time vs megfr l860r.1 100nm osimertinib cell line lung adenocarcinoma egfr mutant l860r missense mutation time |
| GSE235587_2_v_1_mitoxantrone_human | kyse70 without replicate cell line esophageal squamous carcinoma cells control human (kyse70) vs kyse70 treated 20 nm mitoxantrone replicate cell line esophageal squamous carcinoma cells human (kyse70) |
| GSE235587_2_v_0_mitoxantrone_human | kyse70 without replicate cell line esophageal squamous carcinoma cells control human (kyse70) vs kyse70 treated 10 âµm pyrimethamine replicate cell line esophageal squamous carcinoma cells human (kyse70) |
| GSE186471_1_v_0_carnosol_human | normal human retinal microvascular endothelial cells untreated retina vs carnosol human retinal microvascular endothelial cells 10 î¼m retina |
| GSE186471_1_v_2_carnosol_human | normal human retinal microvascular endothelial cells untreated retina vs model human retinal microvascular endothelial cells 300 î¼m bhp retina |
| GSE255432_6_v_2_imeglimin_mouse | liver hfd control c57bl/6n vs swat ime c57bl/6n hfd+ime |
| GSE255432_7_v_0_imeglimin_mouse | bat hfd control c57bl/6n vs bat ime c57bl/6n hfd+ime |
| GSE255432_6_v_0_imeglimin_mouse | liver hfd control c57bl/6n vs bat ime c57bl/6n hfd+ime |
| GSE255432_7_v_3_imeglimin_mouse | bat hfd control c57bl/6n vs liver hfd ime c57bl/6n hfd+ime |
| GSE255432_4_v_0_imeglimin_mouse | swat hfd control c57bl/6n vs bat ime c57bl/6n hfd+ime |
| GSE255432_4_v_3_imeglimin_mouse | swat hfd control c57bl/6n vs liver hfd ime c57bl/6n hfd+ime |
| GSE255432_7_v_2_imeglimin_mouse | bat hfd control c57bl/6n vs swat ime c57bl/6n hfd+ime |
| GSE219154_4_v_2_aspirin_human | healthy /timpoint pbmc subject status nsaid tolerant control vs postdose /timpoint pbmc subject status niua |
| GSE163282_12_v_10_aspirin_human | colon organoid sex ctl pair age center uva smokingstatus never vs colon organoid sex case pair age l center uva smokingstatus never |
| GSE163282_12_v_2_aspirin_human | colon organoid sex ctl pair age center uva smokingstatus never vs colon organoid sex case pair age l center uva smokingstatus |
| GSE163282_0_v_8_aspirin_human | colon organoid sex ctl pair age l center mgh smokingstatus vs colon organoid sex case pair age r center uva smokingstatus |
| GSE163282_0_v_2_aspirin_human | colon organoid sex ctl pair age l center mgh smokingstatus vs colon organoid sex case pair age l center uva smokingstatus |
| GSE163282_12_v_5_aspirin_human | colon organoid sex ctl pair age center uva smokingstatus never vs colon organoid sex case pair age l center mgh smokingstatus |
| GSE163282_1_v_10_aspirin_human | colon organoid sex ctl pair age r center uva smokingstatus vs colon organoid sex case pair age l center uva smokingstatus never |
| GSE163282_7_v_5_aspirin_human | colon organoid sex ctl pair age l center uva smokingstatus vs colon organoid sex case pair age l center mgh smokingstatus |
| GSE163282_12_v_8_aspirin_human | colon organoid sex ctl pair age center uva smokingstatus never vs colon organoid sex case pair age r center uva smokingstatus |
| GSE163282_1_v_5_aspirin_human | colon organoid sex ctl pair age r center uva smokingstatus vs colon organoid sex case pair age l center mgh smokingstatus |
| GSE198434_1_v_0_aspirin_human | sk rna dmso sample type organoid rectosigmoid mucosa 24 hrs colonic vs sk rna asa sample type organoid rectosigmoid mucosa 24 hrs colonic |
| GSE219154_4_v_9_aspirin_human | healthy /timpoint pbmc subject status nsaid tolerant control vs postdose /timpoint pbmc subject status niua |
| GSE163282_0_v_5_aspirin_human | colon organoid sex ctl pair age l center mgh smokingstatus vs colon organoid sex case pair age l center mgh smokingstatus |
| GSE216018_0_v_1_propafenone_human | dmso conjunctival cell line cm as16 cells vs propafenone 20 î¼m conjunctival cell line cm as16 cells |
| GSE164521_0_v_1_nitric oxide_mouse | strain background c57bl/6j /variation wild type age 4 weeks lung unexposed mice vs strain background c57bl/6j /variation triply n//enoss / age 4 weeks lung unexposed mice |
| GSE235994_1_v_2_nitric oxide_mouse | wild type heart pbs vs mcm8 ko heart lcwe knockout stimulation |
| GSE189336_1_v_0_nitric oxide_human | diagnosis healthy control laryngotracheal swab human vs diagnosis subglottic stenosis (sgs) laryngotracheal swab human |
| GSE155852_0_v_1_apigenin_mouse | mefs untreated replica agent developmental stage embryonic treated 24 hours mouse fibroblasts vs mefs apigenin treated replica agent 50 microm developmental stage embryonic 24 hours mouse fibroblasts |
| GSE155852_0_v_2_apigenin_mouse | mefs untreated replica agent developmental stage embryonic treated 24 hours mouse fibroblasts vs mefs chrysin treated replica agent 50 microm developmental stage embryonic 24 hours mouse fibroblasts |
| GSE174740_2_v_1_sunitinib_human | jan 21 cell line caki1 sr human clear renal skin metastasis ctrl (24h) vs cell line caki1 sr human clear renal skin metastasis odc |
| GSE203485_1_v_0_sunitinib_human | 786 cells control kidney cell line renal cancer wt vs 786 cells sizdhhc2 kidney cell line renal cancer zdhhc2 knockdown |
| GSE183323_1_v_0_caffeine_mouse | hippocampal neurons wildtype strain c57bl/6j sorted vs hippocampal neurons app transgenic strain c57bl/6j overexpressing human abeta4 42 sorted |
| GSE183323_1_v_2_caffeine_mouse | hippocampal neurons wildtype strain c57bl/6j sorted vs hippocampal neurons app transgenic strain c57bl/6j overexpressing human abeta4 42 caffeine sorted |
| GSE128563_2_v_3_venetoclax_human | oci ly1 control cell line (non targeting sgrnas) vs oci ly1 nfkbia cell line knocked |
| GSE128563_2_v_5_venetoclax_human | oci ly1 control cell line (non targeting sgrnas) vs oci ly1 ep300 cell line knocked |
| GSE125403_3_v_0_venetoclax_human | molm 13 sgrosa d6 rna seq cell line human acute myeloid leukemia (aml) cells day 6 post transduction /variation clpb wild type cas9 dbsd vs molm 13 sgclpb#2 rna seq cell line human acute myeloid leukemia (aml) cells day post transduction /variation clpb knockout cas9 dbsd |
| GSE128563_2_v_1_venetoclax_human | oci ly1 control cell line (non targeting sgrnas) vs oci ly1 cell line knocked |
| GSE125403_7_v_6_venetoclax_human | molm 13 sgrosa d8 rna seq cell line human acute myeloid leukemia (aml) cells day 8 post transduction /variation clpb wild type cas9 dbsd vs molm 13 sgclpb#1 rna seq cell line human acute myeloid leukemia (aml) cells day post transduction /variation clpb knockout cas9 dbsd |
| GSE172189_0_v_1_venetoclax_human | kg 1 control [kha101520 cell line human acute myeloid leukemia /variation vs kg 1 shfoxm1 [kha101520 cell line human acute myeloid leukemia /variation |
| GSE125403_3_v_6_venetoclax_human | molm 13 sgrosa d6 rna seq cell line human acute myeloid leukemia (aml) cells day 6 post transduction /variation clpb wild type cas9 dbsd vs molm 13 sgclpb#1 rna seq cell line human acute myeloid leukemia (aml) cells day post transduction /variation clpb knockout cas9 dbsd |
| GSE231745_1_v_0_venetoclax_human | molm13 venetoclax cells untreated peripheral blood cell line ven acute myeloid leukemia flt3 itd none vs molm13 venetoclax cells treated cdk7 inhibitor peripheral blood cell line ven acute myeloid leukemia flt3 itd |
| GSE159906_1_v_0_venetoclax_human | vehicle rep b cell non hodgkin lymphoma line untreated molecule rna oci ly1 cells vs sbi 756 rep b cell non hodgkin lymphoma line treated 4 hours molecule rna oci ly1 cells |
| GSE128563_2_v_6_venetoclax_human | oci ly1 control cell line (non targeting sgrnas) vs oci ly1 otud5 cell line knocked |
| GSE164483_2_v_3_venetoclax_mouse | cd8+ control naive cells strain b6.cg foxp3tm2tch/j (foxp3 ires gfp) vehicle cell vs cd8+ venetoclax naive cells strain b6.cg foxp3tm2tch/j (foxp3 ires gfp) cell |
| GSE164483_2_v_0_venetoclax_mouse | cd8+ control naive cells strain b6.cg foxp3tm2tch/j (foxp3 ires gfp) vehicle cell vs cd4+ venetoclax naive cells strain b6.cg foxp3tm2tch/j (foxp3 ires gfp) cell |
| GSE163227,GSE163229_1_v_0_venetoclax_human | rna seq mll af4 derived xenograft cells control lymphoblasts (cd19+) spleen vehicle (60percent phosal 50pg 30percent peg400 10percent ethanol âx80x93 oral gavage) 3 weeks af4+ acute lymphoblastic leukemia vs rna seq mll af4 derived xenograft cells ven lymphoblasts (cd19+) spleen 100 mg/kg venetoclax (oral gavage) 3 weeks af4+ acute lymphoblastic leukemia |
| GSE125403_7_v_0_venetoclax_human | molm 13 sgrosa d8 rna seq cell line human acute myeloid leukemia (aml) cells day 8 post transduction /variation clpb wild type cas9 dbsd vs molm 13 sgclpb#2 rna seq cell line human acute myeloid leukemia (aml) cells day post transduction /variation clpb knockout cas9 dbsd |
| GSE68925_1_v_0_fasudil_human | rna seq donor index blood normal cd34+ hspcs hematopoietic stem/progenitor cells vs rna seq donor index blood disease aml fab subtype m1 leukemic blasts |
| GSE192689_0_v_3_ricin_mouse | gm csf cultured bone marrow derived cells untreated control strain c57bl/6n condition vs gm csf cultured bone marrow derived cells beauvericin strain c57bl/6n condition 4h |
| GSE199606_1_v_4_ricin_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_2_v_0_ricin_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_6_v_4_ricin_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE192689_0_v_1_ricin_mouse | gm csf cultured bone marrow derived cells untreated control strain c57bl/6n condition vs gm csf cultured bone marrow derived cells beauvericin lps strain c57bl/6n condition beauvericin+lps 4h |
| GSE199606_3_v_0_ricin_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_6_v_7_ricin_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE192689_0_v_2_ricin_mouse | gm csf cultured bone marrow derived cells untreated control strain c57bl/6n condition vs gm csf cultured bone marrow derived cells lps strain c57bl/6n condition 4h |
| GSE199606_3_v_7_ricin_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_3_v_4_ricin_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_5_v_7_ricin_mouse | wt 72h lung sex female strain c57bl/6n treated ricin time (h) 72 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_1_v_0_ricin_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_5_v_4_ricin_mouse | wt 72h lung sex female strain c57bl/6n treated ricin time (h) 72 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_5_v_0_ricin_mouse | wt 72h lung sex female strain c57bl/6n treated ricin time (h) 72 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_6_v_0_ricin_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_1_v_7_ricin_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_2_v_7_ricin_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_2_v_4_ricin_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE129811_1_v_0_niacin_human | 4m individual disease state (study group) healthy control wt niacin time 4 months vastus lateralis muscle vs individual disease state (study group) mitochondrial myopathy twinkle mutation niacin time months vastus lateralis muscle |
| GSE129811_1_v_3_niacin_human | 4m individual disease state (study group) healthy control wt niacin time 4 months vastus lateralis muscle vs individual disease state (study group) mitochondrial myopathy single mtdna deletion niacin time months vastus lateralis muscle |
| GSE129811_5_v_0_niacin_human | 4m individual disease state (study group) healthy control wt niacin time 4 months vastus lateralis muscle vs individual disease state (study group) mitochondrial myopathy twinkle mutation niacin time months vastus lateralis muscle |
| GSE129811_2_v_0_niacin_human | 0m individual disease state (study group) healthy control wt time 0 months vastus lateralis muscle vs individual disease state (study group) mitochondrial myopathy twinkle mutation niacin time months vastus lateralis muscle |
| GSE129811_4_v_0_niacin_human | 0m individual disease state (study group) healthy control wt time 0 months vastus lateralis muscle vs individual disease state (study group) mitochondrial myopathy twinkle mutation niacin time months vastus lateralis muscle |
| GSE79291_1_v_2_streptozotocin_mouse | sample j2 (glomerular control) strain c57bl/6 glomerulus agent control disease state glomerular vs sample (podocyte strain c57bl/6 podocyte agent disease state |
| GSE79291_1_v_0_streptozotocin_mouse | sample j2 (glomerular control) strain c57bl/6 glomerulus agent control disease state glomerular vs sample (glomerular stz) strain c57bl/6 glomerulus agent stz disease state diabetes glomerular |
| GSE211983_1_v_3_nicotine_mouse | wt n brain wildtype c57bl6/j nicotine vs dko n brain ps1/ps2 nicotine |
| GSE186660_2_v_3_nicotine_mouse | ctr developmental stage strain icr control embryo vs nic developmental stage strain icr nicotine treated embryo |
| GSE196184_2_v_0_nicotine_mouse | wt air strain c57bl/6j thoracic aorta age 8 month wild type control vs a7 ko nicotine strain c57bl/6j thoracic aorta age 8 month alpha7 nachr knockout inhaled |
| GSE211983_0_v_2_nicotine_mouse | wt b brain wildtype c57bl6/j water vs dko b brain ps1/ps2 water |
| GSE211983_0_v_3_nicotine_mouse | wt b brain wildtype c57bl6/j water vs dko n brain ps1/ps2 nicotine |
| GSE186660_2_v_1_nicotine_mouse | ctr developmental stage strain icr control embryo vs nic mor developmental stage morula strain icr nicotine treated embryo |
| GSE211983_1_v_2_nicotine_mouse | wt n brain wildtype c57bl6/j nicotine vs dko b brain ps1/ps2 water |
| GSE205730,GSE205731_2_v_0_tazemetostat_human | sum149pt dmso rep cell line breast cancer vs sum149pt ipatasertib rep cell line breast cancer |
| GSE205730,GSE205731_2_v_3_tazemetostat_human | sum149pt dmso rep cell line breast cancer vs sum149pt tazemetostat rep cell line breast cancer |
| GSE205729,GSE205731_2_v_0_tazemetostat_human | mda mb 468 dmso rep cell line breast cancer vs mda mb 468 tazemetostat rep cell line breast cancer |
| GSE205729,GSE205731_2_v_3_tazemetostat_human | mda mb 468 dmso rep cell line breast cancer vs mda mb 468 combo cell line breast cancer tazemetostat + ipatasertib |
| GSE205729,GSE205731_2_v_1_tazemetostat_human | mda mb 468 dmso rep cell line breast cancer vs mda mb 468 ipatasertib rep cell line breast cancer |
| GSE205730,GSE205731_2_v_1_tazemetostat_human | sum149pt dmso rep cell line breast cancer vs sum149pt combo rep cell line breast cancer tazemetostat + ipatasertib |
| GSE222758_0_v_4_clofazimine_human | u2os wt cfz cell line osteosarcoma cells time day 8 vs u2os pq d8 cell line osteosarcoma cells polyq rexpressing nt time day 8 |
| GSE222758_0_v_3_clofazimine_human | u2os wt cfz cell line osteosarcoma cells time day 8 vs u2os pq nt cell line osteosarcoma cells polyq rexpressing time day 8 |
| GSE222758_0_v_1_clofazimine_human | u2os wt cfz cell line osteosarcoma cells time day 8 vs u2os pq d1 1 cell line osteosarcoma cells polyq rexpressing nt time day |
| GSE222758_0_v_2_clofazimine_human | u2os wt cfz cell line osteosarcoma cells time day 8 vs u2os pq cfz cell line osteosarcoma cells polyq rexpressing time day 8 |
| GSE62843,GSE64370_4_v_3_furan_mouse | liver control ffpe3wk ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan freshfrozen ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_2_v_5_furan_mouse | liver control ffpe18h polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe3wk polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64370_4_v_1_furan_mouse | liver control ffpe3wk ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe18h ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64370_0_v_3_furan_mouse | liver control ffpe18h ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan freshfrozen ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_2_v_3_furan_mouse | liver control ffpe18h polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan freshfrozen polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_4_v_5_furan_mouse | liver control ffpe3wk polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe3wk polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_4_v_3_furan_mouse | liver control ffpe3wk polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan freshfrozen polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_2_v_0_furan_mouse | liver control ffpe18h polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe18h polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64370_4_v_5_furan_mouse | liver control ffpe3wk ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe3wk ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64371_4_v_0_furan_mouse | liver control ffpe3wk polya rnaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe18h polya rnaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64370_0_v_1_furan_mouse | liver control ffpe18h ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe18h ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE62843,GSE64370_0_v_5_furan_mouse | liver control ffpe18h ribornaseq strain b6c3f1 gender female age 5 6 weeks vs liver 8mkd furan ffpe3wk ribornaseq strain b6c3f1 gender female age 5 6 weeks |
| GSE226249_2_v_7_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf3 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE199034_1_v_0_pirfenidone_mouse | total lung rna isolated control mice treated vehicle agent lungs vs total lung rna isolated tgfalpha mice dox 6weeks treated pirfenidone agent lungs |
| GSE226249_0_v_8_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf3 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_5_v_1_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf2 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE199034_1_v_2_pirfenidone_mouse | total lung rna isolated control mice treated vehicle agent lungs vs total lung rna isolated tgfalpha mice dox 6weeks treated vehicle agent lungs |
| GSE226249_0_v_6_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf2 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE226249_0_v_3_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf3 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE226249_5_v_3_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf3 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE226249_0_v_7_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf3 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE226249_2_v_4_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf2 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_2_v_6_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf2 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE226249_2_v_1_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf2 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE226249_0_v_1_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf2 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE226249_5_v_8_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf3 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_0_v_4_pirfenidone_human | n1 sf lung disease state normal fibroblast serum free dmem medium human fibroblasts vs pf2 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_2_v_8_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf3 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_5_v_7_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf3 fbs lung disease state pulmonary fibrosis fibroblast 20% fibroblasts |
| GSE226249_5_v_4_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf2 pfd lung disease state pulmonary fibrosis fibroblast 20% fbs plus 1mm pirfenidone fibroblasts |
| GSE226249_5_v_6_pirfenidone_human | n1 pfd lung disease state normal fibroblast 20% fbs plus 1mm pirfenidone human fibroblasts vs pf2 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE226249_2_v_3_pirfenidone_human | n1 fbs lung disease state normal fibroblast 20% human fibroblasts vs pf3 sf lung disease state pulmonary fibrosis fibroblast serum free dmem medium fibroblasts |
| GSE164505,GSE164506_3_v_1_indisulam_human | be2c wt cell line vs sima xenograft tumor |
| GSE164505,GSE164506_3_v_2_indisulam_human | be2c wt cell line vs sknas 002 |
| GSE181492_1_v_0_chrysin_human | untreated sgc7901 cells gastric cancer none cell line vs sgc7901 cells treated chrysin gastric cancer 40um 48h cell line |
| GSE48812_9_v_6_sulforaphane_human | lncap 24 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_2_v_5_sulforaphane_human | lncap 6 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_4_v_6_sulforaphane_human | prec 6 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_11_v_1_sulforaphane_human | pc3 6 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_11_v_5_sulforaphane_human | pc3 6 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_0_v_6_sulforaphane_human | pc3 24 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_7_v_5_sulforaphane_human | prec 6 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_7_v_10_sulforaphane_human | prec 6 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_8_v_5_sulforaphane_human | prec 24 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_11_v_6_sulforaphane_human | pc3 6 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_9_v_10_sulforaphane_human | lncap 24 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_0_v_1_sulforaphane_human | pc3 24 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_2_v_10_sulforaphane_human | lncap 6 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_2_v_1_sulforaphane_human | lncap 6 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_4_v_5_sulforaphane_human | prec 6 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_7_v_6_sulforaphane_human | prec 6 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_0_v_5_sulforaphane_human | pc3 24 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_4_v_1_sulforaphane_human | prec 6 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_4_v_10_sulforaphane_human | prec 6 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_8_v_6_sulforaphane_human | prec 24 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_9_v_5_sulforaphane_human | lncap 24 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_7_v_1_sulforaphane_human | prec 6 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_3_v_10_sulforaphane_human | prec 24 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_8_v_1_sulforaphane_human | prec 24 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_11_v_10_sulforaphane_human | pc3 6 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_3_v_5_sulforaphane_human | prec 24 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs lncap 24 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_3_v_1_sulforaphane_human | prec 24 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_8_v_10_sulforaphane_human | prec 24 hours dmso rep normal prostate epithelial cells (prec) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_9_v_1_sulforaphane_human | lncap 24 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 6 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE127252_2_v_3_sulforaphane_mouse | con cell line b16f10 melanoma dmso control vs dac sfn cell line b16f10 melanoma + |
| GSE48812_0_v_10_sulforaphane_human | pc3 24 hours dmso rep androgen independent prostate cancer epithelial cells (pc 3) treated dimethyl sulfoxide (dmso vehicle control) hrs vs pc3 24 hours sfn rep androgen independent prostate cancer epithelial cells (pc 3) treated sulforaphane (sfn) hrs |
| GSE48812_2_v_6_sulforaphane_human | lncap 6 hours dmso rep androgen dependent prostate cancer epithelial cells (lncap) treated dimethyl sulfoxide (dmso vehicle control) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE48812_3_v_6_sulforaphane_human | prec 24 hours sfn rep normal prostate epithelial cells (prec) treated sulforaphane (sfn) hrs vs lncap 6 hours sfn rep androgen dependent prostate cancer epithelial cells (lncap) treated sulforaphane (sfn) hrs |
| GSE166920_6_v_8_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng tnf ada m0 macropahges lps+ifng+tnf+adalimumab peripheral blood mononuclear cells (pbmc) |
| GSE166920_6_v_3_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng tnf etan m0 macropahges lps+ifng+tnf+etanercept peripheral blood mononuclear cells (pbmc) |
| GSE166920_6_v_5_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng tnf igg m0 macropahges lps+ifng+tnf+igg peripheral blood mononuclear cells (pbmc) |
| GSE166920_6_v_1_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng tnf cert m0 macropahges lps+ifng+tnf+certolizumab peripheral blood mononuclear cells (pbmc) |
| GSE166920_6_v_4_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng tnf m0 macropahges lps+ifng+tnf peripheral blood mononuclear cells (pbmc) |
| GSE166920_6_v_2_adalimumab_human | m0 macropahges untreated peripheral blood mononuclear cells (pbmc) vs lps ifng m0 macropahges lps+ifng peripheral blood mononuclear cells (pbmc) |
| GSE137325_3_v_0_copanlisib_human | hairm dmso 4 hrs rep cell line hair hours replicate vs hairm copanlisib hrs rep cell line hair hours replicate |
| GSE137325_2_v_0_copanlisib_human | hairm dmso 12 hrs rep cell line hair hours replicate vs hairm copanlisib hrs rep cell line hair hours replicate |
| GSE164494_1_v_2_angiotensin ii_mouse | strain c57bl/6 abdominal aorta rab22 wt angiotensin ii group vs strain c57bl/6 abdominal aorta rab22a ko saline group |
| GSE206779_1_v_2_angiotensin ii_mouse | wt angii heart wild type 0.8 mg/kg/ vs het angii heart pkn2(komptm1a)+/ 0.8 mg/kg/ |
| GSE225447_1_v_0_angiotensin ii_mouse | control mice control] kidney ncr nude vs eic s120 mice s120] kidney ncr nude + |
| GSE225447_1_v_2_angiotensin ii_mouse | control mice control] kidney ncr nude vs eic s60 mice s60] kidney ncr nude + |
| GSE236454,GSE236456_0_v_1_angiotensin ii_mouse | cfs gfp heart mouse cardiac fibroblast wt ang ii vs cfs irx2 heart mouse cardiac fibroblast knockdown ang ii |
| GSE206779_1_v_3_angiotensin ii_mouse | wt angii heart wild type 0.8 mg/kg/ vs het veh heart pkn2(komptm1a)+/ vehicle (acidified pbs) |
| GSE141726,GSE141733_1_v_0_angiotensin ii_mouse | aortic sample disease normal aorta apolipoprotein e deficient (apoe / ) pbs perfusion 28 days vs aortic sample disease abdominal aneurysm apolipoprotein e deficient (apoe / ) angiotensin ii perfusion 28 days |
| GSE175683_1_v_2_angiotensin ii_mouse | strain c57bl/6 age 6 months old wild type group angii abdominal aorta vs strain c57bl/6 age 6 months old lysyl hydroxylase 1 knock group saline abdominal aorta |
| GSE175683_3_v_2_angiotensin ii_mouse | strain c57bl/6 age 6 months old wild type group saline abdominal aorta vs strain c57bl/6 age 6 months old lysyl hydroxylase 1 knock group saline abdominal aorta |
| GSE206779_4_v_2_angiotensin ii_mouse | wt veh heart wild type vehicle (acidified pbs) vs het angii heart pkn2(komptm1a)+/ 0.8 mg/kg/ |
| GSE164494_0_v_2_angiotensin ii_mouse | strain c57bl/6 abdominal aorta rab22 wt saline group vs strain c57bl/6 abdominal aorta rab22a ko saline group |
| GSE133286,GSE133299_1_v_0_tepoxalin_human | ls1034 dmso 6hr cell line colon cancer vs ls1034 12um tepoxalin 6hr cell line colon cancer |
| GSE151612_0_v_3_pracinostat_human | wsudlcl2 cell line dmso vs cell line |
| GSE151612_4_v_11_pracinostat_human | ocily1 cell line dmso vs sudhl4 14d cell line 14 days |
| GSE151612_4_v_2_pracinostat_human | ocily1 cell line dmso vs toledo 6hrs cell line 6 hours |
| GSE151612_4_v_7_pracinostat_human | ocily1 cell line dmso vs toledo 14d cell line 14 days |
| GSE151612_4_v_10_pracinostat_human | ocily1 cell line dmso vs pracino cell line pracinostat |
| GSE151612_0_v_11_pracinostat_human | wsudlcl2 cell line dmso vs sudhl4 14d cell line 14 days |
| GSE151612_0_v_8_pracinostat_human | wsudlcl2 cell line dmso vs pfeiffer cell line |
| GSE151612_0_v_7_pracinostat_human | wsudlcl2 cell line dmso vs toledo 14d cell line 14 days |
| GSE151612_0_v_2_pracinostat_human | wsudlcl2 cell line dmso vs toledo 6hrs cell line 6 hours |
| GSE151612_0_v_10_pracinostat_human | wsudlcl2 cell line dmso vs pracino cell line pracinostat |
| GSE151612_4_v_8_pracinostat_human | ocily1 cell line dmso vs pfeiffer cell line |
| GSE151612_4_v_3_pracinostat_human | ocily1 cell line dmso vs cell line |
| GSE100676_1_v_2_nitrate_human | human coronary artery smooth muscle cell passages 5 6 agent vehicle control hcasmc vs human coronary artery smooth muscle cell passages 5 6 agent cla hcasmc |
| GSE100676_1_v_0_nitrate_human | human coronary artery smooth muscle cell passages 5 6 agent vehicle control hcasmc vs no2 human coronary artery smooth muscle cell passages 5 6 agent cla hcasmc |
| GSE69244_2_v_0_j147_mouse | old samp8 strain samp8/tahsd brain age ten months control hippocampus vs old samp8 treated j147 strain samp8/tahsd brain age ten months hippocampus |
| GSE69244_1_v_0_j147_mouse | young samp8 control strain samp8/tahsd brain age three months old hippocampus vs old samp8 treated j147 strain samp8/tahsd brain age ten months hippocampus |
| GSE101112_0_v_4_j147_mouse | samp8 young mice brain hippocampal control age 9 months vs samp8 oldj147 mice brain hippocampal drugj147 age 13 months |
| GSE101112_0_v_2_j147_mouse | samp8 young mice brain hippocampal control age 9 months vs samp8 old121 mice brain hippocampal drug121 age 13 months |
| GSE166317_3_v_0_j147_mouse | 13month liver strain samp8 control age 13 month mice vs 13monthj147 liver strain samp8 drugj147 age 13 month mice |
| GSE166317_2_v_0_j147_mouse | 9month liver strain samp8 control age 9 month mice vs 13monthj147 liver strain samp8 drugj147 age 13 month mice |
| GSE101112_6_v_4_j147_mouse | samp8 old mice brain hippocampal control age 13 months vs samp8 oldj147 mice brain hippocampal drugj147 age 13 months |
| GSE228263_0_v_1_elesclomol_human | s4 cell line sudhl 4 dlbcl cells dmso 48h vs s4 cell line sudhl 4 dlbcl cells elesclomol es 48h |
| GSE228261_0_v_1_elesclomol_human | wsu cell line dlcl2 dlbcl cells dmso 48h vs wsu cell line dlcl2 dlbcl cells elesclomol es 48h |
| GSE202744_1_v_3_toyocamycin_human | dmso colorectal cell line yb5 time batch1 vs toyocamycin colorectal cell line yb5 time batch1 |
| GSE202744_1_v_0_toyocamycin_human | dmso colorectal cell line yb5 time batch1 vs toyocamycin colorectal cell line yb5 time |
| GSE85880,GSE85881_0_v_1_tretinoin_human | h1 c (rna seq) hesc derived cells cell line control differentiation time (days) vs c15 inn (rna seq) hipsc derived cells cell line differentiation time (days) |
| GSE85880,GSE85881_4_v_1_tretinoin_human | c15 c (rna seq) hipsc derived cells cell line control differentiation time (days) vs c15 inn (rna seq) hipsc derived cells cell line differentiation time (days) |
| GSE85880,GSE85881_4_v_2_tretinoin_human | c15 c (rna seq) hipsc derived cells cell line control differentiation time (days) vs h1 inn (rna seq) hesc derived cells cell line differentiation time (days) |
| GSE85880,GSE85881_0_v_2_tretinoin_human | h1 c (rna seq) hesc derived cells cell line control differentiation time (days) vs h1 inn (rna seq) hesc derived cells cell line differentiation time (days) |
| GSE94849_6_v_0_pinometostat_human | nomo 1 d10 ctrl cell line aml vs nomo 1 res cell line aml |
| GSE94849_6_v_4_pinometostat_human | nomo 1 d10 ctrl cell line aml vs kopn 8 resistant cell line aml |
| GSE94849_1_v_0_pinometostat_human | kopn 8 d28 ctrl cell line aml vs nomo 1 res cell line aml |
| GSE94849_7_v_5_pinometostat_human | kopn 8 d10 ctrl cell line aml vs nomo d10 treated cell line 1 aml |
| GSE94849_3_v_2_pinometostat_human | nomo res ctrl cell line 1 aml vs kopn 8 d10 treated cell line aml |
| GSE94849_3_v_0_pinometostat_human | nomo res ctrl cell line 1 aml vs nomo 1 res cell line aml |
| GSE94849_1_v_4_pinometostat_human | kopn 8 d28 ctrl cell line aml vs kopn 8 resistant cell line aml |
| GSE94849_3_v_5_pinometostat_human | nomo res ctrl cell line 1 aml vs nomo d10 treated cell line 1 aml |
| GSE94849_1_v_5_pinometostat_human | kopn 8 d28 ctrl cell line aml vs nomo d10 treated cell line 1 aml |
| GSE94849_3_v_4_pinometostat_human | nomo res ctrl cell line 1 aml vs kopn 8 resistant cell line aml |
| GSE94849_7_v_0_pinometostat_human | kopn 8 d10 ctrl cell line aml vs nomo 1 res cell line aml |
| GSE94849_7_v_2_pinometostat_human | kopn 8 d10 ctrl cell line aml vs kopn 8 d10 treated cell line aml |
| GSE94849_1_v_2_pinometostat_human | kopn 8 d28 ctrl cell line aml vs kopn 8 d10 treated cell line aml |
| GSE94849_6_v_2_pinometostat_human | nomo 1 d10 ctrl cell line aml vs kopn 8 d10 treated cell line aml |
| GSE94849_7_v_4_pinometostat_human | kopn 8 d10 ctrl cell line aml vs kopn 8 resistant cell line aml |
| GSE94849_6_v_5_pinometostat_human | nomo 1 d10 ctrl cell line aml vs nomo d10 treated cell line 1 aml |
| GSE245270_1_v_0_isoproterenol_human | hek293 cells wild type isoproterenol biol rep 1 cell line embryonic incubation time h vs hek293 cells î²arrestin1/2 ko basal biol rep 1 cell line embryonic {beta}arrestin1/2 knock incubation vehicle time h |
| GSE245270_2_v_0_isoproterenol_human | hek293 cells wild type basal biol rep 1 cell line embryonic incubation vehicle time h vs hek293 cells î²arrestin1/2 ko basal biol rep 1 cell line embryonic {beta}arrestin1/2 knock incubation vehicle time h |
| GSE245270_1_v_4_isoproterenol_human | hek293 cells wild type isoproterenol biol rep 1 cell line embryonic incubation time h vs hek293 cells gî± ko basal biol rep 1 cell line embryonic g{alpha} knock incubation vehicle time h |
| GSE245270_1_v_3_isoproterenol_human | hek293 cells wild type isoproterenol biol rep 1 cell line embryonic incubation time h vs hek293 cells î²arrestin1/2 ko isoproterenol biol rep 1 cell line embryonic {beta}arrestin1/2 knock incubation time h |
| GSE245270_2_v_3_isoproterenol_human | hek293 cells wild type basal biol rep 1 cell line embryonic incubation vehicle time h vs hek293 cells î²arrestin1/2 ko isoproterenol biol rep 1 cell line embryonic {beta}arrestin1/2 knock incubation time h |
| GSE245270_1_v_5_isoproterenol_human | hek293 cells wild type isoproterenol biol rep 1 cell line embryonic incubation time h vs hek293 cells gî± ko isoproterenol biol rep 1 cell line embryonic g{alpha} knock incubation time h |
| GSE245270_2_v_4_isoproterenol_human | hek293 cells wild type basal biol rep 1 cell line embryonic incubation vehicle time h vs hek293 cells gî± ko basal biol rep 1 cell line embryonic g{alpha} knock incubation vehicle time h |
| GSE245270_2_v_5_isoproterenol_human | hek293 cells wild type basal biol rep 1 cell line embryonic incubation vehicle time h vs hek293 cells gî± ko isoproterenol biol rep 1 cell line embryonic g{alpha} knock incubation time h |
| GSE224439_1_v_3_adagrasib_human | dmso lung cancer cell line nci h2030 vs k 975 100nm adagrasib 30nm lung cancer cell line nci h2030 |
| GSE224439_1_v_2_adagrasib_human | dmso lung cancer cell line nci h2030 vs adagrasib 30nm lung cancer cell line nci h2030 |
| GSE229070,GSE229071_0_v_2_sotorasib_human | nci h358 treated dmso lung cell line carcinoma non small vs nci h358 treated amg510 lung cell line carcinoma non small |
| GSE204752_2_v_0_sotorasib_mouse | c lung tumor control kras g12c trp53 ko vs r lung tumor sotorasib resistant kras g12c trp53 ko |
| GSE130715_1_v_0_budesonide_human | budesonide treated [4r117 subject id human airway smooth muscle (hasm) cells condition control hasm vs gs knockdown [4r117 subject id human airway smooth muscle (hasm) cells condition gnas hasm |
| GSE130715_2_v_3_budesonide_human | control [4r117 subject id human airway smooth muscle (hasm) cells condition hasm vs gs knockdown budesonide treated [4r117 subject id human airway smooth muscle (hasm) cells condition gnas hasm |
| GSE130715_1_v_3_budesonide_human | budesonide treated [4r117 subject id human airway smooth muscle (hasm) cells condition control hasm vs gs knockdown budesonide treated [4r117 subject id human airway smooth muscle (hasm) cells condition gnas hasm |
| GSE130715_2_v_0_budesonide_human | control [4r117 subject id human airway smooth muscle (hasm) cells condition hasm vs gs knockdown [4r117 subject id human airway smooth muscle (hasm) cells condition gnas hasm |
| GSE168473_0_v_1_isoniazid_human | rna seq control cell line hepg2 untreated cultured cells vs rna seq inh treated cell line hepg2 10mm 12 hours cultured cells |
| GSE250534_2_v_3_cabergoline_mouse | post lactation organoids brca1/p53 deficient multiparous mice (60 days) mult lact] mammary gland untreated 60 day involution period vs cabergoline treated post lactation organoids brca1/p53 deficient multiparous mice (1 day) 1 cab 1inv] mammary gland (0.2 mg/kg) day involution period |
| GSE250534_4_v_1_cabergoline_mouse | post lactation organoids brca1/p53 deficient multiparous mice (1 day) 1 mult 1inv] mammary gland untreated day involution period vs cabergoline treated post lactation organoids brca1/p53 deficient multiparous mice (60 days) mult ad] mammary gland (0.2 mg/kg) 60 day involution period |
| GSE250534_0_v_3_cabergoline_mouse | brca1/p53 deficient mammary gland organoids age matched nulliparous mice untreated 60 days post lactational involution vs cabergoline treated post lactation organoids brca1/p53 deficient multiparous mice (1 day) 1 cab 1inv] mammary gland (0.2 mg/kg) day involution period |
| GSE129389_0_v_5_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs ljn452 mid strain c57bl/6 tropifexor (0.1 0.3 0.9 mg/kg) liver |
| GSE129389_0_v_3_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs veh ljn452 strain c57bl/6 tropifexor (0.1 0.3 0.9 mg/kg) liver |
| GSE129389_0_v_7_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs oca strain c57bl/6 (25 mg/kg) liver |
| GSE129389_0_v_4_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs veh oca strain c57bl/6 (25 mg/kg) liver |
| GSE129389_0_v_1_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs ljn452 low strain c57bl/6 tropifexor (0.1 0.3 0.9 mg/kg) liver |
| GSE129389_0_v_6_tropifexor_mouse | normal control strain c57bl/6 low fat diet (10% kcal) fructose cholesterol liver vs ljn452 high strain c57bl/6 tropifexor (0.1 0.3 0.9 mg/kg) liver |
| GSE179974_3_v_4_carboplatin_mouse | bmdm unstim bone marrow derived macrophages (bmdm) strain c57bl/6 untreated control vs bmdm lps100 carbo25 bone marrow derived macrophages (bmdm) strain c57bl/6 lps 100 ng/ml together carboplatin 25 um |
| GSE179974_3_v_0_carboplatin_mouse | bmdm unstim bone marrow derived macrophages (bmdm) strain c57bl/6 untreated control vs bmdm lps10control bone marrow derived macrophages (bmdm) strain c57bl/6 lps 10 ng/ml |
| GSE179974_3_v_1_carboplatin_mouse | bmdm unstim bone marrow derived macrophages (bmdm) strain c57bl/6 untreated control vs bmdm tol carbo25 bone marrow derived macrophages (bmdm) strain c57bl/6 lps 100 ng/ml carboplatin followed 10 |
| GSE179974_3_v_5_carboplatin_mouse | bmdm unstim bone marrow derived macrophages (bmdm) strain c57bl/6 untreated control vs bmdm lps100 bone marrow derived macrophages (bmdm) strain c57bl/6 lps 100 ng/ml |
| GSE179974_3_v_2_carboplatin_mouse | bmdm unstim bone marrow derived macrophages (bmdm) strain c57bl/6 untreated control vs bmdm tol bone marrow derived macrophages (bmdm) strain c57bl/6 lps 100 ng/ml followed 10 |
| GSE150055_0_v_2_melphalan_human | control replicate scvi273 hipsc derived cardiomyocytes developmental stage day 23 differentiated cells cell line scvi 273 agent standard medium dmso cms vs mel+nac replicate scvi273 hipsc derived cardiomyocytes developmental stage day 23 differentiated cells cell line scvi 273 agent standard medium melphalan nac supplementation cms |
| GSE178292_0_v_2_melphalan_human | negative control untreated cell line ina 6 human multiple myeloma (human line) vs melphalan treated 10 î¼m 6 hours cell line ina human multiple myeloma (human line) |
| GSE150055_0_v_1_melphalan_human | control replicate scvi273 hipsc derived cardiomyocytes developmental stage day 23 differentiated cells cell line scvi 273 agent standard medium dmso cms vs mel replicate scvi273 hipsc derived cardiomyocytes developmental stage day 23 differentiated cells cell line scvi 273 agent standard medium melphalan cms |
| GSE178292_0_v_3_melphalan_human | negative control untreated cell line ina 6 human multiple myeloma (human line) vs melphalan ng25 treated 10 î¼m 2 6 hours cell line ina human multiple myeloma (human line) |
| GSE178292_0_v_1_melphalan_human | negative control untreated cell line ina 6 human multiple myeloma (human line) vs ng25 treated 2 î¼m 6 hours cell line ina human multiple myeloma (human line) |
| GSE226452_1_v_2_imiquimod_mouse | control skin strain balb/c sex male condition mouse blank vs lys skin strain balb/c sex male condition imiquimod induced psoriasis like mouse model longkui yinxiao soup |
| GSE226452_1_v_0_imiquimod_mouse | control skin strain balb/c sex male condition mouse blank vs imq skin strain balb/c sex male condition imiquimod induced psoriasis like mouse model |
| GSE204832_0_v_1_imiquimod_mouse | wt imq skin imiquimod vs ko imq skin camk4 imiquimod |
| GSE152637_1_v_0_imiquimod_mouse | imq strain background c57bl/6 group control cervical spinal cord vs imq 2d strain background c57bl/6 group imiquimod (imq) induced psoriasis model cervical spinal cord |
| GSE164580,GSE164581_1_v_0_imiquimod_mouse | rna wt keratinocytes wild type whole skin vs rna mapk8 ko keratinocytes whole skin |
| GSE154219_0_v_2_cholestyramine_mouse | ct strain cd2f1 liver tumor sham injected mice control group vs c26 cho strain cd2f1 liver tumor yes injected mice receiving cholestyramine diet cachectic group treated |
| GSE126463_5_v_3_pomalidomide_human | pom 24h 1 disease multiple myeloma /variation wild type um pomalidomide 24 hours mm.1s human cell line peripheral blood vs aiolos kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_1_v_3_pomalidomide_human | pom 72h 1 disease multiple myeloma /variation wild type um pomalidomide 72 hours mm.1s human cell line peripheral blood vs aiolos kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_0_v_3_pomalidomide_human | control kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood vs aiolos kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_6_v_2_pomalidomide_human | pom 48h 1 disease multiple myeloma /variation wild type um pomalidomide 48 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_5_v_2_pomalidomide_human | pom 24h 1 disease multiple myeloma /variation wild type um pomalidomide 24 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_6_v_3_pomalidomide_human | pom 48h 1 disease multiple myeloma /variation wild type um pomalidomide 48 hours mm.1s human cell line peripheral blood vs aiolos kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_0_v_2_pomalidomide_human | control kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_1_v_2_pomalidomide_human | pom 72h 1 disease multiple myeloma /variation wild type um pomalidomide 72 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_4_v_3_pomalidomide_human | non treat disease multiple myeloma /variation wild type treated mm.1s human cell line peripheral blood vs aiolos kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_4_v_2_pomalidomide_human | non treat disease multiple myeloma /variation wild type treated mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE135705_5_v_1_corticosterone_mouse | hfsc replicate strain background c57bl/6 sex female /variation wild type adrenalectomy facs purified mouse hair follicle stem cells vs hfsc replicate strain background 129/c57bl/6 sex female /variation injection tamoxifen intraperitoneally 6 days facs purified mouse hair follicle stem cells |
| GSE135705_5_v_3_corticosterone_mouse | hfsc replicate strain background c57bl/6 sex female /variation wild type adrenalectomy facs purified mouse hair follicle stem cells vs dp replicate strain 129/c57bl/6 genotypes sex female injection tamoxifen intraperitoneally 6 days facs purified mouse dermal papilla (dp) cells |
| GSE235234_2_v_3_corticosterone_mouse | doca wt rostral ventrolateral nucleus wild type salt vs baseline cre rostral ventrolateral nucleus ko atp6ap2 n/ |
| GSE96544_1_v_0_mebendazole_human | thp1 control 1 cell line thp agent dmso sample pair vs thp1 mebendazole 1 cell line thp agent sample pair |
| GSE213153_1_v_0_ulixertinib_human | ngp cells dmso cell line neuroblastoma n/ time day vs ngp cells ulixertinib cell line neuroblastoma n/ time day |
| GSE160001,GSE160670_1_v_2_lapatinib_human | skbr3 sint dmso 24h cell line skbr 3 her2+ non targeting (nt) sirna control pool 48h treated library preparation kit illumina truseq rna v2 breast carcinoma vs skbr3 sifoxa1 300nm lapatinib 24h foxa1 sirna pool 48h treated library preparation kit illumina truseq rna v2 cell line skbr 3 her2+ breast carcinoma |
| GSE160001,GSE160670_0_v_2_lapatinib_human | skbr3 sifoxa1 dmso 24h cell line skbr 3 her2+ foxa1 sirna pool 48h treated library preparation kit illumina truseq rna v2 breast carcinoma vs skbr3 sifoxa1 300nm lapatinib 24h foxa1 sirna pool 48h treated library preparation kit illumina truseq rna v2 cell line skbr 3 her2+ breast carcinoma |
| GSE195713_0_v_1_lapatinib_human | control time 24 h hacat cells vs lapa lapatinib treated time 24 h hacat cells |
| GSE160001,GSE160670_3_v_2_lapatinib_human | skbr3 sint 300nm lapatinib 24h cell line skbr 3 her2+ non targeting (nt) sirna control pool 48h treated library preparation kit illumina truseq rna v2 breast carcinoma vs skbr3 sifoxa1 300nm lapatinib 24h foxa1 sirna pool 48h treated library preparation kit illumina truseq rna v2 cell line skbr 3 her2+ breast carcinoma |
| GSE157894_2_v_3_cystine_human | rko control cell line colon cancer cells cystine free media 48 hours vs hct116 cystine(25î¼m) cell line colon cancer cells 25î¼m cystine contained media 48 hours |
| GSE226397_0_v_1_cystine_mouse | control kidney cortex proximal tubule cells ctns wt vs case kidney cortex proximal tubule cells ctns ko |
| GSE234566_0_v_1_cystine_mouse | normal cys small intestine cystine diet vs low cys small intestine cystine diet |
| GSE199692_0_v_1_cystine_human | control 1 mcu expression status panc cells vs mcu 1 expression status overexpressing panc oe cells |
| GSE157894_2_v_0_cystine_human | rko control cell line colon cancer cells cystine free media 48 hours vs rko cystine(25î¼m) cell line colon cancer cells 25î¼m cystine contained media 48 hours |
| GSE157894_1_v_3_cystine_human | hct116 control cell line colon cancer cells cystine free media 48 hours vs hct116 cystine(25î¼m) cell line colon cancer cells 25î¼m cystine contained media 48 hours |
| GSE157894_1_v_0_cystine_human | hct116 control cell line colon cancer cells cystine free media 48 hours vs rko cystine(25î¼m) cell line colon cancer cells 25î¼m cystine contained media 48 hours |
| GSE146962_0_v_1_glucosamine_mouse | ogtwt [ogf373 strain background b6 developmenal stage embryonic day 11.5 /variation control heart vs ogtko strain background b6 developmenal stage embryonic day 11.5 /variation ogt cadiomyocytes specific knockout using tnt cre heart |
| GSE116433_1_v_0_glucosamine_mouse | wt strain background c57bl/6 /variation wild type bone marrow lsk cells vs ogt ko strain background c57bl/6 /variation bone marrow lsk cells âx88x86/ |
| GSE249544,GSE249637_9_v_7_temozolomide_human | cschf2927r4gy gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation (4 gy) vs sdchf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE214931_2_v_0_temozolomide_human | ln229 blm ko cell line untreated rep brain knock sample type transfection crispr/cas9 vs ln229 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE225869_2_v_0_temozolomide_human | u251 shctrl dmso cell line human glioblastoma cells wt time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE111247_14_v_9_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs vt 36h glioblastoma cell line time viral therapy lnz308 |
| GSE111247_0_v_8_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs rt 96h glioblastoma cell line time radiotherapy lnz308 |
| GSE249544,GSE249637_8_v_7_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 tmz vs sdchf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE214931_3_v_0_temozolomide_human | ln18 blm ko cell line untreated rep brain type sample transfection crispr/cas9 vs ln229 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_0_v_6_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs vt 96h glioblastoma cell line time viral therapy lnz308 |
| GSE214931_4_v_5_temozolomide_human | ln18 glioma cell line untreated rep brain wild type sample transfection none vs ln18 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_2_v_6_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs vt 96h glioblastoma cell line time viral therapy lnz308 |
| GSE111247_2_v_13_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct vt 96h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_0_v_13_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt 96h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_0_v_1_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt rt 96h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE111247_14_v_1_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt rt 96h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE111247_11_v_9_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs vt 36h glioblastoma cell line time viral therapy lnz308 |
| GSE249544,GSE249637_6_v_2_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation conrol vs cschf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE111247_14_v_13_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt 96h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_2_v_8_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs rt 96h glioblastoma cell line time radiotherapy lnz308 |
| GSE111247_11_v_3_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs rt 36h glioblastoma cell line time radiotherapy lnz308 |
| GSE111247_11_v_5_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs ct vt 36h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_11_v_12_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs ct vt rt 36h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE140441_2_v_0_temozolomide_human | unt rnaseq cell line gbm derived stem cells untreated egfr status vs bmp4 rnaseq cell line gbm derived stem cells egfr status |
| GSE111247_14_v_6_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs vt 96h glioblastoma cell line time viral therapy lnz308 |
| GSE214931_2_v_5_temozolomide_human | ln229 blm ko cell line untreated rep brain knock sample type transfection crispr/cas9 vs ln18 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_0_v_4_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs blank 0h glioblastoma cell line time lnz308 |
| GSE225869_3_v_0_temozolomide_human | u251 nc tmz cell line human glioblastoma cells wt temozolomide time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE111247_2_v_1_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct vt rt 96h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE111247_2_v_10_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct 36h glioblastoma cell line time chemotherapy lnz308 |
| GSE249544,GSE249637_8_v_4_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 tmz vs cschf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE111247_14_v_8_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs rt 96h glioblastoma cell line time radiotherapy lnz308 |
| GSE111247_11_v_13_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs ct vt 96h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE249544,GSE249637_9_v_4_temozolomide_human | cschf2927r4gy gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation (4 gy) vs cschf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE249544,GSE249637_9_v_0_temozolomide_human | cschf2927r4gy gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation (4 gy) vs cschf2303rcontrol gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation conrol |
| GSE249544,GSE249637_9_v_5_temozolomide_human | cschf2927r4gy gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation (4 gy) vs sdchf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE111247_14_v_7_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct 96h glioblastoma cell line time chemotherapy lnz308 |
| GSE111247_2_v_5_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct vt 36h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_14_v_12_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt rt 36h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE111247_11_v_4_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs blank 0h glioblastoma cell line time lnz308 |
| GSE111247_14_v_4_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs blank 0h glioblastoma cell line time lnz308 |
| GSE214931_3_v_5_temozolomide_human | ln18 blm ko cell line untreated rep brain type sample transfection crispr/cas9 vs ln18 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_14_v_10_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct 36h glioblastoma cell line time chemotherapy lnz308 |
| GSE214931_1_v_5_temozolomide_human | ln229 glioma cell line untreated rep brain wild type sample transfection none vs ln18 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE249544,GSE249637_8_v_2_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 tmz vs cschf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE249544,GSE249637_6_v_4_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation conrol vs cschf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE249544,GSE249637_8_v_0_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 tmz vs cschf2303rcontrol gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation conrol |
| GSE111247_11_v_10_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs ct 36h glioblastoma cell line time chemotherapy lnz308 |
| GSE111247_11_v_6_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs vt 96h glioblastoma cell line time viral therapy lnz308 |
| GSE111247_2_v_9_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs vt 36h glioblastoma cell line time viral therapy lnz308 |
| GSE111247_14_v_5_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct vt 36h glioblastoma cell line time double chemotherapy viral therapy lnz308 |
| GSE111247_2_v_7_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct 96h glioblastoma cell line time chemotherapy lnz308 |
| GSE111247_14_v_3_temozolomide_human | ctl r v 96h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs rt 36h glioblastoma cell line time radiotherapy lnz308 |
| GSE249544,GSE249637_6_v_5_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation conrol vs sdchf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE214931_4_v_0_temozolomide_human | ln18 glioma cell line untreated rep brain wild type sample transfection none vs ln229 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_2_v_4_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs blank 0h glioblastoma cell line time lnz308 |
| GSE225869_1_v_0_temozolomide_human | u251 shcd44 dmso cell line human glioblastoma cells cd44 knockdown time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE249544,GSE249637_6_v_7_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation conrol vs sdchf2303r4gy gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 ionizing radiation (4 gy) |
| GSE111247_2_v_12_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs ct vt rt 36h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE214931_1_v_0_temozolomide_human | ln229 glioma cell line untreated rep brain wild type sample transfection none vs ln229 blm ko cell line treated rep brain knock sample type transfection crispr/cas9 temozolomide olaparib |
| GSE111247_2_v_3_temozolomide_human | ctl ct 36h glioblastoma cell line time control chemotherapy lnz308 vs rt 36h glioblastoma cell line time radiotherapy lnz308 |
| GSE249544,GSE249637_9_v_2_temozolomide_human | cschf2927r4gy gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 ionizing radiation (4 gy) vs cschf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE111247_0_v_7_temozolomide_human | ctl r v 36h glioblastoma cell line time control double radiotherapy viral therapy lnz308 vs ct 96h glioblastoma cell line time chemotherapy lnz308 |
| GSE111247_11_v_1_temozolomide_human | ctl ct 96h glioblastoma cell line time control chemotherapy lnz308 vs ct vt rt 96h glioblastoma cell line time triple chemotherapy viral therapy radiotherapy lnz308 |
| GSE154337_0_v_1_temozolomide_human | ln229 survgfp cell line (rrid cvcl 0393) glioblastoma multiforme plasmid pcdna3.1 survivin egfp nes status functional (wt) localisation predominantly cytoplasmic vs ln229 survgfpnes cell line (rrid cvcl 0393) glioblastoma multiforme plasmid pcdna3.1 survivin egfp nes status mutated (>g) (>c) codon leads substitution leucine alanine positions 96 (l96a) 98 (l98a) localisation predominantly nuclear |
| GSE249544,GSE249637_8_v_5_temozolomide_human | gbm primary tumor cell line hf2927 astrocyte tp53 wild type cdkn2a homozygous deletion egfr viii amplification pten nf1 tmz vs sdchf2303tmz gbm primary tumor cell line hf2303 astrocyte tp53 mutation cdkn2a homozygous deletion pten nf1 tmz |
| GSE103122_0_v_1_puromycin_human | healthy donor cd34+ non targeting shrna control day 14 culture cells transduced negative vs donor cd34+ cells riok3 knockdown day 14 culture transduced shrna clone trcn0000005418 gene expression |
| GSE235390_4_v_2_lurbinectedin_human | hmïx86 control monocyte derived macrophages vehicle vs hmïx86 +trb 100nm 6h monocyte derived macrophages trb |
| GSE235390_4_v_0_lurbinectedin_human | hmïx86 control monocyte derived macrophages vehicle vs hmïx86 +lur 100nm 6h monocyte derived macrophages lur |
| GSE171179,GSE171181_0_v_1_e7107_human | ttseq rna seq cutll1 dmso 24hr replicate human cell leukemia line vs ttseq rna seq cutll1 3nm e7107 24hr replicate human cell leukemia line |
| GSE171177,GSE171181_1_v_2_e7107_human | rna seq cutll1 dmso 24hr replicate human cell leukemia line vs rna seq cutll1 nmdi 5um 24hr replicate human cell leukemia cells line |
| GSE171180,GSE171181_0_v_1_e7107_human | ttseq rna seq cutll1 dmso 15min replicate human cell leukemia line vs ttseq rna seq cutll1 3nm e7107 15min replicate human cell leukemia line |
| GSE171177,GSE171181_1_v_0_e7107_human | rna seq cutll1 dmso 24hr replicate human cell leukemia line vs rna seq cutll1 e7107 3nm 24hr replicate human cell leukemia line |
| GSE171175,GSE171181_1_v_2_e7107_human | rna seq cutll1 dmso 24hr replicate human cell leukemia line vs rna seq cutll1 1.5nm e7107 24hr replicate human cell leukemia line |
| GSE171175,GSE171181_1_v_0_e7107_human | rna seq cutll1 dmso 24hr replicate human cell leukemia line vs rna seq cutll1 3nm e7107 24hr replicate human cell leukemia cells line |
| GSE149366_1_v_0_sulconazole_human | ts543 dmso cell line ts 543 glioblastoma derived cancer stem passage 8 10 vs ts543 sn cell line ts 543 glioblastoma derived cancer stem passage 8 10 sulconazole |
| GSE142630_0_v_3_hiltonol_human | unstimulated bdca3 purified cells donor blood vs stimulus bdca3 purified cells donor blood |
| GSE142630_0_v_2_hiltonol_human | unstimulated bdca3 purified cells donor blood vs combiantion bdca3 purified cells donor blood |
| GSE239898,GSE239899_1_v_0_hiltonol_human | donor unstimulated bdca3 blood cdc1 (bdca3+ dc) none vs donor hiltonol+prna stimulated bdca3 blood cdc1 (bdca3+ dc) |
| GSE239898,GSE239899_1_v_2_hiltonol_human | donor unstimulated bdca3 blood cdc1 (bdca3+ dc) none vs donor prna stimulated bdca3 blood cdc1 (bdca3+ dc) |
| GSE239898,GSE239899_1_v_3_hiltonol_human | donor unstimulated bdca3 blood cdc1 (bdca3+ dc) none vs donor hiltonol stimulated bdca3 blood cdc1 (bdca3+ dc) |
| GSE199427_0_v_1_oxytocin_human | hipsc l1 ctrl derived epicardial cells cell line untreated vs hipsc l1 ot derived epicardial cells cell line 100 nm oxt |
| GSE249404_0_v_1_oxytocin_human | snu449 cells sicontrol liver cancer cell line human hepatocarcinomacells vs snu449 cells sioxtr liver cancer cell line human hepatocarcinomacells |
| GSE203181_0_v_1_phosphoramidon_human | hk 2 cells cse t24h control sample immortalized human renal proximal tubular epithelial untreated cell line kidney vs hk 2 cells phosphoramidon t24h immortalized human renal proximal tubular epithelial treated 24 hours cell line kidney |
| GSE218580_1_v_2_fentanyl_mouse | control vp biol rep ventral pallidum sex male bulk rpl22ha aav rg cre ribotag mouse line vs habneula projecting vp biol rep ventral pallidum sex male hb proj rpl22ha aav rg cre ribotag mouse line |
| GSE218580_1_v_5_fentanyl_mouse | control vp biol rep ventral pallidum sex male bulk rpl22ha aav rg cre ribotag mouse line vs ventral tegmental area projecting vp biol rep pallidum sex male vta proj rpl22ha aav rg cre ribotag mouse line |
| GSE218580_1_v_0_fentanyl_mouse | control vp biol rep ventral pallidum sex male bulk rpl22ha aav rg cre ribotag mouse line vs medial dorsal thalamus projecting vp biol rep ventral pallidum sex male mdt proj rpl22ha aav rg cre ribotag mouse line |
| GSE218580_1_v_4_fentanyl_mouse | control vp biol rep ventral pallidum sex male bulk rpl22ha aav rg cre ribotag mouse line vs lateral hypothalamus projecting vp biol rep ventral pallidum sex male lh proj rpl22ha aav rg cre ribotag mouse line |
| GSE218580_1_v_3_fentanyl_mouse | control vp biol rep ventral pallidum sex male bulk rpl22ha aav rg cre ribotag mouse line vs npas positive biol rep ventral pallidum sex male npas+ vp cre rpl22ha ribotag mouse line |
| GSE167922_0_v_1_fentanyl_human | ctrl rep cell line agent none liver vs fentanyl treated rep cell line agent liver |
| GSE143782_7_v_11_calcitriol_human | colon stem cells control gender female age tnm vehicle tumor site cell enriched organoid primary culture vs rectal tumor stem cells gender male age tnm site lower rectum cell enriched organoid primary culture |
| GSE143782_6_v_5_calcitriol_human | rectal tumor stem cells control gender age tnm vehicle site rectum cell enriched organoid primary culture vs colon stem cells vitamind gender female age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE209698_3_v_1_calcitriol_human | untreated mdms 24 h infected donor monocyte derived macrophages infection status zikv hours post vitamin vs d3 mdms 24 h infected donor monocyte derived macrophages infection status zikv hours post vitamin treated |
| GSE209698_2_v_1_calcitriol_human | untreated mdms uninfected donor monocyte derived macrophages infection status hours post 0 vitamin vs d3 mdms 24 h infected donor monocyte derived macrophages infection status zikv hours post vitamin treated |
| GSE143782_3_v_11_calcitriol_human | rectum stem cells control gender age tnm vehicle tumor site cell enriched organoid primary culture vs rectal tumor stem cells gender male age tnm site lower rectum cell enriched organoid primary culture |
| GSE143782_3_v_4_calcitriol_human | rectum stem cells control gender age tnm vehicle tumor site cell enriched organoid primary culture vs rectal tumor stem cells vitamind gender female age tnm 3(4) 1 25(oh)2d3 site rectum cell enriched organoid primary culture |
| GSE143782_7_v_4_calcitriol_human | colon stem cells control gender female age tnm vehicle tumor site cell enriched organoid primary culture vs rectal tumor stem cells vitamind gender female age tnm 3(4) 1 25(oh)2d3 site rectum cell enriched organoid primary culture |
| GSE143782_6_v_1_calcitriol_human | rectal tumor stem cells control gender age tnm vehicle site rectum cell enriched organoid primary culture vs rectum stem cells vitamin gender age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE209698_0_v_1_calcitriol_human | d3 mdms uninfected donor monocyte derived macrophages infection status hours post 0 vitamin treated vs d3 mdms 24 h infected donor monocyte derived macrophages infection status zikv hours post vitamin treated |
| GSE143782_3_v_5_calcitriol_human | rectum stem cells control gender age tnm vehicle tumor site cell enriched organoid primary culture vs colon stem cells vitamind gender female age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE143782_6_v_8_calcitriol_human | rectal tumor stem cells control gender age tnm vehicle site rectum cell enriched organoid primary culture vs rectum stem cells vitamin gender female age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE213410_0_v_3_calcitriol_human | h9 hescs normal ethanol (control) 24 hours vs hipscs trisomy 21 (p hipscs) calcitriol 24 hours |
| GSE143782_7_v_5_calcitriol_human | colon stem cells control gender female age tnm vehicle tumor site cell enriched organoid primary culture vs colon stem cells vitamind gender female age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE213410_2_v_3_calcitriol_human | h9 hescs normal 5 oxo ete 24 hours vs hipscs trisomy 21 (p hipscs) calcitriol 24 hours |
| GSE143782_3_v_8_calcitriol_human | rectum stem cells control gender age tnm vehicle tumor site cell enriched organoid primary culture vs rectum stem cells vitamin gender female age tnm 1 25(oh)2d3 tumor site cell enriched organoid primary culture |
| GSE241031_0_v_2_abemaciclib_human | control (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 vs (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 |
| GSE157383_3_v_1_abemaciclib_human | mcf7 dmso cell line breast carcinoma treamtent length 7 days vs mcf7 ly500 cell line breast carcinoma treamtent abemaciclib length 7 days |
| GSE241031_0_v_7_abemaciclib_human | control (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 vs 72h (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 |
| GSE157383_6_v_1_abemaciclib_human | mda mb 453 dmso 7 days (replicate cell line breast carcinoma treamtent length vs mcf7 ly500 cell line breast carcinoma treamtent abemaciclib length 7 days |
| GSE157383_6_v_2_abemaciclib_human | mda mb 453 dmso 7 days (replicate cell line breast carcinoma treamtent length vs mda mb abemaciclib 7 days (replicate cell line breast carcinoma treamtent length |
| GSE157383_0_v_1_abemaciclib_human | mda mb 468 dmso 7 days (replicate cell line breast carcinoma treamtent length vs mcf7 ly500 cell line breast carcinoma treamtent abemaciclib length 7 days |
| GSE157383_3_v_2_abemaciclib_human | mcf7 dmso cell line breast carcinoma treamtent length 7 days vs mda mb abemaciclib 7 days (replicate cell line breast carcinoma treamtent length |
| GSE241031_0_v_4_abemaciclib_human | control (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 vs weeks (biological replicate cell line ls8817 dedifferentiated liposarcoma tet fmdm2 |
| GSE166914_1_v_0_abemaciclib_human | t98 dmso 24h agent human glioma cells vs t98 vsv51 24h agent vsv m51 human glioma cells |
| GSE166914_1_v_2_abemaciclib_human | t98 dmso 24h agent human glioma cells vs t98 v 24h agent abemaciclib vsv m51 human glioma cells |
| GSE154081_3_v_0_sildenafil_mouse | sample flx 200129 heart wild type sildenafil vs sample cko heart perk mutant sildenafil |
| GSE154081_3_v_2_sildenafil_mouse | sample flx 200129 heart wild type sildenafil vs sample cko tac 200129 heart perk mutant sildenafil |
| GSE154081_1_v_0_sildenafil_mouse | sample flx tac 200129 heart wild type sildenafil vs sample cko heart perk mutant sildenafil |
| GSE217115_3_v_4_alectinib_mouse | ea3 dmso cell line eml4 alk control time day vs ea3 alectinib cell line eml4 alk 100nm time day |
| GSE217115_2_v_0_alectinib_mouse | ea2 dmso cell line eml4 alk control time day vs ea2 alectinib cell line eml4 alk 100nm time day |
| GSE217115_2_v_4_alectinib_mouse | ea2 dmso cell line eml4 alk control time day vs ea3 alectinib cell line eml4 alk 100nm time day |
| GSE217115_2_v_5_alectinib_mouse | ea2 dmso cell line eml4 alk control time day vs ea1 alectinib cell line eml4 alk 100nm time day |
| GSE217115_3_v_0_alectinib_mouse | ea3 dmso cell line eml4 alk control time day vs ea2 alectinib cell line eml4 alk 100nm time day |
| GSE217115_3_v_5_alectinib_mouse | ea3 dmso cell line eml4 alk control time day vs ea1 alectinib cell line eml4 alk 100nm time day |
| GSE149621_3_v_1_olaparib_human | sifra sicjun dmso strain bt549 transfection fosl1 cjun target sirna 48 h breast cancer cell line vs sifra sicjun olap strain bt549 transfection fosl1 cjun target sirna olaparib 48 h breast cancer cell line |
| GSE153867_6_v_4_olaparib_human | a2780 parent line cell adenocarcinoma untreated ovarian carcinoma vs c13* shcebpb cell line adenocarcinoma c/ebp beta knockdown ovarian carcinoma |
| GSE149621_2_v_1_olaparib_human | sictrl olap strain bt549 transfection non target sirna olaparib 48 h breast cancer cell line vs sifra sicjun olap strain bt549 transfection fosl1 cjun target sirna olaparib 48 h breast cancer cell line |
| GSE153867_6_v_3_olaparib_human | a2780 parent line cell adenocarcinoma untreated ovarian carcinoma vs c13* shcon cell line adenocarcinoma c/ebp beta knockdown ovarian carcinoma |
| GSE149621_0_v_1_olaparib_human | sictrl dmso strain bt549 transfection non target sirna 48 h breast cancer cell line vs sifra sicjun olap strain bt549 transfection fosl1 cjun target sirna olaparib 48 h breast cancer cell line |
| GSE153867_6_v_8_olaparib_human | a2780 parent line cell adenocarcinoma untreated ovarian carcinoma vs a2780 olaparib resistant cell line adenocarcinoma treated ovarian carcinoma |
| GSE155162,GSE155169_1_v_0_buparlisib_human | hct116 wt modification parental cell line pasages 8 colorectal carcinoma (atcc ccl 247) vs hct116 202ko modification clone 202 crispr/cas9 ko ap 2a pasages 4 colorectal carcinoma (atcc ccl 247) |
| GSE155162,GSE155169_1_v_2_buparlisib_human | hct116 wt modification parental cell line pasages 8 colorectal carcinoma (atcc ccl 247) vs hct116 24ko modification clone 24 crispr/cas9 ko ap 2a pasages 4 colorectal carcinoma (atcc ccl 247) |
| GSE155162,GSE155169_1_v_3_buparlisib_human | hct116 wt modification parental cell line pasages 8 colorectal carcinoma (atcc ccl 247) vs hct116 49ko modification clone 49 crispr/cas9 ko ap 2a pasages 4 colorectal carcinoma (atcc ccl 247) |
| GSE151090_5_v_1_verteporfin_human | 24 hours dmso nucleus pulposus age year old timepoint vs 48 hours vp nucleus pulposus age year old timepoint |
| GSE151090_5_v_3_verteporfin_human | 24 hours dmso nucleus pulposus age year old timepoint vs 4 days vp nucleus pulposus age year old timepoint |
| GSE151090_2_v_1_verteporfin_human | 4 days dmso nucleus pulposus age year old timepoint vs 48 hours vp nucleus pulposus age year old timepoint |
| GSE151090_0_v_1_verteporfin_human | 48 hours dmso nucleus pulposus age year old timepoint vs 48 hours vp nucleus pulposus age year old timepoint |
| GSE151090_2_v_4_verteporfin_human | 4 days dmso nucleus pulposus age year old timepoint vs 24 hours vp nucleus pulposus age year old timepoint |
| GSE151090_2_v_3_verteporfin_human | 4 days dmso nucleus pulposus age year old timepoint vs 4 days vp nucleus pulposus age year old timepoint |
| GSE151090_5_v_4_verteporfin_human | 24 hours dmso nucleus pulposus age year old timepoint vs 24 hours vp nucleus pulposus age year old timepoint |
| GSE151090_0_v_4_verteporfin_human | 48 hours dmso nucleus pulposus age year old timepoint vs 24 hours vp nucleus pulposus age year old timepoint |
| GSE151090_0_v_3_verteporfin_human | 48 hours dmso nucleus pulposus age year old timepoint vs 4 days vp nucleus pulposus age year old timepoint |
| GSE210476_9_v_3_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut 0h primary macrophage cells rutaecarpine |
| GSE210476_11_v_8_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs syk lps 0h primary macrophage cells inhibitor iv 24h washed rested 3 days followed |
| GSE210476_9_v_5_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut 4h primary macrophage cells rutaecarpine |
| GSE210476_2_v_10_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs syk lps 24h primary macrophage cells inhibitor iv washed rested 3 days followed |
| GSE210476_2_v_0_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut lps 0hr primary macrophage cells rutaecarpine 24h washed rested 3 days followed 0h |
| GSE210476_11_v_10_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs syk lps 24h primary macrophage cells inhibitor iv washed rested 3 days followed |
| GSE210476_9_v_8_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs syk lps 0h primary macrophage cells inhibitor iv 24h washed rested 3 days followed |
| GSE210476_9_v_0_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut lps 0hr primary macrophage cells rutaecarpine 24h washed rested 3 days followed 0h |
| GSE210476_2_v_7_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut 24h primary macrophage cells rutaecarpine |
| GSE183606_1_v_0_rutaecarpine_human | u87 cells solvent control group cell line glioblastoma exposure dmso 48 hours tumor stage iv vs u87 cells rutaecarpin group cell line glioblastoma exposure 48 hours tumor stage iv |
| GSE210476_11_v_3_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs rut 0h primary macrophage cells rutaecarpine |
| GSE210476_11_v_4_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs rut lps 4h primary macrophage cells rutaecarpine 24h washed rested 3 days followed |
| GSE210476_2_v_5_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut 4h primary macrophage cells rutaecarpine |
| GSE210476_2_v_8_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs syk lps 0h primary macrophage cells inhibitor iv 24h washed rested 3 days followed |
| GSE210476_9_v_4_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut lps 4h primary macrophage cells rutaecarpine 24h washed rested 3 days followed |
| GSE210476_9_v_6_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut lps 24h primary macrophage cells rutaecarpine washed rested 3 days followed |
| GSE210476_11_v_7_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs rut 24h primary macrophage cells rutaecarpine |
| GSE210476_11_v_6_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs rut lps 24h primary macrophage cells rutaecarpine washed rested 3 days followed |
| GSE210476_9_v_7_rutaecarpine_human | dmso lps 24hr primary macrophage cells 24h washed rested 3 days followed vs rut 24h primary macrophage cells rutaecarpine |
| GSE210476_11_v_5_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs rut 4h primary macrophage cells rutaecarpine |
| GSE210476_2_v_3_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut 0h primary macrophage cells rutaecarpine |
| GSE210476_2_v_4_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut lps 4h primary macrophage cells rutaecarpine 24h washed rested 3 days followed |
| GSE210476_2_v_6_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs rut lps 24h primary macrophage cells rutaecarpine washed rested 3 days followed |
| GSE210476_2_v_1_rutaecarpine_human | dmso lps 4hr primary macrophage cells 24h washed rested 3 days followed 4h vs syk lps 4h primary macrophage cells inhibitor iv 24h washed rested 3 days followed |
| GSE210476_11_v_1_rutaecarpine_human | dmso lps 0hr primary macrophage cells 24h washed rested 3 days followed 0h vs syk lps 4h primary macrophage cells inhibitor iv 24h washed rested 3 days followed |
| GSE217441,GSE217443_1_v_0_ivosidenib_mouse | idh1 mutated murine bone marrow cells ivosidenib sensitive cell line oci midh1/n aml r132h npm1c untreated vs idh1 mutated murine bone marrow cells ivosidenib resistant cell line oci midh1/n r aml r132h npm1c (5um) culture two months followed drug washout period |
| GSE146865,GSE146866_4_v_3_saracatinib_mouse | sample 1201 cs control2 rnaseq primary microglia culture strain c57bl/6 dmso vehicle control time (hours) 24 2 p1 pup vs sample 1114 s241 1 saracatinib1 rnaseq primary microglia culture strain c57bl/6 saracatinib 1microm selleckchem s1006 time (hours) 24 p1 pup |
| GSE146865,GSE146866_1_v_0_saracatinib_mouse | sample 1114 c24 1 control1 rnaseq primary microglia culture strain c57bl/6 dmso vehicle control time (hours) 24 p1 pup vs sample 1201 s24100 saracatinib2 rnaseq primary microglia culture strain c57bl/6 saracatinib 1microm selleckchem s1006 time (hours) 24 2 p1 pup |
| GSE251992_1_v_0_saracatinib_human | definitive endoderm cells control cell line h1 escs dmso vs definitive endoderm cells saracatinib cell line h1 escs |
| GSE146865,GSE146866_1_v_3_saracatinib_mouse | sample 1114 c24 1 control1 rnaseq primary microglia culture strain c57bl/6 dmso vehicle control time (hours) 24 p1 pup vs sample 1114 s241 1 saracatinib1 rnaseq primary microglia culture strain c57bl/6 saracatinib 1microm selleckchem s1006 time (hours) 24 p1 pup |
| GSE119603_1_v_0_oxaliplatin_human | hct116 total rna phenotype parental control cell line colorectal cancer vs hct116oxr total rna phenotype oxaliplatin resistance cell line colorectal cancer |
| GSE243491_1_v_2_oxaliplatin_mouse | wt c57bl/6j circadian time 8 liver wild type oxaliplatin vs cry1 / cry2 c57bl/6j circadian time 8 liver oxaliplatin |
| GSE243491_3_v_2_oxaliplatin_mouse | wt c57bl/6j circadian time 16 liver wild type oxaliplatin vs cry1 / cry2 c57bl/6j circadian time 8 liver oxaliplatin |
| GSE243491_1_v_0_oxaliplatin_mouse | wt c57bl/6j circadian time 8 liver wild type oxaliplatin vs cry1 / cry2 c57bl/6j circadian time 16 liver oxaliplatin |
| GSE115283_1_v_0_oxaliplatin_mouse | strain background c57bl/6 /variation id2f/f iln cd8+ cells wt vs strain background c57bl/6 /variation cd4creid2f/f iln cd8+ cells id2ko |
| GSE243491_3_v_0_oxaliplatin_mouse | wt c57bl/6j circadian time 16 liver wild type oxaliplatin vs cry1 / cry2 c57bl/6j circadian time 16 liver oxaliplatin |
