| Description | Single gene perturbation signatures produced by querying RummaGEO metadata for knockouts, knockdowns, and over-expression conditions |
| Measurement | gene expression by RNA-seq |
| Association | gene-gene perturbation associations by differential expression of genes across RNA-seq samples from NCBI GEO |
| Category | transcriptomics |
| Resource | RummaGEO |
| Citation(s) | |
| Last Updated | 2025 Jun 10 |
| Stats |
|
| API | |
| Script | |
| Downloads |
Gene Attribute
Gene Similarity
Attribute Similarity
UMAP
4412 sets of genes differentially expressed following gene perturbation from the RummaGEO Gene Perturbation Signatures dataset.
| Gene Set | Description |
|---|---|
| GSE145249_0_v_2_ppm1g_human | sample ctrl ko cell line hct116 colorectal carcinoma /variation passages 15 vs sample ppm1g ko cell line hct116 colorectal carcinoma /variation passages 15 |
| GSE145249_1_v_2_ppm1g_human | sample 4su ctrl ko cell line hct116 colorectal carcinoma /variation passages 15 molecule subtype nascent rna vs sample ppm1g ko cell line hct116 colorectal carcinoma /variation passages 15 |
| GSE145249_1_v_3_ppm1g_human | sample 4su ctrl ko cell line hct116 colorectal carcinoma /variation passages 15 molecule subtype nascent rna vs sample 4su ppm1g ko cell line hct116 colorectal carcinoma /variation passages 15 molecule subtype nascent rna |
| GSE145249_0_v_3_ppm1g_human | sample ctrl ko cell line hct116 colorectal carcinoma /variation passages 15 vs sample 4su ppm1g ko cell line hct116 colorectal carcinoma /variation passages 15 molecule subtype nascent rna |
| GSE122191_1_v_0_zbtb24_human | cell types jurkat control virus immortalized cells vs zb24 cell types jurkat zbtb24 knockdown virus immortalized cells |
| GSE199541_2_v_6_mbd2_mouse | wt es derived neural progenitor cells wild type neuronal vs mbd2a gr es derived neural progenitor cells mbd3 ko + delgr neuronal |
| GSE199541_2_v_4_mbd2_mouse | wt es derived neural progenitor cells wild type neuronal vs mbd2afl es derived neural progenitor cells mbd3 ko + mbd2a neuronal |
| GSE199541_2_v_5_mbd2_mouse | wt es derived neural progenitor cells wild type neuronal vs mbd2t es derived neural progenitor cells mbd3 ko + neuronal |
| GSE126345_4_v_5_hcrt_mouse | ox +/+ strain c57bl/6 cortex /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 brainstem /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_11_v_5_hcrt_mouse | ox +/+ strain c57bl/6 hypothalamus /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 brainstem /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_9_v_3_hcrt_mouse | ox +/+ strain c57bl/6 brainstem /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 hypothalamus /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_7_v_10_hcrt_mouse | ox +/+ strain c57bl/6 hypothalamus /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 cortex /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_9_v_10_hcrt_mouse | ox +/+ strain c57bl/6 brainstem /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 cortex /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_7_v_5_hcrt_mouse | ox +/+ strain c57bl/6 hypothalamus /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 brainstem /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_11_v_10_hcrt_mouse | ox +/+ strain c57bl/6 hypothalamus /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 cortex /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_0_v_10_hcrt_mouse | ox +/+ strain c57bl/6 brainstem /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 cortex /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_4_v_3_hcrt_mouse | ox +/+ strain c57bl/6 cortex /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 hypothalamus /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_0_v_3_hcrt_mouse | ox +/+ strain c57bl/6 brainstem /variation hcrt/orexin wildtype mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate vs ox ko strain c57bl/6 hypothalamus /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_2_v_5_hcrt_mouse | ox +/+ strain c57bl/6 cortex /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 brainstem /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE126345_2_v_3_hcrt_mouse | ox +/+ strain c57bl/6 cortex /variation hcrt/orexin ataxin 3 wildtype mouse model reference hara j. et al. (2001). neuron 30 345 354. replicate vs ox ko strain c57bl/6 hypothalamus /variation hcrt/orexin knockout mouse model reference chemelli r.. et al. (1999). cell 98 437 451. replicate |
| GSE188814,GSE188854_0_v_1_wtap_mouse | strain c57bl/6j cd4+ cells wildtype wild type vs strain c57bl/6j cd4+ cells wtap ko |
| GSE162015_2_v_0_nfkb1_human | wt unt cell line thp 1 macrophage pma induced wild type untreated thp1 vs nfkb1 ko cell line thp 1 macrophage pma induced / thp1 |
| GSE162015_1_v_0_nfkb1_human | wt lps cell line thp 1 macrophage pma induced wild type 3h thp1 vs nfkb1 ko cell line thp 1 macrophage pma induced / thp1 |
| GSE254517_3_v_0_irf7_mouse | raw 264.7 irf7 ko1 untreated rep cell line macrophage like ko vs raw 264.7 irf7 ko1 +lps rep cell line macrophage like ko 4h lps |
| GSE254517_2_v_0_irf7_mouse | raw 264.7 gfp ko untreated rep cell line macrophage like grna control vs raw 264.7 irf7 ko1 +lps rep cell line macrophage like ko 4h lps |
| GSE178560_0_v_1_irf7_mouse | wt c strain c57bl/6j bone marrow control gfp overexpression acute myeloid leukemia (aml) leukemic cells vs irf7 / c strain c57bl/6j bone marrow gfp overexpression acute myeloid leukemia (aml) kit+ leukemic cells |
| GSE254517_1_v_0_irf7_mouse | raw 264.7 gfp ko +lps rep cell line macrophage like grna control 4h lps vs raw 264.7 irf7 ko1 +lps rep cell line macrophage like ko 4h lps |
| GSE150134_1_v_0_scn5a_human | 480 control sw480 cells colorectal carcinoma cancer cell line vs 480 scn5a knockdown sw480 cells colorectal carcinoma cancer cell line |
| GSE174406_2_v_0_lin28b_mouse | control cochlear epithelial cell expansion 7 days cochlea vs fst+lin28b cochlear epithelial cell fst lin28b overexpression expansion 7 days cochlea |
| GSE217378_2_v_0_lin28b_mouse | 14837t pdac cell line cells wt vs lin28b ko 15376t pdac cell line cells knockout |
| GSE158320,GSE183351_0_v_3_lin28b_human | be2c wt lin28b wild type vs be2c ko cell line lin28b knockout |
| GSE217378_1_v_0_lin28b_mouse | 15376t pdac cell line cells wt vs lin28b ko 15376t pdac cell line cells knockout |
| GSE158320,GSE183351_2_v_3_lin28b_human | be2c cell line lin28b wild type vs be2c ko cell line lin28b knockout |
| GSE158320,GSE183351_0_v_1_lin28b_human | be2c wt lin28b wild type vs be2c ko lin28b knockout |
| GSE183335,GSE183351_1_v_2_lin28b_human | fraction input wildtype be2c cells vs fraction polysome lin28b knockout be2c cells |
| GSE71100_0_v_1_lin28b_human | molp8 ct cell line molp 8 condition scrambled control cells multiple myeloma vs molp8 kd cell line molp 8 condition lin28b ko cells multiple myeloma |
| GSE183335,GSE183351_3_v_2_lin28b_human | fraction polysome wildtype be2c cells vs fraction polysome lin28b knockout be2c cells |
| GSE183335,GSE183351_1_v_0_lin28b_human | fraction input wildtype be2c cells vs fraction input lin28b knockout be2c cells |
| GSE138741,GSE138743_0_v_1_lin28b_human | lin28bwt ydox cell line be2c neuroblastoma cells /variation doxycycline inducible overexpression wild type lin28b treated (ydox) vs lin28bmut ydox cell line be2c neuroblastoma cells /variation doxycycline inducible overexpression mutant lin28b treated (ydox) |
| GSE183335,GSE183351_3_v_0_lin28b_human | fraction polysome wildtype be2c cells vs fraction input lin28b knockout be2c cells |
| GSE174406_2_v_1_lin28b_mouse | control cochlear epithelial cell expansion 7 days cochlea vs lin28b cochlear epithelial cell overexpression expansion 7 days cochlea |
| GSE158320,GSE183351_2_v_1_lin28b_human | be2c cell line lin28b wild type vs be2c ko lin28b knockout |
| GSE168750_0_v_1_slc7a5_mouse | disease state antigen induced arthritis wild type sex male age 16 weeks cd4+ cells sorted knee joint vs disease state antigen induced arthritis slc7a5 knockout sex male age 16 weeks cd4+ cells sorted knee joint |
| GSE94011_2_v_3_pias3_mouse | 18m c57 strain c57bl6/j retina age 18 months /variation wild type mouse vs 18m pias3 ko strain c57bl6/j retina age 18 months /variation mouse |
| GSE94011_0_v_1_pias3_mouse | p21 c57 strain c57bl6/j retina age post natal day 21 /variation wild type mouse postnatal vs p21 pias3 ko strain c57bl6/j retina age post natal day 21 /variation mouse postnatal |
| GSE94011_2_v_1_pias3_mouse | 18m c57 strain c57bl6/j retina age 18 months /variation wild type mouse vs p21 pias3 ko strain c57bl6/j retina age post natal day 21 /variation mouse postnatal |
| GSE94011_0_v_3_pias3_mouse | p21 c57 strain c57bl6/j retina age post natal day 21 /variation wild type mouse postnatal vs 18m pias3 ko strain c57bl6/j retina age 18 months /variation mouse |
| GSE163884_1_v_0_sumo2_human | wt human bone osteosarcoma epithelial cells cell line u2os vs s2ko human bone osteosarcoma epithelial cells cell line u2os sumo2 ko |
| GSE209680,GSE209683_0_v_1_nfat5_mouse | strain c57bl/6 tumor cell line b16 gp33 melanoma p14 cd8 cells infiltraing wt 48h activation vitro following transfer 5 mio bearing mice vs strain c57bl/6 tumor cell line b16 gp33 melanoma p14 cd8 cells infiltraing nfat5 ko 48h activation vitro following transfer 5 mio bearing mice |
| GSE148888_0_v_1_fstl1_mouse | total ibat wt interscapular brown adipose fstl1 floxed developmental stage newborn vs total ibat ko interscapular brown adipose myf5 fstl1 developmental stage newborn |
| GSE216378_1_v_0_fstl1_mouse | liver wt high fat carbohydrate diet vs f4mko+fstl1 liver overexpression fstl1 skeletal muscle irf4 ko high fat carbohydrate diet |
| GSE250518_0_v_2_trpm3_mouse | wt lens vs trpm3 ko lens |
| GSE248874_1_v_0_pcdh9_human | bgc 823 cells flag cell line control vs bgc 823 cells pcdh9 cter flag cell line overexpression |
| GSE114992,GSE114993_7_v_10_irf5_mouse | wt wnv 24h rep time infection replicate bone marrow dendritic cells vs ko wnv 6h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114993,GSE118452_2_v_3_irf5_mouse | bmm wt mock rep time infection bone marrow macrophages replicate vs bmm ko wnv rep time infection irf5 / bone marrow macrophages replicate |
| GSE114992,GSE114993_9_v_10_irf5_mouse | wt mock 12h rep time replicate bone marrow dendritic cells vs ko wnv 6h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_7_v_3_irf5_mouse | wt wnv 24h rep time infection replicate bone marrow dendritic cells vs ko wnv 12h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_11_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_9_v_11_irf5_mouse | wt mock 12h rep time replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_9_v_6_irf5_mouse | wt mock 12h rep time replicate bone marrow dendritic cells vs ko wnv 24h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_9_v_5_irf5_mouse | wt mock 12h rep time replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_3_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko wnv 12h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_8_v_2_irf5_mouse | wt wnv 6h rep time infection replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_8_v_3_irf5_mouse | wt wnv 6h rep time infection replicate bone marrow dendritic cells vs ko wnv 12h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_8_v_11_irf5_mouse | wt wnv 6h rep time infection replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_4_v_6_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko wnv 24h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_4_v_11_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_2_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_1_v_6_irf5_mouse | wt wnv 12h rep time infection replicate bone marrow dendritic cells vs ko wnv 24h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_7_v_2_irf5_mouse | wt wnv 24h rep time infection replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_4_v_5_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE129257,GSE129258_1_v_5_irf5_mouse | clp mac wt hh strain c57bl/6 sjl cd45.1 cx3cr1 gfp/+ infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype cd45.1+ gfp+ cd11b+ ly6c lo mhcii+ cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic vs clp p2mono ko hh strain c57bl/6 sjl cd45.2 cx3cr1 gfp/+ irf5 / infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype cd45.2+ gfp+ cd11b+ ly6c hi mhcii+ cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic |
| GSE114992,GSE114993_4_v_3_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko wnv 12h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_4_v_2_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_8_v_5_irf5_mouse | wt wnv 6h rep time infection replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_1_v_2_irf5_mouse | wt wnv 12h rep time infection replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE129257,GSE129258_1_v_0_irf5_mouse | clp mac wt hh strain c57bl/6 sjl cd45.1 cx3cr1 gfp/+ infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype cd45.1+ gfp+ cd11b+ ly6c lo mhcii+ cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic vs clp p1mono ko hh strain c57bl/6 sjl cd45.2 cx3cr1 gfp/+ irf5 / infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype cd45.2+ gfp+ cd11b+ ly6c hi mhcii cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic |
| GSE114992,GSE114993_9_v_2_irf5_mouse | wt mock 12h rep time replicate bone marrow dendritic cells vs ko mock 24h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_5_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_10_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko wnv 6h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_1_v_10_irf5_mouse | wt wnv 12h rep time infection replicate bone marrow dendritic cells vs ko wnv 6h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_4_v_10_irf5_mouse | wt mock 6h rep time replicate bone marrow dendritic cells vs ko wnv 6h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE129257,GSE129258_4_v_3_irf5_mouse | clp p1mono wt hh strain c57bl/6 sjl cd45.1 cx3cr1 gfp/+ infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype gfp+ cd11b+ ly6c hi mhcii cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic vs clp mac ko hh strain c57bl/6 sjl cd45.2 cx3cr1 gfp/+ irf5 / infection mononuclear phagocytes facs isolated inflamed lamina propria phenotype cd45.2+ gfp+ cd11b+ ly6c lo mhcii+ cd3 cd19 cd138 nk1.1 ly6g siglec f replicate chimera colonic |
| GSE114992,GSE114993_1_v_11_irf5_mouse | wt wnv 12h rep time infection replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_7_v_5_irf5_mouse | wt wnv 24h rep time infection replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_7_v_11_irf5_mouse | wt wnv 24h rep time infection replicate bone marrow dendritic cells vs ko mock 6h rep time irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_0_v_6_irf5_mouse | wt mock 24h rep time replicate bone marrow dendritic cells vs ko wnv 24h rep time infection irf5 / replicate bone marrow dendritic cells |
| GSE114992,GSE114993_1_v_5_irf5_mouse | wt wnv 12h rep time infection replicate bone marrow dendritic cells vs ko mock 12h rep time irf5 / replicate bone marrow dendritic cells |
| GSE242049_1_v_0_txndc5_mouse | aml12 cells wt cell line alpha mouse liver 12 vs aml12 cells ko cell line alpha mouse liver 12 txndc5 knockdown |
| GSE141453,GSE141454_0_v_4_card11_mouse | lr myc upregulated lymphoma overexpression none transduced control (empty vector mscv gfp) b220 sorted transgenic cells empty gfp vs lr 34597 myc transgenic suv39h1 / lymphoma cells transduced empty vector mscv gfp overexpression mutated card11 l244p b220 sorted |
| GSE152937_12_v_7_slc16a13_mouse | skeletal muscle hfd wt diet vs liver hfd slc16a13 ko diet |
| GSE152937_6_v_5_slc16a13_mouse | liver hfd wt diet vs skeletal muscle hfd slc16a13 ko diet |
| GSE152937_12_v_1_slc16a13_mouse | skeletal muscle hfd wt diet vs liver hfd slc16a13 ko diet |
| GSE163809_1_v_2_sdhaf4_mouse | cardiac wt strain c57bl/6 heart age post natal month 2 wild type vs cardiac ko strain c57bl/6 heart age post natal month 2 sdhaf4 / |
| GSE167324_1_v_0_eif4e_mouse | n2a ctrl vehicle rna seq cell line neuro 2a neuroblastoma wt dmso 2hrs vs n2a ko torin1 rna seq cell line neuro 2a neuroblastoma eif4e3 2hrs |
| GSE167324_2_v_0_eif4e_mouse | n2a ko vehicle rna seq cell line neuro 2a neuroblastoma eif4e3 dmso 2hrs vs n2a ko torin1 rna seq cell line neuro 2a neuroblastoma eif4e3 2hrs |
| GSE234882_4_v_1_lifr_mouse | dataset nmumg shpcbp1 mammary gland cell line epithelial wild type shrna knockdown pcbp1 vs dataset 1 nmumg shpcbp1 lifr ko cell line mammary gland epithelial / shrna knockdown pcbp1 crispr |
| GSE119694_1_v_0_lifr_mouse | wt strain fvb/nj pancreas primary cells isolated directly fresh pancreatic tumor age 44~49 days kraslsl g12d/+ trp53f/f rosa26lsl luc pdx1 cre tumors developed lifrwt mice vs ko strain fvb/nj pancreas primary cells isolated directly fresh pancreatic tumor age 44~49 days lifrf/f kraslsl g12d/+ trp53f/f rosa26lsl luc pdx1 cre tumors developed mice |
| GSE182834,GSE182836_8_v_3_siah2_mouse | mwt strain c57bl/6 liver sex male wild type vs fko strain c57bl/6 liver sex female siah2 ko |
| GSE182834,GSE182836_2_v_1_siah2_mouse | fwt strain c57bl/6 liver sex female wild type vs mko strain c57bl/6 liver sex male siah2 ko |
| GSE182835,GSE182836_2_v_3_siah2_mouse | wtf strain background c57bl/6 sex female wild type liver vs kom strain background c57bl/6 sex male siah2 ko liver |
| GSE182835,GSE182836_0_v_1_siah2_mouse | wtm strain background c57bl/6 sex male wild type liver vs kof strain background c57bl/6 sex female siah2 ko liver |
| GSE134412_0_v_1_siah2_mouse | ms strain wt tumor source melanoma cells yummer1.7 (100 000cells) injected .c flunk mouse vs ms strain siah2 ko tumor source melanoma cells yummer1.7 (100 000cells) injected .c flunk mouse |
| GSE160246_2_v_5_cpeb4_mouse | wt strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 1h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_0_v_1_cpeb4_mouse | wt un strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) none unstimulated time barcode bmdms vs ko 9h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_9_v_5_cpeb4_mouse | wt 6h strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 1h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_0_v_7_cpeb4_mouse | wt un strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) none unstimulated time barcode bmdms vs ko 3h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_2_v_7_cpeb4_mouse | wt strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 3h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_9_v_7_cpeb4_mouse | wt 6h strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 3h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_0_v_5_cpeb4_mouse | wt un strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) none unstimulated time barcode bmdms vs ko 1h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_9_v_1_cpeb4_mouse | wt 6h strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 9h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE160246_2_v_1_cpeb4_mouse | wt strain background mixed c57bl/6j 129 /variation wild type sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms vs ko 9h strain background mixed c57bl/6j 129 /variation cpeb4 sex male biological replicate cage bone marrow derived macrophages (bmdms) stimulated lps time barcode bmdms |
| GSE225218_9_v_3_abcb1_mouse | wt mel cells day biol rep cell line erythroleukemia 1.5% dmso time days vs abcb10 knockout cells day 0 biol rep cell line mel erythroleukemia none time days |
| GSE234043_3_v_1_abcb1_human | hap1 wt mz1 cell line (rrid cvcl y019) myeloid haploid karyotype 2 weeks vs hap1 abcb1 ko cell line (rrid cvcl y019) myeloid haploid karyotype |
| GSE225218_8_v_3_abcb1_mouse | abcb10 knockout cells day biol rep cell line mel erythroleukemia 1.5% dmso time days vs abcb10 knockout cells day 0 biol rep cell line mel erythroleukemia none time days |
| GSE225218_2_v_3_abcb1_mouse | wt mel cells day 5 biol rep cell line erythroleukemia 1.5% dmso time days vs abcb10 knockout cells day 0 biol rep cell line mel erythroleukemia none time days |
| GSE234043_0_v_1_abcb1_human | hap1 wt dmso cell line (rrid cvcl y019) myeloid haploid karyotype 2 weeks vs hap1 abcb1 ko cell line (rrid cvcl y019) myeloid haploid karyotype |
| GSE225218_0_v_3_abcb1_mouse | wt mel cells day 0 biol rep cell line erythroleukemia none time days vs abcb10 knockout cells day 0 biol rep cell line mel erythroleukemia none time days |
| GSE210225_0_v_1_uba6_mouse | 4t1 ntc cell line mouse breast cancer cells wt vs 4t1 ko cell line mouse breast cancer cells uba6 knockout |
| GSE144838_4_v_3_egfr_mouse | strain background c57bl6j /variation wild type high fat diet 18 weeks kidney wt vs bs strain background c57bl6j /variation vsmc egfr knockout high fat diet 18 weeks aorta |
| GSE144838_1_v_5_egfr_mouse | bs strain background c57bl6j /variation wild type high fat diet 18 weeks aorta wt vs strain background c57bl6j /variation vsmc egfr knockout high fat diet 18 weeks kidney |
| GSE158197_0_v_4_egfr_mouse | r wt aorta sd organ mouse endothelial cells egfr vs egfr ko kidney sd organ mouse endothelial cells |
| GSE144838_7_v_8_egfr_mouse | bs strain background c57bl6j /variation wild type standard fat diet 18 weeks aorta wt vs strain background c57bl6j /variation vsmc egfr knockout standard fat diet 18 weeks kidney |
| GSE158197_2_v_10_egfr_mouse | wt kidney sd organ mouse endothelial cells egfr vs r egfr ko aorta hfd organ mouse endothelial cells |
| GSE158197_6_v_10_egfr_mouse | wt kidney hfd organ mouse endothelial cells egfr vs r egfr ko aorta hfd organ mouse endothelial cells |
| GSE144838_1_v_8_egfr_mouse | bs strain background c57bl6j /variation wild type high fat diet 18 weeks aorta wt vs strain background c57bl6j /variation vsmc egfr knockout standard fat diet 18 weeks kidney |
| GSE158197_2_v_11_egfr_mouse | wt kidney sd organ mouse endothelial cells egfr vs egfr ko kidney hfd organ mouse endothelial cells |
| GSE144838_4_v_8_egfr_mouse | strain background c57bl6j /variation wild type high fat diet 18 weeks kidney wt vs strain background c57bl6j /variation vsmc egfr knockout standard fat diet 18 weeks kidney |
| GSE158197_6_v_4_egfr_mouse | wt kidney hfd organ mouse endothelial cells egfr vs egfr ko kidney sd organ mouse endothelial cells |
| GSE217405_0_v_1_egfr_mouse | megfr dmso cell line lung adenocarcinoma egfr mutant exon deletion 19 time vs megfr l860r.1 100nm osimertinib cell line lung adenocarcinoma egfr mutant l860r missense mutation time |
| GSE144838_2_v_5_egfr_mouse | strain background c57bl6j /variation wild type standard fat diet 18 weeks kidney wt vs strain background c57bl6j /variation vsmc egfr knockout high fat diet 18 weeks kidney |
| GSE144838_7_v_5_egfr_mouse | bs strain background c57bl6j /variation wild type standard fat diet 18 weeks aorta wt vs strain background c57bl6j /variation vsmc egfr knockout high fat diet 18 weeks kidney |
| GSE144838_2_v_3_egfr_mouse | strain background c57bl6j /variation wild type standard fat diet 18 weeks kidney wt vs bs strain background c57bl6j /variation vsmc egfr knockout high fat diet 18 weeks aorta |
| GSE158197_5_v_4_egfr_mouse | r wt aorta hfd organ mouse endothelial cells egfr vs egfr ko kidney sd organ mouse endothelial cells |
| GSE158197_6_v_3_egfr_mouse | wt kidney hfd organ mouse endothelial cells egfr vs r egfr ko aorta sd organ mouse endothelial cells |
| GSE217405_3_v_2_egfr_mouse | megfr l860r.1 dmso cell line lung adenocarcinoma egfr mutant l860r missense mutation time vs megfr 100nm osimertinib cell line lung adenocarcinoma egfr mutant exon deletion 19 time |
| GSE217405_0_v_2_egfr_mouse | megfr dmso cell line lung adenocarcinoma egfr mutant exon deletion 19 time vs megfr 100nm osimertinib cell line lung adenocarcinoma egfr mutant exon deletion 19 time |
| GSE158197_2_v_3_egfr_mouse | wt kidney sd organ mouse endothelial cells egfr vs r egfr ko aorta sd organ mouse endothelial cells |
| GSE158197_0_v_11_egfr_mouse | r wt aorta sd organ mouse endothelial cells egfr vs egfr ko kidney hfd organ mouse endothelial cells |
| GSE211474,GSE212779_0_v_1_phf8_human | panc28 sgcon cell line pancreatic cancer wt time vs panc28 sgphf8 cell line pancreatic cancer phf8 knockout time |
| GSE211474,GSE212779_8_v_2_phf8_mouse | ct26 sh con cell line colorectal cancer wt tumor tissues time day 18 cells injection vs ct26 sgphf8 cell line colorectal cancer phf8 knockout time |
| GSE211474,GSE212779_8_v_5_phf8_mouse | ct26 sh con cell line colorectal cancer wt tumor tissues time day 18 cells injection vs ct26 sh2 cell line colorectal cancer phf8 knockdown tumor tissues time day 18 cells injection |
| GSE214183_1_v_0_phf8_human | control sgrna cell line 786 clear renal cancer cells phf8 wildtype vs phf8 sgrna cell line 786 clear renal cancer cells knockout |
| GSE211474,GSE212779_8_v_4_phf8_mouse | ct26 sh con cell line colorectal cancer wt tumor tissues time day 18 cells injection vs ct26 sgphf8+phf8 cell line colorectal cancer phf8 knockout transduced vector time |
| GSE90019,GSE90020_5_v_2_phf8_mouse | str wt strain background b6x129svj /variation wild type age 2mo / ventral striatum vs npc ko strain background b6x129svj /variation phf8 / neural progenitor cells (npc) |
| GSE211474,GSE212779_8_v_10_phf8_mouse | ct26 sh con cell line colorectal cancer wt tumor tissues time day 18 cells injection vs ct26 sh1 cell line colorectal cancer phf8 knockdown tumor tissues time day 18 cells injection |
| GSE90019,GSE90020_1_v_3_phf8_mouse | npc wt strain background b6x129svj /variation wild type / neural progenitor cells (npc) vs str ko strain background b6x129svj /variation phf8 age 2mo / ventral striatum |
| GSE77178_5_v_3_ccnd1_mouse | ( ex) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 wt skeletal muscle stem cells vs (ko) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 ko skeletal muscle stem cells |
| GSE77178_6_v_3_ccnd1_mouse | (+ex) replicate strain c56bl/6 gender male age 18 months activity exercise ccnd1 wt skeletal muscle stem cells vs (ko) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 ko skeletal muscle stem cells |
| GSE77178_2_v_3_ccnd1_mouse | ( ex) replicate strain c56bl/6 gender male age 18 months activity exercise ccnd1 wt skeletal muscle stem cells vs (ko) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 ko skeletal muscle stem cells |
| GSE77178_1_v_3_ccnd1_mouse | (+ex) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 wt skeletal muscle stem cells vs (ko) replicate strain c56bl/6 gender male age 3 months activity exercise ccnd1 ko skeletal muscle stem cells |
| GSE164087_0_v_1_jmjd8_mouse | ewat wt replicate strain c57bl/6 (epididymal white adipose ) vs ewat jmjd8 ko replicate strain c57bl/6 (epididymal white adipose ) |
| GSE152032_3_v_2_s1pr4_mouse | strain/background c57bl/6 /variation wt colon 84 days aom/dss treated vs strain/background c57bl/6 /variation s1pr4 ko cd8+ cells pymt tumor one reached size 1.5 cm mammary |
| GSE152032_0_v_1_s1pr4_mouse | strain/background c57bl/6 /variation wt cd8+ cells pymt tumor one reached size 1.5 cm mammary vs strain/background c57bl/6 /variation s1pr4 ko colon 84 days aom/dss treated |
| GSE103297_1_v_0_glis3_mouse | glis3 wt rna strain background c57bl/6 /variation wild type diet low iodine (lid) 2 weeks thyroid gland vs glis3 ko rna strain background c57bl/6 /variation glis3ko diet low iodine (lid) 2 weeks thyroid gland |
| GSE106170_1_v_0_nap1l3_human | sc ucbs hematopoietic lineage markers lin cd34+cd38 cell selection facs sorted cells vector type negative control umbilical cord blood vs nap1l3 ucbs hematopoietic lineage markers lin cd34+cd38 cell selection facs sorted cells vector type shrna targeting knockdown umbilical cord blood |
| GSE198054,GSE198057_0_v_1_csf1r_mouse | para damaged tas days post injury macrophage wt partner wt/gfp female parabiotic pair pi cd45+ cd11b+ ly6g/siglecf gfp+ cells sorted facs vs mdx plx tibialis anterior muscle whole musle dmdmdx (female) total rna extracted ta 8 month old mouse following 6 months csf1r inhibition |
| GSE204929_0_v_1_ywhag_human | mkn74 control cell line human gastric adenocarcinoma wt vs mkn74 siywhag cell line mkn74siywhag human gastric adenocarcinoma ywhag knockdown |
| GSE222598_1_v_0_sf3b4_human | a549 cells si nc biol cell line non small lung cancer wt sirna vs a549 cells si sf3b4 biol cell line non small lung cancer knockdown sirna |
| GSE157296,GSE157298_4_v_2_kbtbd4_human | kl dmso cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shluciferase gfp shluc vs al tcp 24h cell line oci aml1 guide rna sgaavs1 tagged trfp647 knockdown shluciferase gfp time shluc tcp1 |
| GSE157296,GSE157298_4_v_5_kbtbd4_human | kl dmso cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shluciferase gfp shluc vs ar um171 cell line oci aml1 guide rna sgaavs1 tagged trfp647 knockdown shrcor1 gfp time |
| GSE157296,GSE157298_4_v_3_kbtbd4_human | kl dmso cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shluciferase gfp shluc vs kr um171 cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shrcor1 gfp time |
| GSE157296,GSE157298_4_v_1_kbtbd4_human | kl dmso cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shluciferase gfp shluc vs kl um171 cell line oci aml1 guide rna sgkbtbd4 tagged trfp647 knockdown shluciferase gfp time shluc |
| GSE101537_1_v_3_neurog3_mouse | wt islet mrna islets age 11 w.. /variation ep300fl/fl mouse vs cbp ko islet mrna islets age 11 w.. /variation neurog3 cre crebbpfl/fl mouse |
| GSE101537_4_v_2_neurog3_mouse | wt islet mrna islets age 11 w.. /variation crebbpfl/fl mouse vs p300 ko islet mrna islets age 11 w.. /variation neurog3 cre ep300fl/fl mouse |
| GSE101537_1_v_2_neurog3_mouse | wt islet mrna islets age 11 w.. /variation ep300fl/fl mouse vs p300 ko islet mrna islets age 11 w.. /variation neurog3 cre ep300fl/fl mouse |
| GSE190186,GSE190188_0_v_10_apoe_mouse | mpmg apoewt microglia apoe wt 2 sex rin mouse primary vs mpast apoeko 1 astrocytes apoe ko sex rin mouse primary |
| GSE190186,GSE190188_8_v_10_apoe_mouse | mpast apoewt astrocytes apoe wt 2 sex rin mouse primary vs mpast apoeko 1 astrocytes apoe ko sex rin mouse primary |
| GSE190186,GSE190188_0_v_5_apoe_mouse | mpmg apoewt microglia apoe wt 2 sex rin mouse primary vs mpmg apoeko 1 microglia apoe ko sex rin mouse primary |
| GSE155596_1_v_0_apoe_mouse | aorta apoe ko control vaccine strain c57bl/6 age 16weeks / vs aorta apoe ko gpnmb vaccine strain c57bl/6 age 16weeks / |
| GSE198228,GSE198245_0_v_2_apoe_human | wt neurons wild type age day differentiation vitro differentiated vs apoe neurons double knockout age day differentiation vitro differentiated |
| GSE192506_0_v_1_apoe_mouse | wild type phagoctyic pooled sample strain c57bl/6 retina age 12 weeks cell line n/ intravitreal injection apoptotic neurons microglia vs apoe / non phagoctyic pooled sample strain ko retina age 12 weeks cell line n/ intravitreal injection apoptotic neurons microglia |
| GSE232472_1_v_2_apoe_mouse | blood vessel apoe knockdown normal purified laboratory 6w aorta vs blood vessel apoe knockdown western diet 22w aorta |
| GSE190186,GSE190188_8_v_5_apoe_mouse | mpast apoewt astrocytes apoe wt 2 sex rin mouse primary vs mpmg apoeko 1 microglia apoe ko sex rin mouse primary |
| GSE152432_6_v_2_zrsr2_mouse | gmp strain background c57bl/6 /variation wild type granulocyte monocyte precursors (gmp) wt vs z2 ko strain background c57bl/6 /variation zrsr2 deficient |
| GSE152432_5_v_4_zrsr2_mouse | mef strain background c57bl/6 /variation wild type mefs wt vs cmp strain background c57bl/6 /variation zrsr2 deficient common myeloid precursors (cmp) ko |
| GSE152432_6_v_4_zrsr2_mouse | gmp strain background c57bl/6 /variation wild type granulocyte monocyte precursors (gmp) wt vs cmp strain background c57bl/6 /variation zrsr2 deficient common myeloid precursors (cmp) ko |
| GSE152432_1_v_0_zrsr2_mouse | mep strain background c57bl/6 /variation wild type megakaryocyte erythroid precursors (mep) wt vs mef strain background c57bl/6 /variation zrsr2 deficient mefs ko |
| GSE152432_1_v_4_zrsr2_mouse | mep strain background c57bl/6 /variation wild type megakaryocyte erythroid precursors (mep) wt vs cmp strain background c57bl/6 /variation zrsr2 deficient common myeloid precursors (cmp) ko |
| GSE152432_5_v_2_zrsr2_mouse | mef strain background c57bl/6 /variation wild type mefs wt vs z2 ko strain background c57bl/6 /variation zrsr2 deficient |
| GSE152432_3_v_2_zrsr2_mouse | cmp strain background c57bl/6 /variation wild type common myeloid precursors (cmp) wt vs z2 ko strain background c57bl/6 /variation zrsr2 deficient |
| GSE152432_9_v_4_zrsr2_mouse | z2 wt z1 strain background c57bl/6 /variation wild type depletion zrsr1 vs cmp strain background c57bl/6 /variation zrsr2 deficient common myeloid precursors (cmp) ko |
| GSE152432_9_v_0_zrsr2_mouse | z2 wt z1 strain background c57bl/6 /variation wild type depletion zrsr1 vs mef strain background c57bl/6 /variation zrsr2 deficient mefs ko |
| GSE151471_1_v_0_zrsr2_mouse | wt es cell line vgb6 cells vs zrsr2 ko cell line vgb6 es cells |
| GSE152432_6_v_0_zrsr2_mouse | gmp strain background c57bl/6 /variation wild type granulocyte monocyte precursors (gmp) wt vs mef strain background c57bl/6 /variation zrsr2 deficient mefs ko |
| GSE152432_1_v_2_zrsr2_mouse | mep strain background c57bl/6 /variation wild type megakaryocyte erythroid precursors (mep) wt vs z2 ko strain background c57bl/6 /variation zrsr2 deficient |
| GSE152432_3_v_0_zrsr2_mouse | cmp strain background c57bl/6 /variation wild type common myeloid precursors (cmp) wt vs mef strain background c57bl/6 /variation zrsr2 deficient mefs ko |
| GSE116930,GSE116935_3_v_0_hes7_human | psm wt [ko] line healthy/wild type ipsc (201b7) stage (presomitic mesoderm) background 201b7 vs psm ko [ko] line knock ipsc (201b7 reporter) stage (presomitic mesoderm) background 201b7 (hes7 luciferase clone |
| GSE116930,GSE116935_1_v_6_hes7_human | ipsc wt [ko] line healthy/wild type (201b7) stage (induced pluripotent stem cell) background 201b7 vs ipsc ko [ko] line knock (201b7 reporter) stage (induced pluripotent stem cell) background 201b7 (hes7 luciferase clone |
| GSE116930,GSE116935_1_v_0_hes7_human | ipsc wt [ko] line healthy/wild type (201b7) stage (induced pluripotent stem cell) background 201b7 vs psm ko [ko] line knock ipsc (201b7 reporter) stage (presomitic mesoderm) background 201b7 (hes7 luciferase clone |
| GSE116930,GSE116935_3_v_6_hes7_human | psm wt [ko] line healthy/wild type ipsc (201b7) stage (presomitic mesoderm) background 201b7 vs ipsc ko [ko] line knock (201b7 reporter) stage (induced pluripotent stem cell) background 201b7 (hes7 luciferase clone |
| GSE165579_3_v_2_opa1_mouse | dn3 strain c57bl/6 wt thymocytes vs dn4 strain c57bl/6 opa1 ko thymocytes |
| GSE165579_0_v_1_opa1_mouse | dn4 strain c57bl/6 wt thymocytes vs dn3 strain c57bl/6 opa1 ko thymocytes |
| GSE218907_3_v_2_opa1_mouse | opa1 flox cre female brown adipose wt sex f vs opa1 flox cre+ female brown adipose ko sex f |
| GSE232631_4_v_2_brca2_mouse | mammary epithelium luminal progenitors wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) wt vs mammary epithelium luminal progenitors mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) brca2ko |
| GSE232631_4_v_1_brca2_mouse | mammary epithelium luminal progenitors wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) wt vs mammary epithelium mature luminal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) brca2ko |
| GSE137818_2_v_6_brca2_mouse | mouse 4t1 brca1 ko untreated bulk rna seq rep strain balbc/j breast cell line tumor model vs 4t1 cell line brca2 ko bulk rna seq rep strain balbc/j breast |
| GSE137818_5_v_6_brca2_mouse | mouse 4t1 brca2 ko untreated bulk rna seq rep strain balbc/j breast cell line tumor model vs 4t1 cell line brca2 ko bulk rna seq rep strain balbc/j breast |
| GSE232631_0_v_2_brca2_mouse | mammary epithelium basal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) wt vs mammary epithelium luminal progenitors mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) brca2ko |
| GSE232631_0_v_1_brca2_mouse | mammary epithelium basal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) wt vs mammary epithelium mature luminal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) brca2ko |
| GSE137818_5_v_0_brca2_mouse | mouse 4t1 brca2 ko untreated bulk rna seq rep strain balbc/j breast cell line tumor model vs mouse 4t1 brca1 ko immunotherapy treated bulk rna seq rep strain balbc/j breast cell line tumor model |
| GSE232631_5_v_1_brca2_mouse | mammary epithelium mature luminal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) wt vs mammary epithelium mature luminal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) brca2ko |
| GSE232631_0_v_3_brca2_mouse | mammary epithelium basal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) wt vs mammary epithelium basal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) brca2ko |
| GSE137818_2_v_7_brca2_mouse | mouse 4t1 brca1 ko untreated bulk rna seq rep strain balbc/j breast cell line tumor model vs mouse 4t1 brca2 ko immunotherapy treated bulk rna seq rep strain balbc/j breast cell line tumor model |
| GSE137818_3_v_6_brca2_mouse | mouse 4t1 parental (brca wt) untreated bulk rna seq rep strain balbc/j breast brca wt cell line tumor model vs 4t1 cell line brca2 ko bulk rna seq rep strain balbc/j breast |
| GSE137818_3_v_7_brca2_mouse | mouse 4t1 parental (brca wt) untreated bulk rna seq rep strain balbc/j breast brca wt cell line tumor model vs mouse 4t1 brca2 ko immunotherapy treated bulk rna seq rep strain balbc/j breast cell line tumor model |
| GSE232631_4_v_3_brca2_mouse | mammary epithelium luminal progenitors wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) wt vs mammary epithelium basal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) brca2ko |
| GSE137818_5_v_1_brca2_mouse | mouse 4t1 brca2 ko untreated bulk rna seq rep strain balbc/j breast cell line tumor model vs 4t1 cell line brca1 ko bulk rna seq rep strain balbc/j breast |
| GSE232631_5_v_2_brca2_mouse | mammary epithelium mature luminal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) wt vs mammary epithelium luminal progenitors mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (lp) brca2ko |
| GSE232631_5_v_3_brca2_mouse | mammary epithelium mature luminal cells wildtype bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) (ml) wt vs mammary epithelium basal cells mmtvcre/brca2/trp53 knockdown bio rep strain mmtvcre brca2(fl/fl) trp53(fl/+) brca2ko |
| GSE111881_0_v_1_znf768_human | u2os cells control (replicate vs u2os cells znf768 dn (replicate inhibition |
| GSE215849_2_v_1_muc1_human | ls411n/tet muc1shrna dox brafi resistance resistant braf inhibitors cell line ls411n disease state colon cancer puromycin shrna muc1 control vs ls411n/tet muc1shrna brafi resistance resistant braf inhibitors cell line ls411n disease state colon cancer puromycin shrna muc1 dox c knockdown |
| GSE213996_1_v_0_fhl3_mouse | c2c12 wt cell line myoblasts myogenic differentiation time day 4 vs c2c12 fhl3 ko cell line myoblasts myogenic differentiation time day 4 |
| GSE213715_0_v_1_iqgap2_human | hacat cells normal control biol rep skin cell line aneuploid immortal keratinocyte wt vs hacat cells shiqgap2 biol rep skin cell line aneuploid immortal keratinocyte iqgap2 knockdown |
| GSE125153_1_v_0_bcl3_mouse | day 1 wt strain c57bl/6j wild type osteoblast differentiation time 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts vs day 1 bcl3âx88x92/âx88x92 strain c57bl/6j bcl3 knockout osteoblast differentiation time 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts |
| GSE125153_2_v_0_bcl3_mouse | day 3 wt strain c57bl/6j wild type osteoblast differentiation time days 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts vs day 1 bcl3âx88x92/âx88x92 strain c57bl/6j bcl3 knockout osteoblast differentiation time 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts |
| GSE125153_2_v_3_bcl3_mouse | day 3 wt strain c57bl/6j wild type osteoblast differentiation time days 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts vs day 3 bcl3âx88x92/âx88x92 strain c57bl/6j bcl3 knockout osteoblast differentiation time days 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts |
| GSE125153_1_v_3_bcl3_mouse | day 1 wt strain c57bl/6j wild type osteoblast differentiation time 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts vs day 3 bcl3âx88x92/âx88x92 strain c57bl/6j bcl3 knockout osteoblast differentiation time days 50 î¼g/ml l ascorbic acid & 2 mm î² glycerophospate neonatal calvarial osteoblasts |
| GSE138872,GSE138874_0_v_1_il33_mouse | wt tumour draining lymph nodes b16.f10 melanoma day 14 cd4+cd25+gitr+foxp3+ regulatory cells strain/ c57bl6 vs ko tumour draining lymph nodes b16.f10 melanoma day 14 cd4+cd25+gitr+foxp3+ regulatory cells strain/ il33 / c57bl6 background |
| GSE155530_1_v_0_ace2_human | conjunctival melanoma cell diagnosis tumor stage t3 knockdown control derived cm vs conjunctival melanoma cell shbace2 diagnosis tumor stage t3 knockdown bace2 derived cm |
| GSE247084,GSE247087_0_v_1_cdyl_mouse | wt cortex cell line na cdyl+/+ vs ko cortex cell line na cdyl / |
| GSE247084,GSE247087_0_v_1_cdyl_human | wt cortex cell line na cdyl+/+ vs ko cortex cell line na cdyl / |
| GSE207832_1_v_0_usp22_mouse | wt treg biol sample spleen regulatory cells n/ vs usp22/usp21 dko treg biol sample spleen regulatory cells usp21/usp22 ko n/ |
| GSE199543,GSE239447_0_v_4_ezh2_human | ko wt rnaseq k562 ezh2 ko/rescue antibody none vs ko dezh2 rnaseq k562 ezh2 ko/rescue antibody none |
| GSE92548_1_v_0_ezh2_mouse | wt background strain c57bl/6 wild type cell surface markers thymic natural killer cells vs ezh2 ko background strain c57bl/6 knock cell surface markers thymic natural killer cells |
| GSE122206_0_v_1_ezh2_mouse | lc wt strain background c57bl/6 /variation wild type skin langerhans cells vs lc ko strain background c57bl/6 /variation ezh2 / skin langerhans cells |
| GSE227518_1_v_0_ezh2_mouse | intestinal crypt stem cells wt hypoxia/reoxygenation vs intestinal crypt stem cells circezh2 005 overexpression hypoxia/reoxygenation |
| GSE171724_4_v_5_ezh2_mouse | wt tgf strain c57bl/6 pgr(+/+) ezh2(fl/fl) ("control") decidua decidual stromal cell 2 ng/ml transforming growth factor beta 1. cells vs ko bl strain c57bl/6 pgr(cre/+) ezh2(fl/fl) ("ezh2 cko") decidua decidual stromal cell none cells |
| GSE199543,GSE239447_0_v_6_ezh2_human | ko wt rnaseq k562 ezh2 ko/rescue antibody none vs ko mt2 rnaseq k562 ezh2 ko/rescue antibody none |
| GSE93674_1_v_0_ezh2_mouse | wild type rgc strain c57/bl6 retina age p0 vs ezh2 knockout non rgc strain c57/bl6 retina age p0 |
| GSE171724_1_v_6_ezh2_mouse | wt bl strain c57bl/6 pgr(+/+) ezh2(fl/fl) ("control") decidua decidual stromal cell none cells vs ko tgf strain c57bl/6 pgr(cre/+) ezh2(fl/fl) ("ezh2 cko") decidua decidual stromal cell 2 ng/ml transforming growth factor beta 1. cells |
| GSE150032,GSE181873_3_v_2_ezh2_mouse | tie2 ezh2 developmental stages e10.5 strain c57bl/6 yolk sac ezh2fl/fl cre+/+ wild type without cre erythro myeloid progenitors vs vav ezh2 developmental stages e10.5 strain c57bl/6 yolk sac ezh2fl/fl cretg/+ ko mediated cre erythro myeloid progenitors |
| GSE226584,GSE226589_1_v_0_ezh2_human | sw480 ev kd cell line primary colorectal cancer cells wt untreated time 72 hours vs sw480 ptenkd ezh2i cell line primary colorectal cancer cells pten knockdown ezh2 inhibitor time 72 hours |
| GSE226584,GSE226589_3_v_0_ezh2_human | sw480 ev kd ezh2i cell line primary colorectal cancer cells wt ezh2 inhibitor time 72 hours vs sw480 ptenkd ezh2i cell line primary colorectal cancer cells pten knockdown ezh2 inhibitor time 72 hours |
| GSE222114,GSE222115_1_v_0_ezh2_human | early erythroid cells scramble shrna day 7 control erythropoiesis vs early erythroid cells ezh2 shrna day 7 knockdown erythropoiesis |
| GSE112995,GSE132079_1_v_0_ezh2_mouse | rna seq lsk wt strain background c57bl/6 /variation bone marrow cells cell population facs sorted vs rna seq lsk g12d ezh2 ko strain background c57bl/6 /variation bone marrow cells cell population facs sorted |
| GSE199543,GSE239447_2_v_4_ezh2_human | ko ctrl rnaseq k562 ezh2 ko/rescue antibody none vs ko dezh2 rnaseq k562 ezh2 ko/rescue antibody none |
| GSE93674_2_v_3_ezh2_mouse | wild type non rgc strain c57/bl6 retina age p0 vs ezh2 knockout rgc strain c57/bl6 retina age p0 |
| GSE84462,GSE84762_2_v_7_ezh2_mouse | cas9 tumor p53 / p18 expression modification control mouse vs sjmmmb018132 19568 ezh2 ko tumor rep p53 / p18 expression modification mouse |
| GSE226584,GSE226589_2_v_0_ezh2_human | sw480 ptenkd cell line primary colorectal cancer cells pten knockdown untreated time 72 hours vs sw480 ptenkd ezh2i cell line primary colorectal cancer cells pten knockdown ezh2 inhibitor time 72 hours |
| GSE162623_0_v_1_ezh2_human | wild type clone bone marrow cell line k 562 vs ezh2 knockout clone bone marrow cell line k 562 / |
| GSE93674_2_v_0_ezh2_mouse | wild type non rgc strain c57/bl6 retina age p0 vs ezh2 knockout non rgc strain c57/bl6 retina age p0 |
| GSE111245_0_v_1_ezh2_mouse | ezh2 wt osx calvaria wild type (wt osx) age 2 3 day old vs ezh2 cko osx calvaria conditional knockout (ezh2 osx) age 2 3 day old |
| GSE150032,GSE181873_3_v_1_ezh2_mouse | tie2 ezh2 developmental stages e10.5 strain c57bl/6 yolk sac ezh2fl/fl cre+/+ wild type without cre erythro myeloid progenitors vs tie2 ezh2 developmental stages e10.5 strain c57bl/6 yolk sac ezh2fl/fl cretg/+ ko mediated cre erythro myeloid progenitors |
| GSE127261_1_v_2_ezh2_human | jurkat ezh2 wt lymphocyte status cell line vs jukat ezh2 lymphocyte status ko jurkat cell line |
| GSE171724_4_v_6_ezh2_mouse | wt tgf strain c57bl/6 pgr(+/+) ezh2(fl/fl) ("control") decidua decidual stromal cell 2 ng/ml transforming growth factor beta 1. cells vs ko tgf strain c57bl/6 pgr(cre/+) ezh2(fl/fl) ("ezh2 cko") decidua decidual stromal cell 2 ng/ml transforming growth factor beta 1. cells |
| GSE84462,GSE84762_0_v_1_ezh2_mouse | x1 wt gnp myc gfi1 tumor expression modification oe granule neural precurser vs ezh2 ko tumor p53 / p18 expression modification mouse |
| GSE84462,GSE84762_0_v_7_ezh2_mouse | x1 wt gnp myc gfi1 tumor expression modification oe granule neural precurser vs sjmmmb018132 19568 ezh2 ko tumor rep p53 / p18 expression modification mouse |
| GSE171724_1_v_5_ezh2_mouse | wt bl strain c57bl/6 pgr(+/+) ezh2(fl/fl) ("control") decidua decidual stromal cell none cells vs ko bl strain c57bl/6 pgr(cre/+) ezh2(fl/fl) ("ezh2 cko") decidua decidual stromal cell none cells |
| GSE199543,GSE239447_2_v_1_ezh2_human | ko ctrl rnaseq k562 ezh2 ko/rescue antibody none vs ko mt1 rnaseq k562 ezh2 ko/rescue antibody none |
| GSE80222_1_v_0_ezh2_mouse | mrna strain background c57bl/6 129 developmental stage e13.5 /variation wild type embryonic cerebellum wt vs mrna strain background c57bl/6 129 developmental stage e13.5 /variation ezh2 deletion embryonic cerebellum ezh2ko |
| GSE221932,GSE222115_0_v_1_ezh2_human | late erythroid cells scramble shrna day 15 control erythropoiesis vs late erythroid cells ezh2 shrna day 15 knockdown erythropoiesis |
| GSE84462,GSE84762_2_v_1_ezh2_mouse | cas9 tumor p53 / p18 expression modification control mouse vs ezh2 ko tumor p53 / p18 expression modification mouse |
| GSE112995,GSE132079_1_v_3_ezh2_mouse | rna seq lsk wt strain background c57bl/6 /variation bone marrow cells cell population facs sorted vs rna seq lsk ezh2 ko strain background c57bl/6 /variation bone marrow cells cell population facs sorted |
| GSE132386_1_v_0_ppara_mouse | wild type liver wy 14 643 diet g134 strain c57bl/6j sex male age 12 weeks old /variation vs ppara ko liver wy 14 643 g134 strain c57bl/6j sex male age 12 weeks old /variation diet |
| GSE132386_2_v_0_ppara_mouse | wild type liver control diet g134 strain c57bl/6j sex male age 12 weeks old /variation vs ppara ko liver wy 14 643 g134 strain c57bl/6j sex male age 12 weeks old /variation diet |
| GSE87299_2_v_3_nr1d1_mouse | bmal1 control ct0 strain c57bl/6 liver age 8 weeks vs nr1d1 ko strain knockout liver age 8 weeks |
| GSE87299_1_v_0_nr1d1_mouse | nr1d1 control strain c57bl/6 liver age 8 weeks vs bmal1 ko ct12 strain knockout liver age 8 weeks |
| GSE178418_1_v_0_traf3_mouse | wt strain c57bl/6 liver wild type vs ko strain c57bl/6 liver alb creert2(+) pten fl/fl traf3 |
| GSE179002_4_v_1_caprin1_mouse | rna seq wt 2h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 2h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_0_v_8_caprin1_mouse | rna seq wt 4h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 8h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_2_v_6_caprin1_mouse | rna seq wt 0h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 0h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_3_v_8_caprin1_mouse | rna seq wt 8h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 8h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_2_v_8_caprin1_mouse | rna seq wt 0h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 8h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_0_v_7_caprin1_mouse | rna seq wt 4h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 4h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_0_v_6_caprin1_mouse | rna seq wt 4h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 0h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_4_v_6_caprin1_mouse | rna seq wt 2h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 0h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_3_v_7_caprin1_mouse | rna seq wt 8h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 4h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_0_v_1_caprin1_mouse | rna seq wt 4h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 2h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_2_v_7_caprin1_mouse | rna seq wt 0h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 4h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_3_v_1_caprin1_mouse | rna seq wt 8h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 2h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_3_v_6_caprin1_mouse | rna seq wt 8h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 0h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_4_v_7_caprin1_mouse | rna seq wt 2h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 4h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_4_v_8_caprin1_mouse | rna seq wt 2h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 8h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE179002_2_v_1_caprin1_mouse | rna seq wt 0h rep embryonic stem cells (escs) alpha amanitin time escs vs rna seq caprin1 ko clone 2h rep 1 embryonic stem cells (escs) alpha amanitin time caprin escs |
| GSE183474_1_v_0_lats1_human | hek293t cells cell line control vs hek293t cells cell line lats1 knockdown |
| GSE124471,GSE124488_2_v_3_lats1_mouse | wt intestinal stromal cell strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ cells sorting method facs sorted vs lats1/2 ko lec strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ lats1f/f lats2 f/f lacteal lecs sorting method facs sorted |
| GSE134615_1_v_0_lats1_human | wt cell line mcf 7 breast cancer passage 12 18 origin /variation wild type vs l12ko cell line mcf 7 breast cancer passage 12 18 origin /variation lats1/2 knockout |
| GSE124471,GSE124488_1_v_3_lats1_mouse | wt lec strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ lacteal lecs sorting method facs sorted vs lats1/2 ko lec strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ lats1f/f lats2 f/f lacteal lecs sorting method facs sorted |
| GSE241847_1_v_0_lats1_human | kle cells cell line wt vs kle cells lats1/2 cell line double knockout |
| GSE124471,GSE124488_1_v_0_lats1_mouse | wt lec strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ lacteal lecs sorting method facs sorted vs lats1/2 ko intestinal stromal cell strain c57bl/6j developmental stage adult pdgfrb+ creert2 tomato+ lats1f/f lats2 f/f cells sorting method facs sorted |
| GSE133555_0_v_1_npm1_mouse | kp doxycline cells npm1 wt vs kp dox transfection plko.1 tet shnpm1 100ng/ml doxycline cells npm1 knockdown |
| GSE108675_2_v_1_slc1a4_mouse | wt striatum strain c57bl/6 age 5 months sex male wild type vs ko cerebral cortex strain c57bl/6 age 5 months sex male slc1a4 / asct1 |
| GSE108675_3_v_0_slc1a4_mouse | wt cerebral cortex strain c57bl/6 age 5 months sex male wild type vs ko striatum strain c57bl/6 age 5 months sex male slc1a4 / asct1 |
| GSE148262,GSE150691_3_v_2_hdlbp_human | rna seq a549 wt hdlbp replicate cell line vs rna seq tumor hdlbp ko knockout replicate a549 |
| GSE148262,GSE150691_1_v_2_hdlbp_human | rna seq tumor wt hdlbp replicate a549 vs rna seq tumor hdlbp ko knockout replicate a549 |
| GSE148262,GSE150691_1_v_0_hdlbp_human | rna seq tumor wt hdlbp replicate a549 vs rna seq a549 hdlbp ko knockout replicate cell line |
| GSE241875_1_v_0_huwe1_mouse | liver wt 1 year old vs liver specific huwe1 ko 1 year old |
| GSE85723,GSE85833_1_v_0_huwe1_mouse | rna sequencing murine hsc huwe1 wt replicate bone marrow hematopoietic stem cells wild type derived vs rna sequencing murine hsc huwe1 ko cre) replicate bone marrow hematopoietic stem cells derived |
| GSE211215_1_v_0_akr1b1_human | shnc lung cancer cell line pc9 brm3 wt routine culture vs shakr1b10 lung cancer cell line pc9 brm3 akr1b10 knockdown routine culture |
| GSE214505_0_v_1_akr1b1_human | shctrl (plko) glucose cell line a549 nsclc wt 5 mm time 5days post transduction vs shakr1b1#09 fructose cell line a549 nsclc akr1b1 knockdown 5 mm time 5days post transduction |
| GSE249714_0_v_1_anxa1_mouse | anxa1 wt ap pancreas flox/flox repeated injection cerulein vs anxa1 cko ap pancreas myeloid specific knockout repeated injection cerulein |
| GSE240468_3_v_6_nfyc_human | lung cell line h520 squamous carcinoma cells wt vs lung cell line h520 squamous carcinoma cells nfyc as1 knockdown |
| GSE240468_3_v_2_nfyc_human | lung cell line h520 squamous carcinoma cells wt vs lung cell line h520 squamous carcinoma cells nfyc as1 knockout |
| GSE167218_1_v_0_hoxd12_mouse | esc wt developmental stage e3.5 embryo strain c57bl6 wild type embryonic stem cells escs vs esc ko hoxd12 developmental stage e3.5 embryo strain c57bl6 / embryonic stem cells escs |
| GSE210990,GSE211030_3_v_1_kmt2d_mouse | rna wt disease state primary medulloblastoma cerebellum anatomic location right hemisphere granule cell precursors smom2 overexpression vs rna methm disease state medulloblastoma spinal metastasis cord anatomic location spine smom2 overexpression kmt2d ko |
| GSE147210_2_v_5_kmt2d_mouse | rnaseq shren strain c57bl/6 hematopoietic stem progenitor cells kmt2d wt vs rnaseq kmt2d strain c57bl/6 bone marrow cells knockdown |
| GSE147210_3_v_5_kmt2d_mouse | rnaseq dmso strain c57bl/6 bone marrow cells treated aml vs rnaseq kmt2d strain c57bl/6 bone marrow cells knockdown |
| GSE210990,GSE211030_3_v_2_kmt2d_mouse | rna wt disease state primary medulloblastoma cerebellum anatomic location right hemisphere granule cell precursors smom2 overexpression vs rna hm disease state primary medulloblastoma cerebellum anatomic location hemisphere granule cell precursors smom2 overexpression kmt2d ko |
| GSE147210_3_v_4_kmt2d_mouse | rnaseq dmso strain c57bl/6 bone marrow cells treated aml vs rnaseq shkmt2d strain c57bl/6 hematopoietic stem progenitor cells kmt2d knockdown |
| GSE130081,GSE130082_5_v_1_neil2_mouse | ebs ra control cell line e14tg2a wild type embryoid bodies (ebs) treated retinoic acid (ra) vs ebs neil2 ko cell line e14tg2a knockout embryoid bodies (ebs) |
| GSE130081,GSE130082_5_v_10_neil2_mouse | ebs ra control cell line e14tg2a wild type embryoid bodies (ebs) treated retinoic acid (ra) vs mescs neil2 ko cell line e14tg2a knockout undifferentiated |
| GSE130081,GSE130082_0_v_1_neil2_mouse | ebs control cell line e14tg2a wild type embryoid bodies (ebs) vs ebs neil2 ko cell line e14tg2a knockout embryoid bodies (ebs) |
| GSE130081,GSE130082_0_v_10_neil2_mouse | ebs control cell line e14tg2a wild type embryoid bodies (ebs) vs mescs neil2 ko cell line e14tg2a knockout undifferentiated |
| GSE130081,GSE130082_4_v_1_neil2_mouse | mescs control cell line e14tg2a wild type undifferentiated vs ebs neil2 ko cell line e14tg2a knockout embryoid bodies (ebs) |
| GSE147669_2_v_1_tram2_human | mcf10a control cell line condition cells transduced empty vector vs mcf10a tram2 cell line condition cells transduced overexpression vector |
| GSE238005_5_v_3_c9orf72_human | ipsc derived neural stem cells control 5280 cell line nd05280 vs ipsc derived neural stem cells c9ko cell line nd03231 c9orf72 knockout |
| GSE238005_7_v_3_c9orf72_human | ipsc derived neural stem cells control 3231 cell line nd03231 vs ipsc derived neural stem cells c9ko cell line nd03231 c9orf72 knockout |
| GSE143743_0_v_2_c9orf72_human | c9gc 1 gene corrected (wild type c9orf72 protein lacking als mutation) ipsc derived motor neurons vs c9ko 1 hexanucleotide repeat expansion intron c9orf72 gene well knockout start codon exon 2 ipsc derived motor neurons |
| GSE238005_0_v_3_c9orf72_human | ipsc derived neural stem cells control 3719 cell line nd03719 vs ipsc derived neural stem cells c9ko cell line nd03231 c9orf72 knockout |
| GSE238005_2_v_3_c9orf72_human | ipsc derived neural stem cells iso c1 cell line nd06769 isogenic control corrected vs ipsc derived neural stem cells c9ko cell line nd03231 c9orf72 knockout |
| GSE238005_4_v_3_c9orf72_human | ipsc derived neural stem cells control 00184 cell line nd00184 vs ipsc derived neural stem cells c9ko cell line nd03231 c9orf72 knockout |
| GSE51684,GSE51741_2_v_4_c9orf72_human | tx fibroblast gender age years known relevant mutations diagnosis non neurologic control disease onset n/ course drug aso cells transfected nuclear rnase h dependent antisense oligonucleotide targeting exon 2 hs c9orf72. shown previous work efficiently knockdown isoforms primary cell cultures vs fibroblast gender male age years unknown mutation diagnosis sporadic als disease onset course time biopsy drug aso cells exposed cytofectin transfection reagent four hours transfected primary cell cultures |
| GSE169263_1_v_0_armc5_mouse | adrenal glands wt strain background 129 sv x cd1 sex female age 30 weeks vs adrenal glands ko strain background 129 sv x cd1 armc5( / ) sex female age 30 weeks |
| GSE240386,GSE242143_1_v_5_morc2_human | dnmt1 morc2 doublecrispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs morc2 crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_8_v_6_morc2_human | morc2 tasor crispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs dnmt1 crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_8_v_5_morc2_human | morc2 tasor crispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs morc2 crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_8_v_4_morc2_human | morc2 tasor crispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs dnmt1 morc2 doublecrispri cell line sai2 human neuroepithelial like stem cells double knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_1_v_3_morc2_human | dnmt1 morc2 doublecrispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs tasor crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_1_v_4_morc2_human | dnmt1 morc2 doublecrispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs dnmt1 morc2 doublecrispri cell line sai2 human neuroepithelial like stem cells double knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_1_v_6_morc2_human | dnmt1 morc2 doublecrispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs dnmt1 crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE240386,GSE242143_8_v_3_morc2_human | morc2 tasor crispri control cell line sai2 human neuroepithelial like stem cells crispr interference time 10 days transduction vs tasor crispri cell line sai2 human neuroepithelial like stem cells knockdown crispr interference time 10 days transduction |
| GSE72491_0_v_1_pcbp2_mouse | wt age 12.5 days post coitum /variation wild type fetal liver vs pcbp2 ko age 12.5 days post coitum /variation knockout fetal liver |
| GSE101859_1_v_0_rhoj_mouse | rhoj wt rep strain c57bl/6 braf ca/+ pten fl/+ cre +/+ mouse primary tumor vs rhoj ko rep strain c57bl/6 braf ca/+ pten fl/+ cre / mouse primary tumor |
| GSE184902_3_v_1_adipor1_mouse | bulk rna seq wt rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j vs bulk rna seq ko rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j adipor1 / |
| GSE184902_3_v_0_adipor1_mouse | bulk rna seq wt rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j vs bulk rna seq ko retina p30 age (days) 30 strain c57bl/6j adipor1 / |
| GSE184902_4_v_1_adipor1_mouse | bulk rna seq wt retina p30 age (days) 30 strain c57bl/6j vs bulk rna seq ko rpe p30 retinal pigmented epithelium cells age (days) 30 strain c57bl/6j adipor1 / |
| GSE184902_4_v_0_adipor1_mouse | bulk rna seq wt retina p30 age (days) 30 strain c57bl/6j vs bulk rna seq ko retina p30 age (days) 30 strain c57bl/6j adipor1 / |
| GSE120200,GSE127269_1_v_2_asxl1_human | embryonic stem cell derived neuronal crest progenitor culture day protocol 7 wildtype neural differentiation vs embryonic stem cell derived neuronal crest progenitor culture day protocol 7 homozygous 500 bp deletion asxl1 neural differentiation |
| GSE44157,GSE44163_3_v_0_nr6a1_mouse | wt sictrl murine msc cell line dicer f/f strain c57bl/6 vs ko sinr6a1 murine msc cell line dicer / strain c57bl/6 |
| GSE44157,GSE44163_1_v_0_nr6a1_mouse | ko sictrl murine msc cell line dicer / strain c57bl/6 vs ko sinr6a1 murine msc cell line dicer / strain c57bl/6 |
| GSE211955_1_v_0_jmjd4_mouse | jmjd4 flox heart cardiomyocytes control (jmjd4f/f) tamoxifen time day 14 inducement vs jmjd4 cko heart cardiomyocytes knockout (mcm+ jmjd4f/f (myh6 cre)) tamoxifen time day 14 inducement |
| GSE156667_0_v_1_lrrc8a_mouse | cell line immortalized mouse myoblast c2c12 wild type (wt) vs cell line immortalized mouse myoblast c2c12 swell1 (lrrc8a) ko |
| GSE190761_0_v_1_samd1_human | rna seq hepg2 control vs rna seq hepg2 samd1 ko |
| GSE207853_2_v_0_mafg_mouse | control (mafg+/ mafk+/ ) developmental stage embryonic day e16.5 lens vs double ko (mafg / mafk ) developmental stage embryonic day e16.5 lens |
| GSE180641_0_v_1_zfp503_mouse | rpe wt [160121 optimus strain c57bl/6 retinal pigment epithelium age e11.5 wild type vs rpe zfp503 ko [160121 optimus strain c57bl/6 retinal pigment epithelium age e11.5 / |
| GSE136232,GSE136234_0_v_1_zpbp2_mouse | b6 rna wt strain c57bl/6j lung time zt7 /variation vs 62 rna mut strain c57bl/6j lung time zt7 /variation zpbp2 ko |
| GSE136233,GSE136234_0_v_1_zpbp2_mouse | strain c57bl/6j lung time zt10 /variation wt vs strain c57bl/6j lung time zt10 /variation zpbp2 ko |
| GSE157233_1_v_4_a1cf_mouse | hepatocytes wt strain c57bl/6j age 12 weeks isolated vs liver 12mo acf ko strain a1cf / age 12 months |
| GSE157233_5_v_4_a1cf_mouse | liver 12mo wt nj strain c57bl/6nj age 12 months vs liver 12mo acf ko strain a1cf / age 12 months |
| GSE157233_2_v_4_a1cf_mouse | liver 12mo wt strain c57bl/6j age 12 months vs liver 12mo acf ko strain a1cf / age 12 months |
| GSE108547_2_v_0_a1cf_mouse | wt liver strain c57bl/6 age 6 8 weeks old wild type vs ko liver strain c57bl/6 age 6 8 weeks old a1cf / |
| GSE207978_1_v_0_rai1_mouse | wild type nih3t3 cells cell line wt serum starvation vs rai16 ko nih3t3 cells cell line serum starvation |
| GSE154577_6_v_9_plagl1_human | htr 8 ctrl rep5 cell line placental 8/svneo negative control sirna vs htr 8 kd rep7 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_2_v_12_plagl1_human | htr 8 ctrl rep6 cell line placental 8/svneo negative control sirna vs htr 8 kd rep6 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_6_v_5_plagl1_human | htr 8 ctrl rep5 cell line placental 8/svneo negative control sirna vs htr 8 kd rep5 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_7_v_12_plagl1_human | htr 8 ctrl rep7 cell line placental 8/svneo negative control sirna vs htr 8 kd rep6 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_6_v_12_plagl1_human | htr 8 ctrl rep5 cell line placental 8/svneo negative control sirna vs htr 8 kd rep6 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_6_v_10_plagl1_human | htr 8 ctrl rep5 cell line placental 8/svneo negative control sirna vs htr 8 kd 1 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_7_v_9_plagl1_human | htr 8 ctrl rep7 cell line placental 8/svneo negative control sirna vs htr 8 kd rep7 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_2_v_9_plagl1_human | htr 8 ctrl rep6 cell line placental 8/svneo negative control sirna vs htr 8 kd rep7 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_2_v_5_plagl1_human | htr 8 ctrl rep6 cell line placental 8/svneo negative control sirna vs htr 8 kd rep5 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_13_v_10_plagl1_human | htr 8 ctrl cell line placental 8/svneo negative control sirna vs htr 8 kd 1 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_13_v_5_plagl1_human | htr 8 ctrl cell line placental 8/svneo negative control sirna vs htr 8 kd rep5 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_2_v_10_plagl1_human | htr 8 ctrl rep6 cell line placental 8/svneo negative control sirna vs htr 8 kd 1 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE154577_7_v_10_plagl1_human | htr 8 ctrl rep7 cell line placental 8/svneo negative control sirna vs htr 8 kd 1 cell line placental 8/svneo plagl1 sirna knockdown |
| GSE189172,GSE189173_2_v_0_traf6_mouse | bone marrow wt lsk vs traf6 bone marrow ko lsk |
| GSE135309_0_v_1_tcf7_mouse | strain c57bl/6 lung infiltrating cd8+ cells age 10 week old tcf7 wildtype mouse vs strain c57bl/6 lung infiltrating cd8+ cells age 10 week old tcf7 knockout mouse |
| GSE162449_0_v_1_tcf7_mouse | wt strain c57bl/6 liver age 12 week old wild type refeeding ncd 24 h mouse vs tcf strain c57bl/6 liver age 12 week old tcf7l2 specific knockout refeeding ncd 24 h mouse |
| GSE129402,GSE129405_1_v_0_tcf7_mouse | tcf7 f/f strain c57bl/6 inguinal white adipose age 6 months wild type diet hfd 16 weeks vs tcf7 ko strain c57bl/6 inguinal white adipose age 6 months tcf7l2 diet hfd 16 weeks |
| GSE128145_2_v_0_ctbp2_mouse | ctbp2 wild type overexpression ten 002 strain c57bl6/j diet induced obesity virus adenovirus mediated liver vs ctbp2 mutant overexpression ten 002 strain c57bl6/j diet induced obesity virus adenovirus mediated liver |
| GSE125025_2_v_3_lyl1_mouse | wt replicate strain c57bl/6j megakaryocytes /variation wildtype primary megakaryocyte culture vs double knockout replicate strain c57bl/6j megakaryocytes /variation scl/tal1/lyl1 primary megakaryocyte culture |
| GSE120216_3_v_0_cbfb_human | wt cell line mcf10a cells (atcc crl 10317) /variation passages less 30 vs cbfb ko cell line mcf10a cells (atcc crl 10317) /variation passages less 30 |
| GSE210383_0_v_1_trim71_mouse | 3ha control cochlear organoid culture lentiviral ha overexpression vs trim71 cochlear organoid culture lentiviral overexpression |
| GSE144484_2_v_1_mllt6_human | mock cells ifng replicate cell line u2os tumor type osteosarcoma mllt6 wildtype bone vs mllt6 knockout without ifng replicate cell line u2os tumor type osteosarcoma bone |
| GSE144484_0_v_3_mllt6_human | mock cells without ifng replicate cell line u2os tumor type osteosarcoma mllt6 wildtype bone vs mllt6 knockout ifng replicate cell line u2os tumor type osteosarcoma bone |
| GSE144484_0_v_1_mllt6_human | mock cells without ifng replicate cell line u2os tumor type osteosarcoma mllt6 wildtype bone vs mllt6 knockout without ifng replicate cell line u2os tumor type osteosarcoma bone |
| GSE144484_2_v_3_mllt6_human | mock cells ifng replicate cell line u2os tumor type osteosarcoma mllt6 wildtype bone vs mllt6 knockout ifng replicate cell line u2os tumor type osteosarcoma bone |
| GSE139966_4_v_2_figla_mouse | figla e18.5 control strain b6d2f1 inbred age embryonic day 18.5 /variation figla+/ ovary vs figla e18.5 ko strain b6d2f1 inbred age embryonic day 18.5 /variation / ovary |
| GSE139966_1_v_0_figla_mouse | lhx8 p0 control strain b6d2f1 inbred age postnatal day 0 /variation lhx8+/ ovary vs figla p0 ko strain b6d2f1 inbred age postnatal day 0 /variation / ovary |
| GSE139966_4_v_3_figla_mouse | figla e18.5 control strain b6d2f1 inbred age embryonic day 18.5 /variation figla+/ ovary vs lhx8 p0 ko strain b6d2f1 inbred age postnatal day 0 /variation / ovary |
| GSE139966_4_v_0_figla_mouse | figla e18.5 control strain b6d2f1 inbred age embryonic day 18.5 /variation figla+/ ovary vs figla p0 ko strain b6d2f1 inbred age postnatal day 0 /variation / ovary |
| GSE139966_5_v_3_figla_mouse | figla p0 control strain b6d2f1 inbred age postnatal day 0 /variation figla+/ ovary vs lhx8 p0 ko strain b6d2f1 inbred age postnatal day 0 /variation / ovary |
| GSE139966_1_v_2_figla_mouse | lhx8 p0 control strain b6d2f1 inbred age postnatal day 0 /variation lhx8+/ ovary vs figla e18.5 ko strain b6d2f1 inbred age embryonic day 18.5 /variation / ovary |
| GSE254526,GSE254528_0_v_1_phf19_human | control homo sapiens cell line kasumi 1 acute myeloblastic leukemia wt vs shphf19 homo sapiens cell line kasumi 1 acute myeloblastic leukemia phf19 knockdown |
| GSE147771_2_v_3_aplp2_mouse | wild type aged [ 4] strain background c57bl/6j age post natal day 750 sex male olfactory epithelium mucosa vs aplp2 ko [ 2] strain background c57bl/6j / age post natal day 60 sex male olfactory epithelium mucosa |
| GSE145323,GSE145324_1_v_0_rfx3_mouse | rfx3 of1 wt strain/background c57bl/6 /variation wild type brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells vs rfx2 of1 ko strain/background c57bl/6 /variation / brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells |
| GSE145323,GSE145324_1_v_2_rfx3_mouse | rfx3 of1 wt strain/background c57bl/6 /variation wild type brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells vs rfx3 of1 ko strain/background c57bl/6 /variation / brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells |
| GSE145323,GSE145324_9_v_2_rfx3_mouse | rfx2 of1 wt strain/background c57bl/6 /variation wild type brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells vs rfx3 of1 ko strain/background c57bl/6 /variation / brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells |
| GSE145323,GSE145324_1_v_4_rfx3_mouse | rfx3 of1 wt strain/background c57bl/6 /variation wild type brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells vs rfx1 of1 ko strain/background c57bl/6 /variation / brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells |
| GSE145323,GSE145324_3_v_2_rfx3_mouse | rfx1 of1 wt strain/background c57bl/6 /variation wild type brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells vs rfx3 of1 ko strain/background c57bl/6 /variation / brain lateral ventricles age e18.5 ex vivo differentiated ependymal cells |
| GSE168676_0_v_3_dach1_mouse | hetn stz strain background c57bl/6 /variation control injection glomeruli + vs ko stz strain background c57bl/6 /variation podocyte specific dach1 injection glomeruli + |
| GSE168676_2_v_3_dach1_mouse | ctrl strain background c57bl/6 /variation control (baseline) glomeruli vs ko stz strain background c57bl/6 /variation podocyte specific dach1 injection glomeruli + |
| GSE168676_0_v_1_dach1_mouse | hetn stz strain background c57bl/6 /variation control injection glomeruli + vs ko strain background c57bl/6 /variation podocyte specific dach1 (baseline) glomeruli |
| GSE183101_0_v_1_hvcn1_human | 293t wt human embryonic kidney cell line cells vs 293t hvcn1 ko human embryonic kidney cell line cells |
| GSE147366_1_v_5_med13_human | wt nt rep. hap1 cells sample number treated vs med13 ko #10 mms rep. hap1 cells sample number 125 âµm treated |
| GSE147366_3_v_0_med13_human | wt mms rep. hap1 cells sample number 125 âµm treated vs med13 ko #17 mms rep. hap1 cells sample number 125 âµm treated |
| GSE90710_1_v_0_med13_mouse | scr mo control /variation negative scrambled morpholino embryos vs med13 mo case /variation knockdown morpholino oligonucleotides targeting transcription start site embryos |
| GSE147366_1_v_2_med13_human | wt nt rep. hap1 cells sample number treated vs med13 ko #10 nt rep. hap1 cells sample number treated |
| GSE147366_3_v_4_med13_human | wt mms rep. hap1 cells sample number 125 âµm treated vs med13 ko #17 nt rep. hap1 cells sample number treated |
| GSE147366_3_v_5_med13_human | wt mms rep. hap1 cells sample number 125 âµm treated vs med13 ko #10 mms rep. hap1 cells sample number 125 âµm treated |
| GSE147366_1_v_4_med13_human | wt nt rep. hap1 cells sample number treated vs med13 ko #17 nt rep. hap1 cells sample number treated |
| GSE147366_1_v_0_med13_human | wt nt rep. hap1 cells sample number treated vs med13 ko #17 mms rep. hap1 cells sample number 125 âµm treated |
| GSE147366_3_v_2_med13_human | wt mms rep. hap1 cells sample number 125 âµm treated vs med13 ko #10 nt rep. hap1 cells sample number treated |
| GSE215109_0_v_2_ep400_mouse | o9 1 wt biol rep cell line murine cranial neural crest vs ep400 knockout clone 1 cell line o9 murine cranial neural crest |
| GSE166169_0_v_3_elp3_mouse | bmdm elp3 ko il4 untreated bone marrow derived macrophages strain c57bl/6 vs bmdm elp3 ko il4 treated bone marrow derived macrophages strain c57bl/6 |
| GSE166169_2_v_3_elp3_mouse | bmdm wt il4 untreated bone marrow derived macrophages strain c57bl/6 vs bmdm elp3 ko il4 treated bone marrow derived macrophages strain c57bl/6 |
| GSE166169_1_v_3_elp3_mouse | bmdm wt il4 treated bone marrow derived macrophages strain c57bl/6 vs bmdm elp3 ko il4 treated bone marrow derived macrophages strain c57bl/6 |
| GSE217873_1_v_2_nusap1_human | panc1 cells control pancreas cell line pancreatic ductal adenocarcinoma wt vs panc1 cells flag nusap1 pancreas cell line pancreatic ductal adenocarcinoma overexpression transfected overexpressed plasmid targeted |
| GSE217873_1_v_0_nusap1_human | panc1 cells control pancreas cell line pancreatic ductal adenocarcinoma wt vs panc1 cells sinusap1 pancreas cell line pancreatic ductal adenocarcinoma nusap1 knockdown transfected sirna targeted |
| GSE200982_0_v_2_plac8_human | huh7.5 cells scramble sads cov infected 24 hours biol rep cell line hepatocarcinoma wt infection time post vs huh7.5 cells plac8 ko biol rep cell line hepatocarcinoma knockout mock time applicable |
| GSE112365_0_v_1_sirt1_human | wt cell line bt549 breast cancer /variation wildtype cells vs sirt1 ko cell line bt549 breast cancer /variation cells |
| GSE182854_2_v_3_sirt1_human | control breast cell line mda mb 231 cells untreated vs sirt1+igf2bp2 double kd breast cell line mda mb 231 cells knockdown |
| GSE186065_0_v_1_sirt1_mouse | sirt1 control age 6 8 weeks old uterus vs sirt1 ko age 6 8 weeks old uterus |
| GSE182854_2_v_0_sirt1_human | control breast cell line mda mb 231 cells untreated vs sirt1 kd breast cell line mda mb 231 cells sirtuin 1 (sirt1) knockdown |
| GSE163920_1_v_0_sirt1_mouse | sirt1wt background strain 129sv/j gender male embryonic stem cells wild type vs sirt1ko background strain 129sv/j gender male embryonic stem cells sirt1 ko |
| GSE138672_4_v_3_rabgef1_mouse | age p10 /variation rabgef1 wt retina retinal transcriptome mice vs age p6 /variation rabgef1 ko retina retinal transcriptome mice |
| GSE138672_0_v_1_rabgef1_mouse | age p6 /variation rabgef1 wt retina retinal transcriptome mice vs age p10 /variation rabgef1 ko retina retinal transcriptome mice |
| GSE226181_3_v_0_akt1s1_mouse | og2 3dpp testis primary spermatogonia pou5f1 gfp wt vs akt1s1 ko testis primary spermatogonia pou5f1 gfp null |
| GSE226181_3_v_2_akt1s1_mouse | og2 3dpp testis primary spermatogonia pou5f1 gfp wt vs akt1s1 ko 7dpp testis primary spermatogonia pou5f1 gfp null |
| GSE137914_4_v_3_tet3_mouse | ctl cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_0_v_3_tet3_mouse | ctl cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE222500,GSE222501_1_v_0_tet3_mouse | wt rna seq gv oocytes tet3 lcdf/f vs ko rna seq gv oocytes tet3 lcdf/f zp3 cre |
| GSE137914_0_v_5_tet3_mouse | ctl cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_2_v_1_tet3_mouse | ctl b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93+ b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_2_v_5_tet3_mouse | ctl b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_0_v_1_tet3_mouse | ctl cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93+ b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_2_v_3_tet3_mouse | ctl b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_4_v_5_tet3_mouse | ctl cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93 cd23+cd21 int b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE137914_4_v_1_tet3_mouse | ctl cd93 cd23 cd21 io b cells primary freshly isolated spleen strain c57bl/6 control cell markers vs tet ko cd93+ b cells primary freshly isolated spleen strain c57bl/6 tet2/tet3 deficient cell markers |
| GSE193588_1_v_0_pax3_mouse | splotch wt strain mixed pax3 wild type age embryonic day 12.5 (e12.5) embryo e12.5 vs carm1 ko strain c57bl/6 null age embryonic day 12.5 (e12.5) embryo e12.5 |
| GSE193588_1_v_2_pax3_mouse | splotch wt strain mixed pax3 wild type age embryonic day 12.5 (e12.5) embryo e12.5 vs splotch ko strain mixed pax3 null age embryonic day 12.5 (e12.5) embryo e12.5 |
| GSE193588_3_v_2_pax3_mouse | carm1 wt strain c57bl/6 wild type age embryonic day 12.5 (e12.5) embryo e12.5 vs splotch ko strain mixed pax3 null age embryonic day 12.5 (e12.5) embryo e12.5 |
| GSE136311_1_v_0_lyz2_mouse | ctr strain c57bl/6 /variation wild type colon control vs ko strain c57bl/6 /variation uhrf1fl/fllyz2 cre colon |
| GSE147535_2_v_0_lyz2_mouse | peritoneal macrophages shp099 strain c57bl/6 age 8 weeks wild type vs peritoneal macrophages ko strain c57bl/6 age 8 weeks shp2lyz2 / |
| GSE103124_1_v_0_bmpr1a_mouse | naivewt strain/background c57bl/6 /variation wild type cd4+ cells age 8 12 weeks none naive cd4+cd44 cd62+foxp3gfp sorted normal b6 mice expressing foxp3gfp reporter transgene vs activatedbmpr strain/background c57bl/6 /variation bmpr1a/cd4cre cd4+ cells age 8 12 weeks cona activated cd4+cd44+cd62l foxp3gfp flow sorted mixed lymph node spleen cell populations isolated conditional knockout mice expressing reporter transgene presence lps 3 days |
| GSE103124_2_v_0_bmpr1a_mouse | activatedwt strain/background c57bl/6 /variation wild type cd4+ cells age 8 12 weeks cona activated cd4+cd44+cd62l foxp3gfp flow sorted mixed lymph node spleen cell populations isolated normal b6 mice expressing reporter transgene presence lps 3 days vs activatedbmpr strain/background c57bl/6 /variation bmpr1a/cd4cre cd4+ cells age 8 12 weeks cona activated cd4+cd44+cd62l foxp3gfp flow sorted mixed lymph node spleen cell populations isolated conditional knockout mice expressing reporter transgene presence lps 3 days |
| GSE224877_3_v_0_pctp_mouse | livers wt mice fed mcd diet bio rep primary whole liver vs livers ko mice fed chow diet bio rep primary whole liver pctp / |
| GSE224877_3_v_1_pctp_mouse | livers wt mice fed mcd diet bio rep primary whole liver vs livers ko mice fed mcd diet bio rep primary whole liver pctp / |
| GSE224877_2_v_1_pctp_mouse | livers wt mice fed chow diet bio rep primary whole liver vs livers ko mice fed mcd diet bio rep primary whole liver pctp / |
| GSE132694,GSE132717_0_v_2_meis1_human | control cell line cwr 22rv1 prostate carcinoma epithelial derived xenograft serially propagated mice castration induced regression relapse parental androgen dependent cwr22 exogenous expression cas9 grna provided vs hoxb13ko lv meis1 cell line cwr 22rv1 prostate carcinoma epithelial derived xenograft serially propagated mice castration induced regression relapse parental androgen dependent cwr22 knockout hoxb13 crispr exogenous expression |
| GSE228894_0_v_2_rnmt_mouse | liver strain c57bl/6j wt na vs liver strain c57bl/6j carnmt1 ko na |
| GSE228894_0_v_1_rnmt_mouse | liver strain c57bl/6j wt na vs brain strain c57bl/6j carnmt1 ko na |
| GSE228894_3_v_2_rnmt_mouse | brain strain c57bl/6j wt na vs liver strain c57bl/6j carnmt1 ko na |
| GSE228894_3_v_1_rnmt_mouse | brain strain c57bl/6j wt na vs brain strain c57bl/6j carnmt1 ko na |
| GSE217990_0_v_1_rnmt_human | control biol rep cell line hek293 cells wt vs carnmt1 ko rep cell line hek293 cells |
| GSE205976,GSE205978_3_v_5_cep83_human | bulk rna seq wildtype differentiated hipscs day 7 clone d7] time intermediate mesoderm cells vs bulk rna seq cep83 knockout differentiated hipscs day 25 clone d25] time organoids |
| GSE205976,GSE205978_2_v_4_cep83_human | bulk rna seq wildtype hipscs day 0 clone time undifferentiated vs bulk rna seq cep83 knockout differentiated hipscs day 7 clone d7] time intermediate mesoderm cells |
| GSE205976,GSE205978_2_v_5_cep83_human | bulk rna seq wildtype hipscs day 0 clone time undifferentiated vs bulk rna seq cep83 knockout differentiated hipscs day 25 clone d25] time organoids |
| GSE205976,GSE205978_2_v_0_cep83_human | bulk rna seq wildtype hipscs day 0 clone time undifferentiated vs bulk rna seq cep83 knockout hipscs day 0 clone d0] time undifferentiated |
| GSE205976,GSE205978_1_v_4_cep83_human | bulk rna seq wildtype differentiated hipscs day 25 clone d25] time organoids vs bulk rna seq cep83 knockout differentiated hipscs day 7 clone d7] time intermediate mesoderm cells |
| GSE205976,GSE205978_1_v_0_cep83_human | bulk rna seq wildtype differentiated hipscs day 25 clone d25] time organoids vs bulk rna seq cep83 knockout hipscs day 0 clone d0] time undifferentiated |
| GSE205976,GSE205978_3_v_0_cep83_human | bulk rna seq wildtype differentiated hipscs day 7 clone d7] time intermediate mesoderm cells vs bulk rna seq cep83 knockout hipscs day 0 clone d0] time undifferentiated |
| GSE123958,GSE123959_0_v_1_mta1_human | synchronized rna seq control time cell line hct116 colon morphology epithelial disease colorectal carcinoma /variation vs synchronized rna seq crmta1 time cell line hct116 colon morphology epithelial disease colorectal carcinoma /variation mta1 knockout |
| GSE205687_1_v_0_mta1_human | wild type sh sy5y brain neuroblastoma cells wildtype cell line vs camta1 knockout sh sy5y cells brain neuroblastoma cell line |
| GSE223287,GSE223290_2_v_4_braf_mouse | cxcr2 wild type tumor brafv600e/pten / /cxcr2wt vs cxcr2 knockout tumor brafv600e/pten / /cxcr2 |
| GSE130396_0_v_2_braf_human | a375wt dt cell line background a375 human brafv600e mutant melanoma /variation wild type culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs a375flag pi3kmut cell line background a375 human brafv600e mutant melanoma /variation pi3k h1047r overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE130396_1_v_2_braf_human | ko11 dmso cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs a375flag pi3kmut cell line background a375 human brafv600e mutant melanoma /variation pi3k h1047r overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE233566_1_v_2_braf_mouse | 3t3 l1 lv cell line embryonic fibroblast cells wt adipogenic differentiation time day 8 vs 3t3 l1 lv bmp8a cell line embryonic fibroblast cells zebrafish overexpression adipogenic differentiation time day 8 |
| GSE130396_7_v_6_braf_human | a375flagpi3kwt cell line background a375 human brafv600e mutant melanoma /variation pi3k wt overexpression culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 vs dt cell line background a375 human brafv600e mutant melanoma /variation pten null culture media dmem supplemented 5% fbs 1% penicillin streptomycin library preparation kit illumina truseq rna v2 |
| GSE189941_1_v_0_kdm4c_human | huh7 cells scramble human hepatocellular carcinoma cell line control vs huh7 cells si kdm4c#2 human hepatocellular carcinoma cell line kdm4c knockdown |
| GSE203060_0_v_1_kdm4c_human | hel cells control cell line erythroleukemia wt vs hel cells kdm4c ko sg3 cell line erythroleukemia knockout |
| GSE203060_0_v_2_kdm4c_human | hel cells control cell line erythroleukemia wt vs hel cells kdm4c ko sg2 cell line erythroleukemia knockout |
| GSE189941_1_v_2_kdm4c_human | huh7 cells scramble human hepatocellular carcinoma cell line control vs huh7 cells si kdm4c#1 human hepatocellular carcinoma cell line kdm4c knockdown |
| GSE213442_1_v_0_kpna2_mouse | wild type adult testis wt vs kpna2 knockout adult testis / |
| GSE206342_1_v_0_kpna2_human | nc si cells cell line u2os osteosarcoma wt sinc vs kpna2 si cells cell line u2os osteosarcoma knockdown sikpna2 |
| GSE217101_0_v_1_mcph1_mouse | hsc wt rna seq bone marrow hematopoietic stem cells vs hsc ko rna seq bone marrow hematopoietic stem cells mcph1 / |
| GSE236262_2_v_1_trim28_mouse | wild type plantaris muscle mte vs trim28 mko plantaris muscle knockout sham |
| GSE167956_4_v_0_trim28_human | shntc 1% o2 [sum159 1pct cell line sum159 breast cancer non targeting control vs shtrim28 o2 [sum159 cell line sum159 breast cancer trim28 knockdown |
| GSE167956_1_v_0_trim28_human | shntc 20% o2 [sum159 20pct cell line sum159 breast cancer non targeting control vs shtrim28 o2 [sum159 cell line sum159 breast cancer trim28 knockdown |
| GSE236262_0_v_3_trim28_mouse | wild type plantaris muscle sham vs trim28 mko plantaris muscle knockout mte |
| GSE133329_0_v_3_trim28_human | tr28 6kr mock cell line a549 lung epithelial carcinoma infection uninfected (mock) /variation crispr/cas9 edited trim28 ko lentivirally transduced mutant vs tr28 6kr moi10 cell line a549 lung epithelial carcinoma infection influenza /wsn/33 pfu/cell 6hpi /variation crispr/cas9 edited trim28 ko lentivirally transduced mutant iav infected |
| GSE236262_2_v_3_trim28_mouse | wild type plantaris muscle mte vs trim28 mko plantaris muscle knockout mte |
| GSE140445,GSE140448_1_v_0_trim28_mouse | d0 strain c57bl/6 wild type cd4 cells vs d0 strain c57bl/6 trim28 ko cd4 cells |
| GSE133329_2_v_3_trim28_human | wt tr28 mock cell line a549 lung epithelial carcinoma infection uninfected (mock) /variation crispr/cas9 edited trim28 ko lentivirally transduced vs tr28 6kr moi10 cell line a549 lung epithelial carcinoma infection influenza /wsn/33 pfu/cell 6hpi /variation crispr/cas9 edited trim28 ko lentivirally transduced mutant iav infected |
| GSE181461_1_v_4_trim28_human | umg12 mock replicate cell line umuc3 gfp tagged htert mutant promoter allele knockdown control bladder cancer vs umg12 trim28 kd replicate cell line umuc3 gfp tagged htert mutant promoter allele knockdown bladder cancer |
| GSE133329_1_v_3_trim28_human | wt tr28 moi10 cell line a549 lung epithelial carcinoma infection influenza /wsn/33 pfu/cell 6hpi /variation crispr/cas9 edited trim28 ko lentivirally transduced iav infected vs tr28 6kr moi10 cell line a549 lung epithelial carcinoma infection influenza /wsn/33 pfu/cell 6hpi /variation crispr/cas9 edited trim28 ko lentivirally transduced mutant iav infected |
| GSE138001_0_v_4_rorb_mouse | p7 ctl rnaseq one copy gfp knocked rorb locus collected l4 s1 heterozygous mice vs p7 ko rnaseq two copies gfp knocked rorb locus create full collected l4 s1 homozygous mice |
| GSE138001_5_v_4_rorb_mouse | p2 ctl rnaseq one copy gfp knocked rorb locus collected l4 s1 heterozygous mice vs p7 ko rnaseq two copies gfp knocked rorb locus create full collected l4 s1 homozygous mice |
| GSE138001_2_v_3_rorb_mouse | p30 ctl rnaseq one copy gfp knocked rorb locus collected l4 s1 heterozygous mice vs p30 ko rnaseq two copies gfp knocked rorb locus create full collected l4 s1 homozygous mice |
| GSE138001_2_v_4_rorb_mouse | p30 ctl rnaseq one copy gfp knocked rorb locus collected l4 s1 heterozygous mice vs p7 ko rnaseq two copies gfp knocked rorb locus create full collected l4 s1 homozygous mice |
| GSE138001_0_v_3_rorb_mouse | p7 ctl rnaseq one copy gfp knocked rorb locus collected l4 s1 heterozygous mice vs p30 ko rnaseq two copies gfp knocked rorb locus create full collected l4 s1 homozygous mice |
| GSE218819_2_v_1_kdm5b_human | mda mb 231 control breast cell line vs mcf7 kdm5b ntt overexpression breast cell line |
| GSE218819_3_v_4_kdm5b_human | mcf7 control breast cell line vs mda mb 231 kdm5b ntt overexpression breast cell line |
| GSE161064,GSE161065_0_v_1_kdm5b_mouse | control cell line yummer1.7(braf v600e pten / cdkn2 high frequency stable uv induced somatic mutations skin melanoma knockout cancer vs kdm5b sg cell line yummer1.7(braf v600e pten / cdkn2 high frequency stable uv induced somatic mutations skin melanoma deletion cancer |
| GSE213746_0_v_1_kdm5b_mouse | wt heart age 8 10 weeks old cardiac fibroblast wild type myocardial infarction vs ko heart age 8 10 weeks old cardiac fibroblast kdm5b knockout myocardial infarction |
| GSE99687_0_v_1_smad5_human | wt strain h9 cell hes wild type vs ko strain h9 cell hes smad5 / |
| GSE99687_2_v_1_smad5_human | es wt ldn strain h9 cell hes wild type +ldn vs ko strain h9 cell hes smad5 / |
| GSE99687_3_v_1_smad5_human | es wt strain h9 cell hes wild type vs ko strain h9 cell hes smad5 / |
| GSE129186,GSE129223_0_v_1_aicda_mouse | rna seq ipsc clone fibroblast wt reprogramming reprogrammed using oskm passage 4 vs rna seq ipsc clone fibroblast aicda ko reprogramming reprogrammed using oskm passage 4 |
| GSE86813,GSE86814_0_v_1_atf7ip_human | wild type /variation cell line hela cells vs atf7ipko /variation atf7ip ko cell line hela cells |
| GSE118766_2_v_0_ifng_mouse | ulk wt ifng embryonic fibroblasts /variation wildtype/wt + mouse vs ulk dko ifng embryonic fibroblasts /variation 1/2 double ko + mouse |
| GSE118766_2_v_3_ifng_mouse | ulk wt ifng embryonic fibroblasts /variation wildtype/wt + mouse vs ulk dko ut embryonic fibroblasts /variation 1/2 double ko mouse |
| GSE118766_1_v_0_ifng_mouse | ulk wt ut embryonic fibroblasts /variation wildtype/wt mouse vs ulk dko ifng embryonic fibroblasts /variation 1/2 double ko + mouse |
| GSE134515_1_v_2_sh2d2a_mouse | wt strain c57bl/6 wild type cells cd4+cd25high regulatory condition anti cd3 stimulation splenocytes vs ko strain c57bl/6 sh2d2a knock cells cd4+cd25high regulatory condition anti cd3 stimulation splenocytes |
| GSE106654_0_v_1_klf2_mouse | wt strain c57bl/6 peritoneal macrophage vs k2 strain c57bl/6 peritoneal macrophage klf2 ko |
| GSE92965_0_v_1_klf2_mouse | cre control day6 background strain c57bl/6j heart endothelial cells age 8 10 weeks primary cardiac microvascular vs ec k2k4 dko day6 background strain c57bl/6j heart endothelial cells klf2 klf4 double knockout age 8 10 weeks primary cardiac microvascular |
| GSE166004_3_v_4_pld1_mouse | wt pre bladder strain c57bl/6 wild type none vs pld1 8w bladder strain c57bl/6 knockout bbn 8 weeks |
| GSE166004_3_v_2_pld1_mouse | wt pre bladder strain c57bl/6 wild type none vs pld1 12w bladder strain c57bl/6 knockout bbn 12 weeks |
| GSE166004_7_v_0_pld1_mouse | wt 12w bladder strain c57bl/6 wild type bbn 12 weeks vs pld1 pre bladder strain c57bl/6 knockout none |
| GSE166004_5_v_4_pld1_mouse | wt 16w bladder strain c57bl/6 wild type bbn 16 weeks vs pld1 8w bladder strain c57bl/6 knockout bbn 8 weeks |
| GSE166004_5_v_0_pld1_mouse | wt 16w bladder strain c57bl/6 wild type bbn 16 weeks vs pld1 pre bladder strain c57bl/6 knockout none |
| GSE166004_3_v_6_pld1_mouse | wt pre bladder strain c57bl/6 wild type none vs pld1 16w bladder strain c57bl/6 knockout bbn 16 weeks |
| GSE166004_1_v_0_pld1_mouse | wt 8w bladder strain c57bl/6 wild type bbn 8 weeks vs pld1 pre bladder strain c57bl/6 knockout none |
| GSE166004_5_v_6_pld1_mouse | wt 16w bladder strain c57bl/6 wild type bbn 16 weeks vs pld1 16w bladder strain c57bl/6 knockout bbn 16 weeks |
| GSE166004_1_v_6_pld1_mouse | wt 8w bladder strain c57bl/6 wild type bbn 8 weeks vs pld1 16w bladder strain c57bl/6 knockout bbn 16 weeks |
| GSE174522_1_v_0_spp1_mouse | wt 1 strain c57bl/6 retinas optic nerves age post natal day 3 wild type primary cultured astrocytes vs spp1 ko 1 strain b6.129s6(cg) spp1tm1blh/j retinas optic nerves age post natal day 3 / primary cultured astrocytes |
| GSE158975_0_v_1_spp1_human | du145 nc cell line normal prostate vs du145 oe cell line circcspp1 overexpression prostate |
| GSE224004,GSE224005_0_v_6_chd4_human | rnaseq sknmc shscramble 24h cell line ewing sarcoma wildtype time vs rnaseq sknmc shchd4#1 24h cell line ewing sarcoma chd4 knockdown time |
| GSE224004,GSE224005_0_v_1_chd4_human | rnaseq sknmc shscramble 24h cell line ewing sarcoma wildtype time vs rnaseq sknmc shchd4#2 48h cell line ewing sarcoma chd4 knockdown time |
| GSE190555,GSE190557_2_v_3_chd4_human | 12z control non targeting sirna rna endometriotic epithelial cells /condition (non sirna) vs 12z sichd4siarid1a rna endometriotic epithelial cells /condition sichd4+siarid1a (chd4/arid1a co knockdown sirna) |
| GSE224004,GSE224005_0_v_8_chd4_human | rnaseq sknmc shscramble 24h cell line ewing sarcoma wildtype time vs rnaseq sknmc shchd4#1 48h cell line ewing sarcoma chd4 knockdown time |
| GSE154961,GSE154963_4_v_0_chd4_human | znf410 vector (rna seq) cell line hudep 2 immortalized erythroid day isolation 7 culture infected cells transduced empty control (vector) vs znf410 chd4 (rna seq) cell line hudep 2 immortalized erythroid day isolation 7 culture infected cells overexpression |
| GSE129293_0_v_1_chd4_human | shsc cell line mda mb 231 cells o2 knockdown scrambled control vs shchd4 cell line mda mb 231 cells o2 knockdown chd4 |
| GSE190555,GSE190557_2_v_0_chd4_human | 12z control non targeting sirna rna endometriotic epithelial cells /condition (non sirna) vs 12z sichd4 rna endometriotic epithelial cells /condition (chd4 knockdown sirna) |
| GSE123502,GSE123504_1_v_0_chd4_mouse | chd4 wt [ctrl strain c57bl/6 age 4 6 weeks /variation wild type bone marrow pro b cells (lin cd19+c kit+igm igd cd25 ) vs chd4 cko [chd4 strain c57bl/6 age 4 6 weeks /variation conditional knockout (chd4fl/flcd79a cretg/+) bone marrow pro b cells (lin cd19+c kit+igm igd cd25 ) |
| GSE229468,GSE229471_2_v_3_znf587_human | oci ly7 control shrna d6 rna cell line diffuse large b lymphoma lentiviral transduction time day 6 vs oci ly7 shznf587 417v1 d6 rna cell line diffuse large b lymphoma znf587 znf417 knockdown lentiviral transduction time day 6 |
| GSE229467,GSE229471_1_v_0_znf587_human | u2932 control shrna 72h rna cell line diffuse large b lymphoma lentiviral transduction time vs u2932 shznf587 417v1 72h rna cell line diffuse large b lymphoma znf587 znf417 knockdown lentiviral transduction time |
| GSE229468,GSE229471_0_v_3_znf587_human | u2932 control shrna d6 rna cell line diffuse large b lymphoma lentiviral transduction time day 6 vs oci ly7 shznf587 417v1 d6 rna cell line diffuse large b lymphoma znf587 znf417 knockdown lentiviral transduction time day 6 |
| GSE229468,GSE229471_2_v_1_znf587_human | oci ly7 control shrna d6 rna cell line diffuse large b lymphoma lentiviral transduction time day 6 vs u2932 shznf587 417v1 d6 rna cell line diffuse large b lymphoma znf587 znf417 knockdown lentiviral transduction time day 6 |
| GSE229468,GSE229471_0_v_1_znf587_human | u2932 control shrna d6 rna cell line diffuse large b lymphoma lentiviral transduction time day 6 vs u2932 shznf587 417v1 d6 rna cell line diffuse large b lymphoma znf587 znf417 knockdown lentiviral transduction time day 6 |
| GSE214684_0_v_1_gpr174_mouse | muscle wt strain c57bl/6 post hli day 7 wild type vs muscle gpr174 ko strain c57bl/6 post hli day 7 |
| GSE186044_4_v_2_tcra_mouse | strain c57bl/6j 129 tcrdcreer deletion 1 tcra tcrd loci. also contains rosa26zsg/zsg id3f/f alleles. homozygous ko. rosa26zsg/+. id3f/f. untreated. thymus pre selection dp thymocytes vs 12h tcra djd strain mixed 129/c57bl/6j 129 tcrdcreer tcrd also contains heterozygous alleles cam+/ . rosa26zsg/+. tamoxifen treated. thymus zsgreen+ pre selection dp thymocytes |
| GSE95826_4_v_1_tcra_mouse | wt tcra strain/variation 129 /variation thymus dp thymocytes vs int tcra /variation int1 2 ko thymus dp thymocytes |
| GSE136622_6_v_3_srpk3_mouse | wt immatureb immature b cells stimulation unstimulated wildtype vs ko marginal zone b cells stimulation hr srpk3 conditional knockout |
| GSE136622_0_v_3_srpk3_mouse | ko matureb mature b cells stimulation unstimulated srpk3 conditional knockout vs ko marginal zone b cells stimulation hr srpk3 conditional knockout |
| GSE136622_2_v_3_srpk3_mouse | wt matureb mature b cells stimulation unstimulated wildtype vs ko marginal zone b cells stimulation hr srpk3 conditional knockout |
| GSE136622_7_v_3_srpk3_mouse | ko immatureb immature b cells stimulation unstimulated srpk3 conditional knockout vs ko marginal zone b cells stimulation hr srpk3 conditional knockout |
| GSE247764_0_v_2_nell2_mouse | caput contra wild type epididymis age 12 week old unilateral orchidectomy (contralateral) vs caput nell2 ko / epididymis age 14 week old |
| GSE247764_5_v_2_nell2_mouse | caput uod wild type epididymis age 12 week old unilateral orchidectomy (ipsilateral) vs caput nell2 ko / epididymis age 14 week old |
| GSE247764_3_v_2_nell2_mouse | caput bod wild type epididymis age 12 week old bilateral orchidectomy vs caput nell2 ko / epididymis age 14 week old |
| GSE247764_4_v_2_nell2_mouse | caput sham wild type epididymis age 12 week old operation vs caput nell2 ko / epididymis age 14 week old |
| GSE247764_1_v_2_nell2_mouse | caput wt wild type epididymis age 14 week old vs caput nell2 ko / epididymis age 14 week old |
| GSE221955_3_v_2_igfbp2_mouse | wt nt brain cell line primary neural stem cells none vs ncf1ko igfbp2 brain cell line primary neural stem cells ncf1 ko |
| GSE228272,GSE228382_0_v_1_igfbp2_human | mdamb468 control replicate cell line mda mb 468 tnbc wt vs mdamb468 igfbp2 expression replicate cell line mda mb 468 tnbc overexpression |
| GSE122215,GSE122217_0_v_4_peg10_mouse | embryo wt differentiated tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10 ko tsc sample id name knockout (ko) pluripotent trophoblast stem cells rna |
| GSE122215,GSE122217_0_v_2_peg10_mouse | embryo wt differentiated tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10 ko diff 2%o2 sample id name knockout (ko) pluripotent trophoblast stem cells rna |
| GSE122215,GSE122217_5_v_2_peg10_mouse | embryo wt tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10 ko diff 2%o2 sample id name knockout (ko) pluripotent trophoblast stem cells rna |
| GSE122215,GSE122217_5_v_4_peg10_mouse | embryo wt tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10 ko tsc sample id name knockout (ko) pluripotent trophoblast stem cells rna |
| GSE122215,GSE122217_0_v_1_peg10_mouse | embryo wt differentiated tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10.kodifferentiatedtsc sample id name peg10 knockout (ko) pluripotent trophoblast stem cells rna |
| GSE122215,GSE122217_5_v_1_peg10_mouse | embryo wt tsc sample id name peg10 wildtype (wt) pluripotent trophoblast stem cells rna vs embryo peg10.kodifferentiatedtsc sample id name peg10 knockout (ko) pluripotent trophoblast stem cells rna |
| GSE207471_2_v_3_btla_human | rna seq shcontrol cell line a549 tumor cells wt knockdown control vs rna seq low cell line a549 tumor cells btla subpopulation sorting |
| GSE207471_2_v_1_btla_human | rna seq shcontrol cell line a549 tumor cells wt knockdown control vs rna seq high cell line a549 tumor cells btla subpopulation sorting |
| GSE207471_2_v_0_btla_human | rna seq shcontrol cell line a549 tumor cells wt knockdown control vs rna seq shbtla cell line a549 tumor cells btla konckdown knockdown |
| GSE114272_0_v_1_clk3_mouse | sample strain/background c57bl/6j /variation wt conditions sham heart age weeks vs sample strain/background c57bl/6j /variation clk3 ko conditions tac heart age 10 weeks |
| GSE114272_0_v_2_clk3_mouse | sample strain/background c57bl/6j /variation wt conditions sham heart age weeks vs sample strain/background c57bl/6j /variation clk3 ko conditions sham heart age weeks |
| GSE133070_2_v_4_prss1_mouse | tongue wt age p1 strain tmprss11. b c e f g wildtype vs epidermis ko age p1 strain tmprss11. b c e f g tmprss11a / |
| GSE133070_3_v_1_prss1_mouse | epidermis wt age p1 strain tmprss11. b c e f g wildtype vs tongue ko age p1 strain tmprss11. b c e f g tmprss11a / |
| GSE175883_0_v_1_dis3_mouse | dis3l2 p12 strain background b6d2f1 inbred wt age postnatal day 12 (p12) testis vs dis3l2 p12 strain background b6d2f1 inbred ko age postnatal day 12 (p12) testis |
| GSE156505_1_v_0_dis3_mouse | dis3 p4 strain b6d2f1 inbred testis wt age postnatal day 4 (p4) vs dis3 p4 strain b6d2f1 inbred testis ko age postnatal day 4 (p4) |
| GSE206516,GSE206518_0_v_7_ptdss2_human | hct116 ptdss2 ko dmso cell line human derived colon cancer vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_0_v_4_ptdss2_human | hct116 ptdss2 ko dmso cell line human derived colon cancer vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE206516,GSE206518_3_v_4_ptdss2_human | hct116 parent ds07551382 cell line human derived colon cancer wild type 0.1 um vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE206516,GSE206518_3_v_7_ptdss2_human | hct116 parent ds07551382 cell line human derived colon cancer wild type 0.1 um vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_2_v_7_ptdss2_human | a375 parent dmso cell line human derived melanoma wild type vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_6_v_7_ptdss2_human | a375 parent ds07551382 cell line human derived melanoma wild type 0.1 um vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_5_v_7_ptdss2_human | hct116 parent dmso cell line human derived colon cancer wild type vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_1_v_4_ptdss2_human | a375 ptdss2 ko dmso cell line human derived melanoma vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE206516,GSE206518_2_v_4_ptdss2_human | a375 parent dmso cell line human derived melanoma wild type vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE206516,GSE206518_1_v_7_ptdss2_human | a375 ptdss2 ko dmso cell line human derived melanoma vs a375 ptdss2 ko ds07551382 cell line human derived melanoma 0.1 um |
| GSE206516,GSE206518_6_v_4_ptdss2_human | a375 parent ds07551382 cell line human derived melanoma wild type 0.1 um vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE206516,GSE206518_5_v_4_ptdss2_human | hct116 parent dmso cell line human derived colon cancer wild type vs hct116 ptdss2 ko ds07551382 cell line human derived colon cancer 0.1 um |
| GSE215155_0_v_1_golph3_human | hesc nc cell line hescs human endometrial stromal cells wt decidualization vs hesc si cell line hescs human endometrial stromal cells golph3 knockdown decidualization |
| GSE150349_0_v_1_msx1_mouse | c2c12 ctrl cell line myoblasts control vs c2c12 msx1 cell line myoblasts overexpression |
| GSE228413_4_v_5_mavs_mouse | wt d0 small rest time day 0 splenic naive follicular b cells strain b6 anti cell receptor vs ko d0 small rest time day 0 splenic naive follicular b cells strain b6 mavs / anti cell receptor |
| GSE114232_10_v_6_mavs_mouse | wt mock strain c57bl/6 lung wild type infection time 6 days post vs mavs ko mock strain mixed c57bl/6 129svev lung / infection time 6 days post |
| GSE228413_2_v_3_mavs_mouse | wt d3 lrg active time day 3 cell line splenic naive follicular b cells b6 mice anti receptor vs ko d3 lrg active time day 3 cell line splenic naive follicular b cells mavs / mice anti receptor |
| GSE228413_2_v_5_mavs_mouse | wt d3 lrg active time day 3 cell line splenic naive follicular b cells b6 mice anti receptor vs ko d0 small rest time day 0 splenic naive follicular b cells strain b6 mavs / anti cell receptor |
| GSE114232_10_v_11_mavs_mouse | wt mock strain c57bl/6 lung wild type infection time 6 days post vs mavs ko strain mixed c57bl/6 129svev lung / infection influenza time 6 days post pr8 |
| GSE228413_2_v_1_mavs_mouse | wt d3 lrg active time day 3 cell line splenic naive follicular b cells b6 mice anti receptor vs ko 1 day1 lrg active time day splenic naive follicular b cells strain b6 mavs / anti cell receptor |
| GSE228413_0_v_3_mavs_mouse | wt 1 day1 lrg active time day splenic naive follicular b cells strain b6 anti cell receptor vs ko d3 lrg active time day 3 cell line splenic naive follicular b cells mavs / mice anti receptor |
| GSE114232_8_v_6_mavs_mouse | wt strain c57bl/6 lung wild type infection influenza time 6 days post pr8 vs mavs ko mock strain mixed c57bl/6 129svev lung / infection time 6 days post |
| GSE228413_4_v_3_mavs_mouse | wt d0 small rest time day 0 splenic naive follicular b cells strain b6 anti cell receptor vs ko d3 lrg active time day 3 cell line splenic naive follicular b cells mavs / mice anti receptor |
| GSE228413_4_v_1_mavs_mouse | wt d0 small rest time day 0 splenic naive follicular b cells strain b6 anti cell receptor vs ko 1 day1 lrg active time day splenic naive follicular b cells strain b6 mavs / anti cell receptor |
| GSE228413_0_v_1_mavs_mouse | wt 1 day1 lrg active time day splenic naive follicular b cells strain b6 anti cell receptor vs ko 1 day1 lrg active time day splenic naive follicular b cells strain b6 mavs / anti cell receptor |
| GSE114232_8_v_11_mavs_mouse | wt strain c57bl/6 lung wild type infection influenza time 6 days post pr8 vs mavs ko strain mixed c57bl/6 129svev lung / infection influenza time 6 days post pr8 |
| GSE154197_1_v_2_ints13_human | rpe control replicate cell line arpe 19 sirna target non targeting retinal pigment epithial vs rpe ints13 utr targeting knockdown replicate cell line arpe 19 sirna target retinal pigment epithial |
| GSE154197_1_v_0_ints13_human | rpe control replicate cell line arpe 19 sirna target non targeting retinal pigment epithial vs rpe ints13 gene body targeting knockdown replicate cell line arpe 19 sirna target retinal pigment epithial |
| GSE84148,GSE96938_3_v_1_nrros_mouse | wt bulk cd11b+ cells inventory sample name microglia primary /variation vs nrros ko bulk cd11b+ cells inventory sample name microglia primary /variation |
| GSE84148,GSE96938_0_v_2_nrros_mouse | wt brain inventory sample name primary /variation vs nrros ko brain inventory sample name primary /variation |
| GSE84148,GSE96938_0_v_1_nrros_mouse | wt brain inventory sample name primary /variation vs nrros ko bulk cd11b+ cells inventory sample name microglia primary /variation |
| GSE207301,GSE207303_0_v_3_tp53bp2_human | hepad38 treated 1000 iu/ml interferon î± 2b cell line hcc wt alpha vs tp53bp2 knockdown hepad38 treated 1000 iu/ml interferon î± 2b cell line hcc alpha |
| GSE207301,GSE207303_1_v_2_tp53bp2_human | hepad38 cell line hcc wt pbs vs tp53bp2 knockdown hepad38 cell line hcc pbs |
| GSE207301,GSE207303_0_v_2_tp53bp2_human | hepad38 treated 1000 iu/ml interferon î± 2b cell line hcc wt alpha vs tp53bp2 knockdown hepad38 cell line hcc pbs |
| GSE207301,GSE207303_1_v_3_tp53bp2_human | hepad38 cell line hcc wt pbs vs tp53bp2 knockdown hepad38 treated 1000 iu/ml interferon î± 2b cell line hcc alpha |
| GSE207302,GSE207303_0_v_2_tp53bp2_human | hepg2 interferon î± 2b cell line hcc wt 1000 iu/ml alpha vs tp53bp2 knockdown hepg2 1 wihh interferon treated cell line hcc 1000 iu/ml alpha 2b |
| GSE184884_6_v_5_gps2_mouse | bmdm gps2 ko rna seq macrophage strain c57bl/6 control cells vs rnaseq shgfp il4 macrophage strain balb/c 6h chip antibody vendor cat. raw 264.7 |
| GSE130383_2_v_3_gps2_mouse | wt lps macrophage strain balb/c agent 6 hour raw264.7 cells vs crispr gps2 ko macrophage strain balb/c agent raw264.7 cells |
| GSE184884_7_v_1_gps2_mouse | bmdm wt il4 rna seq macrophage strain c57bl/6 6h cells vs bmdm gps2 ko il4 rna seq macrophage strain c57bl/6 6h cells |
| GSE184884_2_v_1_gps2_mouse | bmdm wt rna seq macrophage strain c57bl/6 control cells vs bmdm gps2 ko il4 rna seq macrophage strain c57bl/6 6h cells |
| GSE184884_4_v_1_gps2_mouse | rnaseq shgfp macrophage strain balb/c control chip antibody vendor cat. raw 264.7 vs bmdm gps2 ko il4 rna seq macrophage strain c57bl/6 6h cells |
| GSE130383_2_v_0_gps2_mouse | wt lps macrophage strain balb/c agent 6 hour raw264.7 cells vs crispr gps2 ko lps macrophage strain balb/c agent 6 hour raw264.7 cells |
| GSE130383_1_v_3_gps2_mouse | wt con macrophage strain balb/c agent raw264.7 cells vs crispr gps2 ko macrophage strain balb/c agent raw264.7 cells |
| GSE184884_6_v_0_gps2_mouse | bmdm gps2 ko rna seq macrophage strain c57bl/6 control cells vs rnaseq shkdm1a il4 macrophage strain balb/c 6h chip antibody vendor cat. raw 264.7 |
| GSE130383_1_v_0_gps2_mouse | wt con macrophage strain balb/c agent raw264.7 cells vs crispr gps2 ko lps macrophage strain balb/c agent 6 hour raw264.7 cells |
| GSE152055_2_v_1_mpc1_mouse | wt 16 wild type timepoint weeks post knockout mouse heart vs mpc1 ko 16 knockout timepoint weeks post mouse heart |
| GSE122711_2_v_0_mpc1_mouse | wt cd4 rep strain c57bl/6 spleen cell mpc1 fl/fl cd3+ cd4+ facs sorted splenocytes vs ko cd4 rep strain c57bl/6 spleen cell vav cre mpc1 fl/fl cd3+ cd4+ facs sorted splenocytes |
| GSE152055_0_v_3_mpc1_mouse | wt 8 wild type timepoint weeks post knockout mouse heart vs mpc1 ko 8 knockout timepoint weeks post mouse heart |
| GSE122711_1_v_0_mpc1_mouse | wt cd8 rep strain c57bl/6 spleen cell mpc1 fl/fl cd3+ cd8+ facs sorted splenocytes vs ko cd4 rep strain c57bl/6 spleen cell vav cre mpc1 fl/fl cd3+ cd4+ facs sorted splenocytes |
| GSE152055_2_v_3_mpc1_mouse | wt 16 wild type timepoint weeks post knockout mouse heart vs mpc1 ko 8 knockout timepoint weeks post mouse heart |
| GSE122711_2_v_3_mpc1_mouse | wt cd4 rep strain c57bl/6 spleen cell mpc1 fl/fl cd3+ cd4+ facs sorted splenocytes vs ko cd8 rep strain c57bl/6 spleen cell vav cre mpc1 fl/fl cd3+ cd8+ facs sorted splenocytes |
| GSE122711_1_v_3_mpc1_mouse | wt cd8 rep strain c57bl/6 spleen cell mpc1 fl/fl cd3+ cd8+ facs sorted splenocytes vs ko cd8 rep strain c57bl/6 spleen cell vav cre mpc1 fl/fl cd3+ cd8+ facs sorted splenocytes |
| GSE152055_0_v_1_mpc1_mouse | wt 8 wild type timepoint weeks post knockout mouse heart vs mpc1 ko 16 knockout timepoint weeks post mouse heart |
| GSE226439,GSE226441_6_v_2_hnf4g_human | an1.1 d26 kidney organoid cell line hipsc wild type vs hnf4g ko d26 kidney organoid cell line ipsc |
| GSE211128_9_v_5_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (pbs) time 24h vs huvecs cells biol rep ns xen445 10 âµm cell line huvec primary endothlelial time 12h |
| GSE211128_9_v_0_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 cocl2 100 âµm cell line huvec primary endothlelial angptl4 knockdown cobalt chloride (cocl2) time 24h |
| GSE211128_2_v_0_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 cocl2 100 âµm cell line huvec primary endothlelial angptl4 knockdown cobalt chloride (cocl2) time 24h |
| GSE211128_4_v_0_angptl4_human | huvecs cells biol rep ns control cell line huvec primary endothlelial time 60h post transfection vs huvecs cells biol rep siangptl4 cocl2 100 âµm cell line huvec primary endothlelial angptl4 knockdown cobalt chloride (cocl2) time 24h |
| GSE211128_2_v_1_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown time 60h post transfection |
| GSE211128_7_v_6_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 xen445 10 âµm cell line huvec primary endothlelial angptl4 knockdown time 12h |
| GSE211128_3_v_6_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 xen445 10 âµm cell line huvec primary endothlelial angptl4 knockdown time 12h |
| GSE211128_3_v_1_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown time 60h post transfection |
| GSE211128_7_v_0_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 cocl2 100 âµm cell line huvec primary endothlelial angptl4 knockdown cobalt chloride (cocl2) time 24h |
| GSE211128_2_v_6_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 xen445 10 âµm cell line huvec primary endothlelial angptl4 knockdown time 12h |
| GSE211128_3_v_0_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 cocl2 100 âµm cell line huvec primary endothlelial angptl4 knockdown cobalt chloride (cocl2) time 24h |
| GSE211128_7_v_1_angptl4_human | huvecs cells biol rep ns cell line huvec primary endothlelial vehicle control (dmso) time 24h vs huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown time 60h post transfection |
| GSE211128_4_v_1_angptl4_human | huvecs cells biol rep ns control cell line huvec primary endothlelial time 60h post transfection vs huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown time 60h post transfection |
| GSE211128_9_v_6_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 xen445 10 âµm cell line huvec primary endothlelial angptl4 knockdown time 12h |
| GSE211128_4_v_6_angptl4_human | huvecs cells biol rep ns control cell line huvec primary endothlelial time 60h post transfection vs huvecs cells biol rep siangptl4 xen445 10 âµm cell line huvec primary endothlelial angptl4 knockdown time 12h |
| GSE211128_3_v_5_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (dmso) time 24h vs huvecs cells biol rep ns xen445 10 âµm cell line huvec primary endothlelial time 12h |
| GSE211128_9_v_1_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (pbs) time 24h vs huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown time 60h post transfection |
| GSE211128_9_v_8_angptl4_human | huvecs cells biol rep siangptl4 cell line huvec primary endothlelial angptl4 knockdown vehicle control (pbs) time 24h vs huvecs cells biol ns cocl2 100 âµm cell line huvec primary endothlelial cobalt chloride (cocl2) time 24h |
| GSE189219_0_v_1_atoh1_mouse | terminal ileum wt strain il17rafl/fl atoh1 cre age 6 weeks murine small intestinal vs terminal ileum ko strain il17rafl/fl atoh1 cre+ age 6 weeks murine small intestinal |
| GSE143830_0_v_1_trex1_mouse | wt bmdm cell line bone marrow derived macrophage vs trex1 ko bmdm cell line bone marrow derived macrophage |
| GSE216702,GSE216718_0_v_1_trex1_human | hesc derived microglia control embryonic stem cell line h9 esc like cells vs hesc derived microglia trex1 ko embryonic stem cell line h9 esc like cells |
| GSE148193_1_v_0_satb2_mouse | c2c12 control cells rna seq muscle myoblasts strain c3h/hej knockdown sirna myoblast vs c2c12 satb2 knockdown cells rna seq muscle myoblasts strain c3h/hej sisatb2 myoblast |
| GSE148692,GSE148695_2_v_4_satb2_mouse | wt cecum rep wild type intestine epithelium vs ko ileum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_5_v_3_satb2_mouse | wt jejunum rep wild type intestine epithelium vs ko cecum rep satb2 knock intestine epithelium |
| GSE148695,GSE167281_2_v_1_satb2_mouse | wt colon organoid rep genotyping wild type intestine part 3d cultured mouse organoids vs ko colon organoid rep genotyping satb2 knock intestine part 3d cultured mouse organoids |
| GSE148692,GSE148695_1_v_4_satb2_mouse | wt ileum rep wild type intestine epithelium vs ko ileum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_2_v_0_satb2_mouse | wt cecum rep wild type intestine epithelium vs ko jejunum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_7_v_0_satb2_mouse | wt colon rep wild type intestine epithelium vs ko jejunum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_1_v_3_satb2_mouse | wt ileum rep wild type intestine epithelium vs ko cecum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_7_v_3_satb2_mouse | wt colon rep wild type intestine epithelium vs ko cecum rep satb2 knock intestine epithelium |
| GSE77005_5_v_3_satb2_mouse | rnaseq control satb2 strain c57bl/6j /variation hippocampal ca1 region vs rnaseq knockout satb2 strain c57bl/6j /variation hippocampal ca1 region |
| GSE148692,GSE148695_1_v_6_satb2_mouse | wt ileum rep wild type intestine epithelium vs ko colon rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_7_v_6_satb2_mouse | wt colon rep wild type intestine epithelium vs ko colon rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_1_v_0_satb2_mouse | wt ileum rep wild type intestine epithelium vs ko jejunum rep satb2 knock intestine epithelium |
| GSE148695,GSE167284_2_v_1_satb2_mouse | wt colon rna seq rep genotyping wild type intestine part epithelium vs ko colon rna seq rep genotyping satb2 knock intestine part epithelium |
| GSE148692,GSE148695_5_v_4_satb2_mouse | wt jejunum rep wild type intestine epithelium vs ko ileum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_2_v_3_satb2_mouse | wt cecum rep wild type intestine epithelium vs ko cecum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_2_v_6_satb2_mouse | wt cecum rep wild type intestine epithelium vs ko colon rep satb2 knock intestine epithelium |
| GSE148695,GSE167281_0_v_1_satb2_mouse | wt ileum organoid rep genotyping wild type intestine part 3d cultured mouse organoids vs ko colon organoid rep genotyping satb2 knock intestine part 3d cultured mouse organoids |
| GSE148695,GSE167284_0_v_1_satb2_mouse | wt ileum rna seq rep genotyping wild type intestine part epithelium vs ko colon rna seq rep genotyping satb2 knock intestine part epithelium |
| GSE148692,GSE148695_7_v_4_satb2_mouse | wt colon rep wild type intestine epithelium vs ko ileum rep satb2 knock intestine epithelium |
| GSE148692,GSE148695_5_v_6_satb2_mouse | wt jejunum rep wild type intestine epithelium vs ko colon rep satb2 knock intestine epithelium |
| GSE150665,GSE150667_4_v_2_mysm1_mouse | cd150neg mysm1 wt puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ puma+/+ lin ckit+sca1+cd150 bone marrow cells vs cd150neg mysm1 ko puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / lin ckit+sca1+cd150 bone marrow cells |
| GSE150665,GSE150667_4_v_0_mysm1_mouse | cd150neg mysm1 wt puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ puma+/+ lin ckit+sca1+cd150 bone marrow cells vs cd150pos mysm1 ko puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / lin ckit+sca1+cd150+ bone marrow cells |
| GSE150665,GSE150667_1_v_5_mysm1_mouse | cd150neg mysm1 wt puma ko strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ / lin ckit+sca1+cd150 bone marrow cells vs cd150pos mysm1 ko puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / lin ckit+sca1+cd150+ bone marrow cells |
| GSE150665,GSE150667_4_v_8_mysm1_mouse | cd150neg mysm1 wt puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ puma+/+ lin ckit+sca1+cd150 bone marrow cells vs cd150pos mysm1 ko puma het strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / puma+/ lin ckit+sca1+cd150+ bone marrow cells |
| GSE150665,GSE150667_1_v_8_mysm1_mouse | cd150neg mysm1 wt puma ko strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ / lin ckit+sca1+cd150 bone marrow cells vs cd150pos mysm1 ko puma het strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / puma+/ lin ckit+sca1+cd150+ bone marrow cells |
| GSE150665,GSE150667_1_v_2_mysm1_mouse | cd150neg mysm1 wt puma ko strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ / lin ckit+sca1+cd150 bone marrow cells vs cd150neg mysm1 ko puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / lin ckit+sca1+cd150 bone marrow cells |
| GSE150665,GSE150667_4_v_5_mysm1_mouse | cd150neg mysm1 wt puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female mysm1+/+ puma+/+ lin ckit+sca1+cd150 bone marrow cells vs cd150pos mysm1 ko puma strain c57bl/6 age mice 8 12 weeks age. gender pooled male female / lin ckit+sca1+cd150+ bone marrow cells |
| GSE90821_3_v_1_esrp1_mouse | strain c57bl/6 cochlear epithelium age embryonic day 16.5 wild type vs e1 ko strain c57bl/6 cochlear epithelium age embryonic day 16.5 esrp1 / |
| GSE149355_0_v_1_esrp1_mouse | wt strain c57bl/6 oocyte wild type age post natal day 42 ovary vs esrp1 ko strain c57bl/6 oocyte / age post natal day 42 ovary |
| GSE239784_1_v_0_sat1_human | hela cells shcontrol xenograft host female scid/scid mice (c.b 17/icr scid/scidjcl) type snapfrozen specimen cell line carcinoma cervix wt vs hela cells shsat1 xenograft host female scid/scid mice (c.b 17/icr scid/scidjcl) type snapfrozen specimen cell line carcinoma cervix sat1 knockdown |
| GSE149035_3_v_5_hepacam_human | dms454 cont cell line wt supplier sigma small lung cancer vs dms454 crispr cell line hepacam2 knockdown supplier sigma small lung cancer |
| GSE149035_7_v_5_hepacam_human | h1694 cont cell line nci wt supplier atcc small lung cancer vs dms454 crispr cell line hepacam2 knockdown supplier sigma small lung cancer |
| GSE149035_7_v_0_hepacam_human | h1694 cont cell line nci wt supplier atcc small lung cancer vs h1694 crispr cell line nci hepacam2 knockdown supplier atcc small lung cancer |
| GSE149035_1_v_5_hepacam_human | a549 cont cell line wt supplier atcc lung cancer vs dms454 crispr cell line hepacam2 knockdown supplier sigma small lung cancer |
| GSE149035_1_v_0_hepacam_human | a549 cont cell line wt supplier atcc lung cancer vs h1694 crispr cell line nci hepacam2 knockdown supplier atcc small lung cancer |
| GSE149035_2_v_5_hepacam_human | h1299 cont cell line nci wt supplier atcc lung cancer vs dms454 crispr cell line hepacam2 knockdown supplier sigma small lung cancer |
| GSE149035_2_v_0_hepacam_human | h1299 cont cell line nci wt supplier atcc lung cancer vs h1694 crispr cell line nci hepacam2 knockdown supplier atcc small lung cancer |
| GSE184475_1_v_0_il21_mouse | wild type days background strain c57bl/6 wt immunization germinal center b cells spleen vs knock days background strain c57bl/6 il21r ko immunization germinal center b cells spleen |
| GSE179138_3_v_1_lama4_mouse | strain lfko wild type (floxed) diet 5015 gwat vs strain lfko lama4 knockout diet hfd gwat |
| GSE179138_4_v_1_lama4_mouse | strain lfko wild type (floxed) diet hfd gwat vs strain lfko lama4 knockout diet hfd gwat |
| GSE167404_1_v_0_lama4_mouse | bm mpc wt strain c57bl/6j bone marrow age 14 weeks wild type mesenchymal progenitor cell (mpc) vs bm mpc lama ko strain c57bl/6j bone marrow age 14 weeks lama4 / mesenchymal progenitor cell (mpc) |
| GSE87144_3_v_1_rorc_mouse | vehicle control vivo us pid20985 rna seq 23apr2014 sample type c57/bl6 thymocytes vs rorc ko thymic lymphoma cells mirg1 gfp us pid20985 rna seq 21apr2014 sample type transfection migr1 |
| GSE87144_6_v_1_rorc_mouse | dmso vitro us pid20985 rna seq 23apr2014 sample type c57/bl6 thymocytes vs rorc ko thymic lymphoma cells mirg1 gfp us pid20985 rna seq 21apr2014 sample type transfection migr1 |
| GSE164726_0_v_1_phf10_human | control cell line a375 sirna melanoma cells vs phf10 total exp1 cell line a375 sirna knockdown melanoma cells |
| GSE110038,GSE133995_3_v_0_hic1_mouse | rna seq wildtype replicate [ta seq] strain c57bl/6j wt hic1f/f whole ta muscle tibialis anterior homogenate vs rna seq knockout replicate [ta seq] strain c57bl/6j ubc creert2 hic1f/f whole ta muscle tibialis anterior homogenate |
| GSE173232_1_v_3_sf3b1_human | luci cfue developmental stage luciferase control cb derived hsc cultured cells cfu e progenitors vs sf3b1kd cfue developmental stage sf3b1 knockdown cb derived hsc cultured cells cfu e progenitors |
| GSE173232_4_v_3_sf3b1_human | luci poly developmental stage polychromatic luciferase control cb derived hsc cultured cells erythroblasts vs sf3b1kd cfue developmental stage sf3b1 knockdown cb derived hsc cultured cells cfu e progenitors |
| GSE173232_1_v_0_sf3b1_human | luci cfue developmental stage luciferase control cb derived hsc cultured cells cfu e progenitors vs sf3b1kd developmental stage sf3b1 knockdown cb derived hsc cultured cells erythroblasts |
| GSE173232_2_v_3_sf3b1_human | luci ortho developmental stage orthochromatic luciferase control cb derived hsc cultured cells erythroblasts vs sf3b1kd cfue developmental stage sf3b1 knockdown cb derived hsc cultured cells cfu e progenitors |
| GSE173232_2_v_0_sf3b1_human | luci ortho developmental stage orthochromatic luciferase control cb derived hsc cultured cells erythroblasts vs sf3b1kd developmental stage sf3b1 knockdown cb derived hsc cultured cells erythroblasts |
| GSE144919,GSE145177_1_v_0_dazl_mouse | dazl strain c57bl/6n pou5f1 egfp/+ age months facs spermatogonia sorted egfp positive control adult male vs dazl strain c57bl/6n dazl2l/ ddx4cre/+ pou5f1 egfp/+ age months facs spermatogonia sorted egfp positive conditional knockout adult male |
| GSE217982,GSE217983_2_v_3_hgfac_mouse | wt liver gender male strain c57bl/6j control hf/hs vs ko liver gender male strain c57bl/6j hgfac chow |
| GSE123002_0_v_1_srsf3_mouse | control strain c57bl/6 alphamhc creert2 stage adult heart vs srsf3 ko strain c57bl/6 srsf3flox/flox alphamhc creert2 stage adult heart |
| GSE224970,GSE224971_1_v_0_sap30_mouse | sap ntc n2a flp rtta (sap30bp nt control biological rep cell line mouse neuroblastoma cdna expressed (n2a line) flag sap30bp condition vs sap kd n2a flp rtta (sap30bp sisap30bp biological rep cell line mouse neuroblastoma cdna expressed (n2a line) flag sap30bp condition sirna knockdown |
| GSE210667_1_v_0_rfx1_mouse | lps plv cell line pmas macrophage negetive control time 24 hours vs lps cell line pmas macrophage rfx1 knockout time 24 hours |
| GSE210667_3_v_2_rfx1_mouse | lps cell line pmas macrophage wt time 24 hours vs lps plv rfx1 cell line pmas macrophage overexpression time 24 hours |
| GSE200673,GSE200691_2_v_4_hmga2_mouse | rna seq hmga2 wt 0h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #1 24h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_1_v_4_hmga2_mouse | rna seq hmga2 wt 24h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #1 24h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_1_v_5_hmga2_mouse | rna seq hmga2 wt 24h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #1 0h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_1_v_0_hmga2_mouse | rna seq hmga2 wt 24h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #2 24h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_2_v_5_hmga2_mouse | rna seq hmga2 wt 0h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #1 0h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_2_v_3_hmga2_mouse | rna seq hmga2 wt 0h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #2 0h biol rep time ipsc induced epilc |
| GSE107594_0_v_1_hmga2_human | control cell markers cd34+ vs hmga2 transduced cell markers cd34+ overexpression |
| GSE200673,GSE200691_1_v_3_hmga2_mouse | rna seq hmga2 wt 24h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #2 0h biol rep time ipsc induced epilc |
| GSE200673,GSE200691_2_v_0_hmga2_mouse | rna seq hmga2 wt 0h biol rep time ipsc induced epilc #1 vs rna seq hmga2 ko clone #2 24h biol rep time ipsc induced epilc |
| GSE160817_0_v_6_slamf6_human | wt6 cell line jurkat e6 1 stimulated 6 wt vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE160817_7_v_1_slamf6_human | wt12 cell line jurkat e6 1 stimulated 12 wt vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_4_v_9_slamf6_human | wt24 cell line jurkat e6 1 stimulated 24 wt vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_7_v_9_slamf6_human | wt12 cell line jurkat e6 1 stimulated 12 wt vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_0_v_1_slamf6_human | wt6 cell line jurkat e6 1 stimulated 6 wt vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_3_v_9_slamf6_human | ko0 cell line jurkat e6 1 unstimulated 0 ko slamf6 iso1 vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_3_v_1_slamf6_human | ko0 cell line jurkat e6 1 unstimulated 0 ko slamf6 iso1 vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_7_v_6_slamf6_human | wt12 cell line jurkat e6 1 stimulated 12 wt vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE160817_5_v_8_slamf6_human | wt36 cell line jurkat e6 1 stimulated 36 wt vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_4_v_8_slamf6_human | wt24 cell line jurkat e6 1 stimulated 24 wt vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_3_v_6_slamf6_human | ko0 cell line jurkat e6 1 unstimulated 0 ko slamf6 iso1 vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE160817_2_v_1_slamf6_human | wt0 cell line jurkat e6 1 unstimulated 0 wt vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_2_v_9_slamf6_human | wt0 cell line jurkat e6 1 unstimulated 0 wt vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_5_v_9_slamf6_human | wt36 cell line jurkat e6 1 stimulated 36 wt vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_2_v_8_slamf6_human | wt0 cell line jurkat e6 1 unstimulated 0 wt vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_4_v_1_slamf6_human | wt24 cell line jurkat e6 1 stimulated 24 wt vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_4_v_6_slamf6_human | wt24 cell line jurkat e6 1 stimulated 24 wt vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE160817_0_v_8_slamf6_human | wt6 cell line jurkat e6 1 stimulated 6 wt vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_5_v_1_slamf6_human | wt36 cell line jurkat e6 1 stimulated 36 wt vs ko6 cell line jurkat e6 1 stimulated 6 ko slamf6 iso1 |
| GSE160817_3_v_8_slamf6_human | ko0 cell line jurkat e6 1 unstimulated 0 ko slamf6 iso1 vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_0_v_9_slamf6_human | wt6 cell line jurkat e6 1 stimulated 6 wt vs ko36 cell line jurkat e6 1 stimulated 36 ko slamf6 iso1 |
| GSE160817_5_v_6_slamf6_human | wt36 cell line jurkat e6 1 stimulated 36 wt vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE160817_7_v_8_slamf6_human | wt12 cell line jurkat e6 1 stimulated 12 wt vs ko24 cell line jurkat e6 1 stimulated 24 ko slamf6 iso1 |
| GSE160817_2_v_6_slamf6_human | wt0 cell line jurkat e6 1 unstimulated 0 wt vs ko12 cell line jurkat e6 1 stimulated 12 ko slamf6 iso1 |
| GSE173282_1_v_0_marchf6_human | hela wt cell lines wild type vs hela marchf6 ko cell lines |
| GSE147943_4_v_6_cited2_mouse | wild type lps strain c57bl/6 bmdms age postnatal week 10 vs cited2 ko lps strain c57bl/6 bmdms age postnatal week 10 |
| GSE147943_2_v_3_cited2_mouse | wild type control strain c57bl/6 bmdms age postnatal week 10 vs cited2 ko il4 strain c57bl/6 bmdms age postnatal week 10 |
| GSE147943_5_v_1_cited2_mouse | wild type ifng strain c57bl/6 bmdms age postnatal week 10 vs cited2 ko ifng strain c57bl/6 bmdms age postnatal week 10 |
| GSE147943_0_v_3_cited2_mouse | wild type il4 strain c57bl/6 bmdms age postnatal week 10 vs cited2 ko il4 strain c57bl/6 bmdms age postnatal week 10 |
| GSE147943_7_v_3_cited2_mouse | cited2 ko control strain c57bl/6 bmdms age postnatal week 10 vs cited2 ko il4 strain c57bl/6 bmdms age postnatal week 10 |
| GSE77260_0_v_2_e2f1_human | knockdown sictrl mesenchymal stem cells agasga sga umbilical cord wharton' jelly vs knockdown sie2f1 mesenchymal stem cells agasga umbilical cord wharton' jelly |
| GSE77260_3_v_2_e2f1_human | knockdown sictrl mesenchymal stem cells agasga aga umbilical cord wharton' jelly vs knockdown sie2f1 mesenchymal stem cells agasga umbilical cord wharton' jelly |
| GSE202134_0_v_1_rbm39_human | ctrl kd rep cell line hela sirna cervix cancer vs flag rbm39 rescue rep cell line hela sirna + overexpression cervix cancer |
| GSE245001_1_v_0_trpv3_human | sebocytes con 24h cell line sz95 human sebaceous gland cells wt mock plamid transfection vs sebocytes oe 24h cell line sz95 human sebaceous gland cells trpv3 overexpression plamid transfection |
| GSE166944_3_v_2_eif4b_mouse | wt pbs tisssue lung strain c57bl/6 wsn uninfected 48 hours wilde type age 8weeks vs ko wsn tisssue lung strain c57bl/6 infected 48 hours eif4b cko age 8weeks |
| GSE166944_0_v_2_eif4b_mouse | ko pbs tisssue lung strain c57bl/6 wsn uninfected 48 hours eif4b cko age 8weeks vs ko wsn tisssue lung strain c57bl/6 infected 48 hours eif4b cko age 8weeks |
| GSE166944_1_v_2_eif4b_mouse | wt wsn tisssue lung strain c57bl/6 infected 48 hours wilde type age 8weeks vs ko wsn tisssue lung strain c57bl/6 infected 48 hours eif4b cko age 8weeks |
| GSE136894_2_v_3_psen1_mouse | wt iso treated replicate 200 microm 6 hrs blastocysts strain c57bl/6 vs psen1 ko replicate knockout blastocysts strain c57bl/6 |
| GSE136894_1_v_0_psen1_mouse | wt replicate blastocysts strain c57bl/6 vs psen1 ko iso treated replicate knockout 200 microm 6 hrs blastocysts strain c57bl/6 |
| GSE136894_1_v_3_psen1_mouse | wt replicate blastocysts strain c57bl/6 vs psen1 ko replicate knockout blastocysts strain c57bl/6 |
| GSE117643_1_v_0_irx5_mouse | rna seq wt bmscs tibiae femurs 4 week old wild type mice strain c57bl/6j day differentiating osteoblastogenesis vs rna seq irx5 ko bmscs tibiae femurs 4 week old knockout mice strain c57bl/6j day differentiating osteoblastogenesis |
| GSE154464_0_v_3_cdk6_mouse | rna seq hpclsk bcrablp210 cdk6 wt replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation transformed vs rna seq hpclsk bcrablp210 cdk6 ko replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation transformed |
| GSE154464_0_v_2_cdk6_mouse | rna seq hpclsk bcrablp210 cdk6 wt replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation transformed vs rna seq hpclsk cdk6 ko replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation untransformed |
| GSE154464_1_v_3_cdk6_mouse | rna seq hpclsk cdk6 wt replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation untransformed vs rna seq hpclsk bcrablp210 cdk6 ko replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation transformed |
| GSE154464_1_v_2_cdk6_mouse | rna seq hpclsk cdk6 wt replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation untransformed vs rna seq hpclsk cdk6 ko replicate strain background c57bl/6n haematopoetic stem/progenitor cells /variation untransformed |
| GSE162590_1_v_0_gsx2_mouse | lge wild type replicate lateral ganglionic eminence (lge) developmental stage e12.5 mice mouse vs lge gsx2 ko replicate lateral ganglionic eminence (lge) developmental stage e12.5 gsx2egfp/gsx2ra mouse |
| GSE203017_0_v_1_irs2_human | sw403 irs2 control bio cell line colon adenocarcinoma wt vs sw403 irs2 knockdown bio cell line colon adenocarcinoma |
| GSE100732,GSE100733_0_v_1_lrpprc_mouse | wt strain c57bl/6n wildtype heart vs ko strain c57bl/6n lrpprc knockout heart |
| GSE233256_0_v_1_rbms1_mouse | scrambled control cell line 3t3 l1 fibroblast wt adipogenic differentiation time day 7 vs rbms1 knockdown cell line 3t3 l1 fibroblast rbms1kd adipogenic differentiation time day 7 |
| GSE173262_2_v_0_ash1l_mouse | wtnpc differentiation t24 neural progenetor wild type strain b6 medium 24 hrs cell isolated mouse brain vs ash1lko npc differentiation t0 neural progenetor ash1l knockout strain b6 medium 0 hrs cell isolated mouse brain |
| GSE173262_6_v_4_ash1l_mouse | wtnpc differentiation t12 neural progenetor wild type strain b6 medium 12 hrs cell isolated mouse brain vs ash1lko npc differentiation t24 neural progenetor ash1l knockout strain b6 medium 24 hrs cell isolated mouse brain |
| GSE173262_6_v_0_ash1l_mouse | wtnpc differentiation t12 neural progenetor wild type strain b6 medium 12 hrs cell isolated mouse brain vs ash1lko npc differentiation t0 neural progenetor ash1l knockout strain b6 medium 0 hrs cell isolated mouse brain |
| GSE183413_0_v_2_ash1l_mouse | normalhpc modification modifications wild type strain c57bl/6 c kit+ hematopoietic progenitor cells vs rnaseq mesc pd modification modifications ash1l knockout strain c57bl/6 mll af9 transformed cells |
| GSE183413_1_v_2_ash1l_mouse | rnaseq mesc serum modification modifications ash1l wild type strain c57bl/6 mll af9 transformed cells vs rnaseq mesc pd modification modifications ash1l knockout strain c57bl/6 mll af9 transformed cells |
| GSE173262_2_v_5_ash1l_mouse | wtnpc differentiation t24 neural progenetor wild type strain b6 medium 24 hrs cell isolated mouse brain vs ash1lko npc differentiation t12 neural progenetor ash1l knockout strain b6 medium 12 hrs cell isolated mouse brain |
| GSE236486_1_v_2_arnt_human | ln229 wt sample cell line glioblastoma vs ln229 arnt2 ko c4 sample cell line glioblastoma |
| GSE236486_1_v_0_arnt_human | ln229 wt sample cell line glioblastoma vs ln229 arnt2 ko b3 sample cell line glioblastoma |
| GSE124621_0_v_1_pgrmc2_mouse | wt strain 129sv/c57bl6j wild type age 18 wo brown adipose (bat) vs patko strain 129sv/c57bl6j pgrmc2 adipose knockout age 18 wo brown (bat) |
| GSE89729_0_v_1_ppard_human | hct116 wt colon vs ko1 hct116 genetic ppard ko colon |
| GSE130676_0_v_1_suds3_human | control replicate (phf12/suds3 control) cell line hek293t cells vs suds3 rnai knockdown replicate cell line hek293t cells |
| GSE130676_0_v_2_suds3_human | control replicate (phf12/suds3 control) cell line hek293t cells vs phf12 rnai knockdown replicate cell line hek293t cells |
| GSE125011_0_v_2_cd83_human | nc control cell line skov3 passage <10 vs kd cd83 stable knockdown cell line skov3 passage <10 |
| GSE125011_0_v_1_cd83_human | nc control cell line skov3 passage <10 vs ov cd83 stable overexpression cell line skov3 passage <10 |
| GSE233441_1_v_0_tnnt1_human | huh7.5.1 cells liver cell line hcc wt vs tnnt1 ko huh7.5.1 cells liver cell line hcc |
| GSE86507,GSE86509_4_v_1_hoxb7_mouse | pkd1f rna seq strain background c57bl/6 /variation pkd1f/f age post natal day kidney wt vs pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_0_v_10_hoxb7_mouse | pkd2f rna seq strain background c57bl/6 /variation pkd2f/f age post natal day kidney wt vs pkd1f p1 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_4_v_5_hoxb7_mouse | pkd1f rna seq strain background c57bl/6 /variation pkd1f/f age post natal day kidney wt vs pkd2f p1 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_4_v_9_hoxb7_mouse | pkd1f rna seq strain background c57bl/6 /variation pkd1f/f age post natal day kidney wt vs pkd2f p3 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 3 kidney ko |
| GSE86507,GSE86509_7_v_8_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_3_v_9_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd2f p3 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 3 kidney ko |
| GSE86507,GSE86509_0_v_8_hoxb7_mouse | pkd2f rna seq strain background c57bl/6 /variation pkd2f/f age post natal day kidney wt vs pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_0_v_1_hoxb7_mouse | pkd2f rna seq strain background c57bl/6 /variation pkd2f/f age post natal day kidney wt vs pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_3_v_2_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd1f p3 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 3 kidney ko |
| GSE86507,GSE86509_7_v_2_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd1f p3 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 3 kidney ko |
| GSE86507,GSE86509_3_v_10_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd1f p1 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_3_v_5_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd2f p1 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_7_v_10_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd1f p1 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_7_v_5_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd2f p1 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 1 kidney ko |
| GSE86507,GSE86509_4_v_8_hoxb7_mouse | pkd1f rna seq strain background c57bl/6 /variation pkd1f/f age post natal day kidney wt vs pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_7_v_9_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd2f p3 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 3 kidney ko |
| GSE86507,GSE86509_7_v_1_hoxb7_mouse | pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f age post natal day 7 kidney wt vs pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_3_v_1_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd2f p7 rna seq strain background c57bl/6 /variation pkd2f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE86507,GSE86509_3_v_8_hoxb7_mouse | pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f age post natal day 7 kidney wt vs pkd1f p7 rna seq strain background c57bl/6 /variation pkd1f/f hoxb7 cre age post natal day 7 kidney ko |
| GSE206108_1_v_0_bhlhe22_human | pc 3 vector cell line bhlhe22 status normal cancer type prostate vs pc 3 bhlhe22 cell line status overexpression cancer type prostate |
| GSE201381_0_v_1_bhlhe22_mouse | rm 1 vector cell line control (rm vector) cancertype prostate cancer vs rm 1 bhlhe22 cell line overexpression cancertype prostate cancer |
| GSE208350_4_v_1_fgfr1_human | jhh 7 cells sgntc biol rep cell line liver cancer wt vs jhh 7 cells sgfgfr1/3/4 biol rep cell line liver cancer fgfr1/3/4 knockout |
| GSE201401_2_v_0_fgfr1_mouse | 2022 n2a sirna ctrl totalrna cell line neuro 2a cells neuronal wt control sirnas vs 2022 n2a sirna sifgfr1 totalrna cell line neuro 2a cells neuronal fgfr1 knockdown sirnas |
| GSE132759_4_v_0_fgfr1_mouse | ne central (cgrp c) tumor histology location ctr virus cgrp mouse lung (sclc) vs ne central (cgrp fgfr1) tumor histology location fgfr1 overexpression virus cgrp mouse lung (sclc) |
| GSE132759_4_v_5_fgfr1_mouse | ne central (cgrp c) tumor histology location ctr virus cgrp mouse lung (sclc) vs adc (cgrp fgfr1) tumor histology location na fgfr1 overexpression virus cgrp mouse lung (sclc) |
| GSE208350_0_v_1_fgfr1_human | huh 7 cells sgntc biol rep cell line liver cancer wt vs jhh 7 cells sgfgfr1/3/4 biol rep cell line liver cancer fgfr1/3/4 knockout |
| GSE132759_4_v_2_fgfr1_mouse | ne central (cgrp c) tumor histology location ctr virus cgrp mouse lung (sclc) vs adc (spc fgfr1) tumor histology location na fgfr1 overexpression virus spc mouse lung (sclc) |
| GSE169697,GSE169725_1_v_4_prrx1_mouse | coculture llc1 wt cell line lung cancer co cultured cells wound healing fibroblast vs coculture 1681 sg cell line 168 farn breast cancer co cultured cells mmtv caf prrx1 deletion |
| GSE169697,GSE169725_0_v_5_prrx1_mouse | coculture 1681 wt cell line 168 farn breast cancer co cultured cells mmtv caf vs coculture llc1 sg cell line lung cancer co cultured cells wound healing fibroblast prrx1 deletion |
| GSE169697,GSE169725_0_v_4_prrx1_mouse | coculture 1681 wt cell line 168 farn breast cancer co cultured cells mmtv caf vs coculture 1681 sg cell line 168 farn breast cancer co cultured cells mmtv caf prrx1 deletion |
| GSE169697,GSE169725_1_v_5_prrx1_mouse | coculture llc1 wt cell line lung cancer co cultured cells wound healing fibroblast vs coculture llc1 sg cell line lung cancer co cultured cells wound healing fibroblast prrx1 deletion |
| GSE161846,GSE161849_4_v_0_smarca4_human | wt 16 h replicate human small airway epithelial cells (hsaec) wild type rsv infected hsaec vs kd 16 h replicate human small airway epithelial cells (hsaec) smarca4 depleted rsv infected hsaec knockdown |
| GSE161846,GSE161849_3_v_0_smarca4_human | wt 0 replicate human small airway epithelial cells (hsaec) wild type uninfected (0h) hsaec vs kd 16 h replicate human small airway epithelial cells (hsaec) smarca4 depleted rsv infected hsaec knockdown |
| GSE161846,GSE161849_1_v_5_smarca4_human | wt 24 h replicate human small airway epithelial cells (hsaec) wild type rsv infected hsaec vs kd 24 h replicate human small airway epithelial cells (hsaec) smarca4 depleted rsv infected hsaec knockdown |
| GSE161846,GSE161849_1_v_0_smarca4_human | wt 24 h replicate human small airway epithelial cells (hsaec) wild type rsv infected hsaec vs kd 16 h replicate human small airway epithelial cells (hsaec) smarca4 depleted rsv infected hsaec knockdown |
| GSE122378_0_v_1_carmil3_mouse | wt cell line 4t1 cells wild type mammary tumor vs carmil3 ko cell line 4t1 cells knockout mammary tumor |
| GSE181966_5_v_3_has2_mouse | has2+/ ko mice saline control strain balb/c treated intranasal 8 weeks lung whole homogenate vs has2+/ ko mice 24 chronic ova stimulation strain balb/c treated intranasal ovalbumin 8 weeks lung whole homogenate |
| GSE181966_0_v_3_has2_mouse | wt mice saline control strain balb/c treated intranasal 8 weeks lung whole homogenate vs has2+/ ko mice 24 chronic ova stimulation strain balb/c treated intranasal ovalbumin 8 weeks lung whole homogenate |
| GSE191015_0_v_2_gsdmb_human | ht 29 cell line colonic epithelial wt cells vs ibd gsdmb cell line ht 29 colonic epithelial crispr cas9 ko stable transfection mutant glycine arginine position 299 proline serine 306 cells |
| GSE191015_1_v_2_gsdmb_human | wt gsdmb cell line ht 29 colonic epithelial crispr cas9 ko stable transfection canonical cells vs ibd gsdmb cell line ht 29 colonic epithelial crispr cas9 ko stable transfection mutant glycine arginine position 299 proline serine 306 cells |
| GSE191015_0_v_3_gsdmb_human | ht 29 cell line colonic epithelial wt cells vs gsdmb ko cell line ht 29 colonic epithelial crispr cas9 cells |
| GSE191015_1_v_3_gsdmb_human | wt gsdmb cell line ht 29 colonic epithelial crispr cas9 ko stable transfection canonical cells vs gsdmb ko cell line ht 29 colonic epithelial crispr cas9 cells |
| GSE178714_3_v_7_smad2_human | ctl ko nt 1h pancreas crispr none time bxpc3 cells vs s2 3 ko nt 24h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_1_v_2_smad2_human | ctl ko tgf 24h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko nt 1h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_5_v_4_smad2_human | ctl ko nt 24h pancreas crispr none time bxpc3 cells vs s2 3 ko tgf 1h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_1_v_4_smad2_human | ctl ko tgf 24h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko tgf 1h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_1_v_7_smad2_human | ctl ko tgf 24h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko nt 24h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_3_v_2_smad2_human | ctl ko nt 1h pancreas crispr none time bxpc3 cells vs s2 3 ko nt 1h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_6_v_4_smad2_human | ctl ko tgf 1h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko tgf 1h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_5_v_0_smad2_human | ctl ko nt 24h pancreas crispr none time bxpc3 cells vs s2 3 ko tgf 24h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_6_v_0_smad2_human | ctl ko tgf 1h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko tgf 24h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_3_v_0_smad2_human | ctl ko nt 1h pancreas crispr none time bxpc3 cells vs s2 3 ko tgf 24h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_5_v_2_smad2_human | ctl ko nt 24h pancreas crispr none time bxpc3 cells vs s2 3 ko nt 1h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_6_v_7_smad2_human | ctl ko tgf 1h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko nt 24h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_6_v_2_smad2_human | ctl ko tgf 1h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko nt 1h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_5_v_7_smad2_human | ctl ko nt 24h pancreas crispr none time bxpc3 cells vs s2 3 ko nt 24h pancreas crispr smad2 smad3 none time bxpc3 cells |
| GSE178714_1_v_0_smad2_human | ctl ko tgf 24h pancreas crispr tgfb time bxpc3 cells vs s2 3 ko tgf 24h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE178714_3_v_4_smad2_human | ctl ko nt 1h pancreas crispr none time bxpc3 cells vs s2 3 ko tgf 1h pancreas crispr smad2 smad3 tgfb time bxpc3 cells |
| GSE133927_1_v_3_meox1_human | sample mdamb468 negative control sirna cell line triple breast cancer mda mb 468 vs sample bt549 meox1 sirna cell line triple negative breast cancer bt 549 knockdown |
| GSE133927_1_v_0_meox1_human | sample mdamb468 negative control sirna cell line triple breast cancer mda mb 468 vs sample mdamb468 meox1 sirna cell line triple negative breast cancer mda mb 468 knockdown |
| GSE214823,GSE214824_6_v_1_crtc2_mouse | mef dko a1 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef dko a1 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_0_v_1_crtc2_mouse | mef dko a2 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef dko a1 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_6_v_7_crtc2_mouse | mef dko a1 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef dko a2 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_4_v_1_crtc2_mouse | mef wt il1î² mouse embryonic fibroblast il 1beta vs mef dko a1 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE207433_0_v_1_crtc2_mouse | epididyaml primary adipocytes old crtc2 f/f strain c57bl/6n wt vs epididyaml primary adipocytes young crtc2 ako strain c57bl/6n adipocyte specific ko |
| GSE214823,GSE214824_3_v_7_crtc2_mouse | mef wt ctrl mouse embryonic fibroblast control vs mef dko a2 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_4_v_7_crtc2_mouse | mef wt il1î² mouse embryonic fibroblast il 1beta vs mef dko a2 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_0_v_2_crtc2_mouse | mef dko a2 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef ko il1î² mouse embryonic fibroblast lkb1 knockout il 1beta |
| GSE214823,GSE214824_0_v_7_crtc2_mouse | mef dko a2 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef dko a2 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE214823,GSE214824_5_v_7_crtc2_mouse | mef ko ctrl mouse embryonic fibroblast lkb1 knockout control vs mef dko a2 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE207433_0_v_3_crtc2_mouse | epididyaml primary adipocytes old crtc2 f/f strain c57bl/6n wt vs epididyaml primary adipocytes old crtc2 ako strain c57bl/6n adipocyte specific ko |
| GSE214823,GSE214824_6_v_2_crtc2_mouse | mef dko a1 ctrl mouse embryonic fibroblast lkb1/crtc2 knockout clone control vs mef ko il1î² mouse embryonic fibroblast lkb1 knockout il 1beta |
| GSE214823,GSE214824_3_v_1_crtc2_mouse | mef wt ctrl mouse embryonic fibroblast control vs mef dko a1 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE207433_2_v_1_crtc2_mouse | epididyaml primary adipocytes young crtc2 f/f strain c57bl/6n wt vs epididyaml primary adipocytes young crtc2 ako strain c57bl/6n adipocyte specific ko |
| GSE214823,GSE214824_5_v_1_crtc2_mouse | mef ko ctrl mouse embryonic fibroblast lkb1 knockout control vs mef dko a1 il1î² mouse embryonic fibroblast lkb1/crtc2 knockout clone il 1beta |
| GSE207433_2_v_3_crtc2_mouse | epididyaml primary adipocytes young crtc2 f/f strain c57bl/6n wt vs epididyaml primary adipocytes old crtc2 ako strain c57bl/6n adipocyte specific ko |
| GSE162084,GSE162085_2_v_6_bap1_mouse | preb wt strain c57bl/6 age gender bone marrow pre b cells (bone sorted gates b220+cd3 cd11b nk1.1 cd11c ter119 gr1 igm igd cd19+cd43 ) bap1 fl/+ vs immatureb ko strain c57bl/6 age gender bone marrow immature b cells (bone sorted gates b220+cd3 cd11b nk1.1 cd11c ter119 gr1 cd19+igm+igd ) bap1 fl/fl mb1 cre |
| GSE162739_4_v_1_bap1_mouse | wt ev ra mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE162739_6_v_1_bap1_mouse | wt ev dmso mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE120415,GSE120447_0_v_1_bap1_mouse | omentum wt mesothelial cells sample id primary /variation rna mouse vs omentum bap1 ko mesothelial cells sample id primary /variation rna mouse |
| GSE120413,GSE120447_4_v_2_bap1_mouse | embryo c91a d4 /variation bap1 control protected mesc sample id primary vs embryo dko d4 4oht /variation rnf2 bap1 double knockout protected mesc sample id primary |
| GSE120413,GSE120447_0_v_2_bap1_mouse | embryo cko d4 /variation bap1 knockout control protected mesc sample id primary vs embryo dko d4 4oht /variation rnf2 bap1 double knockout protected mesc sample id primary |
| GSE162084,GSE162085_5_v_4_bap1_mouse | immatureb wt strain c57bl/6 age gender bone marrow immature b cells (bone sorted gates b220+cd3 cd11b nk1.1 cd11c ter119 gr1 cd19+igm+igd ) bap1 fl/+ vs preb ko strain c57bl/6 age gender bone marrow pre b cells (bone sorted gates b220+cd3 cd11b nk1.1 cd11c ter119 gr1 igm igd cd19+cd43 ) bap1 fl/fl mb1 cre |
| GSE120413,GSE120447_4_v_5_bap1_mouse | embryo c91a d4 /variation bap1 control protected mesc sample id primary vs embryo cko d4 4oht /variation bap1 knockout protected mesc sample id primary |
| GSE162739_2_v_1_bap1_mouse | bap1ko dmso mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE162739_2_v_1_bap1_human | bap1ko dmso mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE120413,GSE120447_0_v_1_bap1_mouse | embryo cko d4 /variation bap1 knockout control protected mesc sample id primary vs embryo c91a d4 4oht /variation knock bap1 mutant protected mesc sample id primary |
| GSE120413,GSE120447_0_v_5_bap1_mouse | embryo cko d4 /variation bap1 knockout control protected mesc sample id primary vs embryo cko d4 4oht /variation bap1 knockout protected mesc sample id primary |
| GSE162739_8_v_1_bap1_mouse | bap1ko wt ra mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE162739_7_v_1_bap1_mouse | bap1ko c91s dmso mouse embryonic stem cells sample type vs bap1 ko sample type mesc |
| GSE120413,GSE120447_3_v_5_bap1_mouse | embryo wt d4 /variation bap1 protected mesc sample id primary vs embryo cko d4 4oht /variation bap1 knockout protected mesc sample id primary |
| GSE120413,GSE120447_3_v_2_bap1_mouse | embryo wt d4 /variation bap1 protected mesc sample id primary vs embryo dko d4 4oht /variation rnf2 bap1 double knockout protected mesc sample id primary |
| GSE150671_0_v_3_nptx2_mouse | social stress (ss) wt background strain c57bl/6 wild type (single housed) brain cortex vs social stress (ss) nptx2 ko background strain c57bl/6 (single housed) brain cortex |
| GSE148252_1_v_6_npas4_mouse | min30 1 light pulse wt condition superchiasmatic nuclei age 11 12 weeks sex male protocol vs npas4 ko condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_0_v_4_npas4_mouse | batch2 snscn wt condition dark superchiasmatic nuclei age 11 12 weeks sex male protocol 3 vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_8_v_4_npas4_mouse | npas4 ko wt condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_7_v_4_npas4_mouse | ct17 1 light pulse wt condition dark superchiasmatic nuclei age 11 12 weeks sex male protocol vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_0_v_6_npas4_mouse | batch2 snscn wt condition dark superchiasmatic nuclei age 11 12 weeks sex male protocol 3 vs npas4 ko condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_2_v_4_npas4_mouse | npas4 ko wt condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_5_v_4_npas4_mouse | 1 light pulse wt condition superchiasmatic nuclei age 11 12 weeks sex male 2 protocol vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_1_v_4_npas4_mouse | min30 1 light pulse wt condition superchiasmatic nuclei age 11 12 weeks sex male protocol vs npas4 ko condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_7_v_6_npas4_mouse | ct17 1 light pulse wt condition dark superchiasmatic nuclei age 11 12 weeks sex male protocol vs npas4 ko condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_5_v_6_npas4_mouse | 1 light pulse wt condition superchiasmatic nuclei age 11 12 weeks sex male 2 protocol vs npas4 ko condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE148252_2_v_6_npas4_mouse | npas4 ko wt condition light superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 vs npas4 ko condition dark superchiasmatic nuclei age 11 12 weeks sex male na protocol 1 |
| GSE217685_0_v_1_ddx20_mouse | thy1â +â spermatogonia control thy1 time day 4 vs thy1â +â spermatogonia ddx20 knockout thy1 time day 4 |
| GSE175571_3_v_2_acsl6_mouse | cerebellum 18month wt strain c57bl/6 age 18 months control natural aging vs cerebellum 2month ko strain c57bl/6 age 2 months acsl6 / |
| GSE168171,GSE168173_0_v_1_ddx41_human | u20s sictrl rna seq cell line control knockdown replicate vs u20s siddx41 rna seq cell line ddx41 knockdown replicate |
| GSE147056_0_v_1_actl6b_mouse | wt 4 1h kcl rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv wild type primary vs ko 3 rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv actl6b / primary |
| GSE147056_3_v_1_actl6b_mouse | wt 6h control rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 7h ttx/apv wild type primary vs ko 3 rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv actl6b / primary |
| GSE147056_4_v_1_actl6b_mouse | wt 7 6h kcl rna seq cortical neurons derived e16.5 embryos cultured days vitro 7h ttx/apv wild type primary vs ko 3 rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv actl6b / primary |
| GSE147056_2_v_1_actl6b_mouse | wt rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv wild type primary vs ko 3 rna seq cortical neurons derived e16.5 embryos cultured 7 days vitro 2h ttx/apv actl6b / primary |
| GSE114284_1_v_3_irf1_human | parent ifn l cell line beas 2b respiratory epithelial cells /variation wild type treated 5ng/ml ifnî»1 24h vs irf1 ko ifn cell line beas 2b respiratory epithelial cells /variation treated none |
| GSE114284_2_v_3_irf1_human | parent ifn cell line beas 2b respiratory epithelial cells /variation wild type treated none vs irf1 ko ifn cell line beas 2b respiratory epithelial cells /variation treated none |
| GSE114284_4_v_0_irf1_human | parent ifn b cell line beas 2b respiratory epithelial cells /variation wild type treated 0.2 ng/ml ifnî² 24h vs irf1 ko ifn b cell line beas 2b respiratory epithelial cells /variation treated 0.2 ng/ml ifnî² 24h |
| GSE114284_1_v_5_irf1_human | parent ifn l cell line beas 2b respiratory epithelial cells /variation wild type treated 5ng/ml ifnî»1 24h vs irf1 ko ifn l cell line beas 2b respiratory epithelial cells /variation treated 5ng/ml ifnî»1 24h |
| GSE114284_4_v_5_irf1_human | parent ifn b cell line beas 2b respiratory epithelial cells /variation wild type treated 0.2 ng/ml ifnî² 24h vs irf1 ko ifn l cell line beas 2b respiratory epithelial cells /variation treated 5ng/ml ifnî»1 24h |
| GSE114284_1_v_0_irf1_human | parent ifn l cell line beas 2b respiratory epithelial cells /variation wild type treated 5ng/ml ifnî»1 24h vs irf1 ko ifn b cell line beas 2b respiratory epithelial cells /variation treated 0.2 ng/ml ifnî² 24h |
| GSE114284_2_v_5_irf1_human | parent ifn cell line beas 2b respiratory epithelial cells /variation wild type treated none vs irf1 ko ifn l cell line beas 2b respiratory epithelial cells /variation treated 5ng/ml ifnî»1 24h |
| GSE114284_4_v_3_irf1_human | parent ifn b cell line beas 2b respiratory epithelial cells /variation wild type treated 0.2 ng/ml ifnî² 24h vs irf1 ko ifn cell line beas 2b respiratory epithelial cells /variation treated none |
| GSE114284_2_v_0_irf1_human | parent ifn cell line beas 2b respiratory epithelial cells /variation wild type treated none vs irf1 ko ifn b cell line beas 2b respiratory epithelial cells /variation treated 0.2 ng/ml ifnî² 24h |
| GSE84678,GSE93902_1_v_2_bcl11b_human | control cd1a replicate cord blood cd34+ cells transduced scrambled shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a precursors number vs knockdown cd1a replicate cord blood cd34+ cells transduced bcl11b shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a precursors number |
| GSE223334_1_v_2_bcl11b_mouse | wildtype cd4 cells stimulated biol rep sex cd4+ wt anti cd3/anti cd28 time day 3 vs bcl11b ko cd4 cells stimulated biol rep sex cd4+ anti cd3/anti cd28 time day 3 |
| GSE223334_3_v_2_bcl11b_mouse | wildtype cd4 cells resting biol rep sex male cd4+ wt il 7 (resting) time day 3 vs bcl11b ko cd4 cells stimulated biol rep sex cd4+ anti cd3/anti cd28 time day 3 |
| GSE84678,GSE93902_3_v_2_bcl11b_human | control cd1a+ replicate cord blood cd34+ cells transduced scrambled shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a+ precursors number vs knockdown cd1a replicate cord blood cd34+ cells transduced bcl11b shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a precursors number |
| GSE223334_1_v_0_bcl11b_mouse | wildtype cd4 cells stimulated biol rep sex cd4+ wt anti cd3/anti cd28 time day 3 vs bcl11b ko cd4 cells resting biol rep sex male cd4+ il 7 (resting) time day 3 |
| GSE162472_1_v_0_bcl11b_mouse | wt nk mcmv strain bcl11b splenic ly49h+ cells vs ko nk mcmv strain bcl11b splenic ly49h+ cells |
| GSE223334_3_v_0_bcl11b_mouse | wildtype cd4 cells resting biol rep sex male cd4+ wt il 7 (resting) time day 3 vs bcl11b ko cd4 cells resting biol rep sex male cd4+ il 7 (resting) time day 3 |
| GSE84678,GSE93902_3_v_0_bcl11b_human | control cd1a+ replicate cord blood cd34+ cells transduced scrambled shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a+ precursors number vs knockdown cd1a+ replicate cord blood cd34+ cells transduced bcl11b shrna lentivral vector containing gfp reporter cell populatione cd45+gfp+cd7+cd1a+ precursors number |
| GSE202470_2_v_3_stat6_mouse | ctr jejunum primarily isolated intestinal epithelial cells loxp vs t13 jejunum primarily isolated intestinal epithelial cells stat6vt iec specific overexpression |
| GSE202470_1_v_3_stat6_mouse | c13 jejunum primarily isolated intestinal epithelial cells wt vs t13 jejunum primarily isolated intestinal epithelial cells stat6vt iec specific overexpression |
| GSE136627_3_v_1_hdac4_mouse | wt veh den wild type vehicle denervation surgery denervated leg gastrocnemius muscle vs irko veh den hdac4 inducible whole body knockout vehicle denervation surgery denervated leg gastrocnemius muscle |
| GSE136627_2_v_1_hdac4_mouse | wt veh con wild type vehicle denervation surgery control contralateral leg gastrocnemius muscle vs irko veh den hdac4 inducible whole body knockout vehicle denervation surgery denervated leg gastrocnemius muscle |
| GSE186707_1_v_0_hdac4_mouse | control mc3t3 cell line e1 knockdown scrambled non silencing rna pre osteoblast vs hdac4 knockdown mc3t3 cell line e1 shrna pre osteoblast |
| GSE136627_7_v_1_hdac4_mouse | wt veh den wild type vehicle denervation surgery denervated leg gastrocnemius muscle vs irko veh den hdac4 inducible whole body knockout vehicle denervation surgery denervated leg gastrocnemius muscle |
| GSE212486,GSE212488_2_v_3_gata4_mouse | control fasted (rna seq) strain c57bl/6j liver sex male age 9 weeks old (gata4fl/fl empty aav8) vs ko refed (rna seq) strain c57bl/6j liver sex male age 9 weeks old gata4lko (gata4fl/fl aav8 tbg cre) |
| GSE212487,GSE212488_0_v_1_gata4_mouse | control (rna seq) strain c57bl/6j liver sex male age 11 weeks old (gata4fl/fl empty aav8) diet western 3 vs ko (rna seq) strain c57bl/6j liver sex male age 11 weeks old gata4lko (gata4fl/fl aav8 tbg cre) diet western 3 |
| GSE212486,GSE212488_0_v_3_gata4_mouse | control refed (rna seq) strain c57bl/6j liver sex male age 9 weeks old (gata4fl/fl empty aav8) vs ko refed (rna seq) strain c57bl/6j liver sex male age 9 weeks old gata4lko (gata4fl/fl aav8 tbg cre) |
| GSE212488,GSE218420_1_v_2_gata4_mouse | cntrl dmso strain mixed liver sex male age 11 weeks old control (gata4fl/fl empty aav8) vehicle vs ko gw strain mixed liver sex male age 11 weeks old gata4lko (gata4fl/fl aav8 tbg cre) lxr agonist gw3965 |
| GSE212488,GSE218420_0_v_2_gata4_mouse | ko dmso strain mixed liver sex male age 11 weeks old gata4lko (gata4fl/fl aav8 tbg cre) lxr agonist gw3965 vs ko gw strain mixed liver sex male age 11 weeks old gata4lko (gata4fl/fl aav8 tbg cre) lxr agonist gw3965 |
| GSE212486,GSE212488_2_v_1_gata4_mouse | control fasted (rna seq) strain c57bl/6j liver sex male age 9 weeks old (gata4fl/fl empty aav8) vs ko fasted (rna seq) strain c57bl/6j liver sex male age 9 weeks old gata4lko (gata4fl/fl aav8 tbg cre) |
| GSE212486,GSE212488_0_v_1_gata4_mouse | control refed (rna seq) strain c57bl/6j liver sex male age 9 weeks old (gata4fl/fl empty aav8) vs ko fasted (rna seq) strain c57bl/6j liver sex male age 9 weeks old gata4lko (gata4fl/fl aav8 tbg cre) |
| GSE200430_1_v_0_sema3d_human | hcclm3 control cell line hepatocellular carsinoma vs hcclm3 sema3d cell line hepatocellular carsinoma overexpression |
| GSE196318_0_v_1_xpo4_mouse | wt mrna cell line nih/3t3 ( atcc) wild type sequencing seq vs ko mrna cell line nih/3t3 ( atcc) xpo4 knockout sequencing type seq |
| GSE124375_10_v_9_chd2_mouse | e13.5 wt mef matched chaserr+/ chd2+/ cross vs mef ko |
| GSE133764_2_v_0_chd2_human | control [ analyzed] cell line 46 11 ipsc derived motor neuron /variation control. replicate vs cell line 46 11 ipsc derived motor neuron /variation knockout.chchd2 knockout gene chchd2 replicate |
| GSE182770,GSE182784_0_v_1_chd2_human | cin wt rnaseq replicate cortical interneuron ipsc source h9 hesc passage p10 p60 embryonic stem cells vs npc chd2 ko rnaseq replicate medial ganglionic eminence neuronal precursor ipsc source h9 hesc passage p10 p60 embryonic stem cells |
| GSE124375_13_v_12_chd2_mouse | mef wt pregnancy ko vs e13.5 chaserr / chd2m/ mef matched chd2+/ cross |
| GSE124375_13_v_0_chd2_mouse | mef wt pregnancy ko vs e13.5 mef matched chd2+/ cross |
| GSE133764_1_v_0_chd2_human | control [ analyzed] cell line 46 11 ipsc derived motor neuron /variation control.b replicate vs cell line 46 11 ipsc derived motor neuron /variation knockout.chchd2 knockout gene chchd2 replicate |
| GSE143643,GSE143644_2_v_5_hdac3_mouse | 20180515 d5 20180502 strain background ot transgenic hdac3 wt cd8 cells drug nil day post activation 5 vs 20180515 d5 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 5 |
| GSE109530,GSE109531_1_v_3_hdac3_mouse | sel wt tcr int cd69 pos thymocyte strain c57bl/6 ot ii thymocytes vs sel ko tcr int cd69 pos thymocyte strain c57bl/6 ot ii cd2 icre hdac3 cko thymocytes |
| GSE143643,GSE143644_3_v_0_hdac3_mouse | 20170928 d5 drug 20170824 strain background ot transgenic hdac3 wt cd8 cells dmso control day post activation 5 vs 20180515 d0 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 0 (na㯠cells) |
| GSE79696_0_v_1_hdac3_mouse | wt rest zt10 rnaseq strain c57b/6 age 4 months old gender male /variation hdac3 wild type quadriceps muscle vs hdac3 ko rest zt10 rnaseq strain c57b/6 age 4 months old gender male /variation knock quadriceps muscle |
| GSE143643,GSE143644_4_v_0_hdac3_mouse | 20180515 d0 20180502 strain background ot transgenic hdac3 wt cd8 cells drug nil day post activation 0 (na㯠cells) vs 20180515 d0 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 0 (na㯠cells) |
| GSE143643,GSE143644_4_v_5_hdac3_mouse | 20180515 d0 20180502 strain background ot transgenic hdac3 wt cd8 cells drug nil day post activation 0 (na㯠cells) vs 20180515 d5 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 5 |
| GSE109530,GSE109531_2_v_3_hdac3_mouse | imm wt tcr lo cd69 neg thymocyte strain c57bl/6 ot ii thymocytes vs sel ko tcr int cd69 pos thymocyte strain c57bl/6 ot ii cd2 icre hdac3 cko thymocytes |
| GSE143643,GSE143644_1_v_0_hdac3_mouse | 20170928 d5 rgfp966 20170824 strain background ot transgenic hdac3 wt cd8 cells drug 10 î¼m day post activation 5 vs 20180515 d0 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 0 (na㯠cells) |
| GSE109530,GSE109531_2_v_0_hdac3_mouse | imm wt tcr lo cd69 neg thymocyte strain c57bl/6 ot ii thymocytes vs imm ko tcr lo cd69 neg thymocyte strain c57bl/6 ot ii cd2 icre hdac3 cko thymocytes |
| GSE143643,GSE143644_3_v_5_hdac3_mouse | 20170928 d5 drug 20170824 strain background ot transgenic hdac3 wt cd8 cells dmso control day post activation 5 vs 20180515 d5 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 5 |
| GSE109530,GSE109531_1_v_0_hdac3_mouse | sel wt tcr int cd69 pos thymocyte strain c57bl/6 ot ii thymocytes vs imm ko tcr lo cd69 neg thymocyte strain c57bl/6 ot ii cd2 icre hdac3 cko thymocytes |
| GSE143643,GSE143644_2_v_0_hdac3_mouse | 20180515 d5 20180502 strain background ot transgenic hdac3 wt cd8 cells drug nil day post activation 5 vs 20180515 d0 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 0 (na㯠cells) |
| GSE153064,GSE153065_1_v_0_hdac3_mouse | hdac3fl/+ rs wild type round spermatids (rs) vs stra8 cre/hdac3fl/ ps hdac3 ko pachytene spermatocytes (ps) |
| GSE143643,GSE143644_1_v_5_hdac3_mouse | 20170928 d5 rgfp966 20170824 strain background ot transgenic hdac3 wt cd8 cells drug 10 î¼m day post activation 5 vs 20180515 d5 20180502 strain background ot transgenic hdac3 ko cd8 cells drug nil day post activation 5 |
| GSE153064,GSE153065_1_v_2_hdac3_mouse | hdac3fl/+ rs wild type round spermatids (rs) vs stra8 cre/hdac3fl/ rs hdac3 ko round spermatids (rs) |
| GSE183994_1_v_0_scml2_mouse | ctrl f1 rna age weeks day icsi insemination wt backgtound strain b6 vs scml2 ko icsi sperm / spermatozoa age 8 12 weeks /generation background strain |
| GSE183994_3_v_0_scml2_mouse | scml2 ko f1 blastocyst rna age weeks day 4 icsi insemination wt backgtound strain b6 blast vs scml2 ko icsi sperm / spermatozoa age 8 12 weeks /generation background strain |
| GSE116492,GSE116495_3_v_2_stag2_human | a673 stag2 wt cell line /variaton wild type crispr cas9 guides ewing sarcoma vs tc71 stag2 ko cell line /variaton null crispr cas9 guides sgstag2 ewing sarcoma |
| GSE144115_1_v_3_stag2_mouse | wt sistag1 cell line v6.5 mouse embryonic stem cells /variation wildtype sirna mesc vs stag2 ko sistag1 cell line v6.5 mouse embryonic stem cells /variation knockout sirna mesc |
| GSE144115_0_v_3_stag2_mouse | stag2 ko siglo cell line v6.5 mouse embryonic stem cells /variation knockout sirna control mesc vs stag2 ko sistag1 cell line v6.5 mouse embryonic stem cells /variation knockout sirna mesc |
| GSE116492,GSE116495_3_v_1_stag2_human | a673 stag2 wt cell line /variaton wild type crispr cas9 guides ewing sarcoma vs a673 stag2 ko cell line /variaton null crispr cas9 guides sgstag2 ewing sarcoma |
| GSE144115_2_v_3_stag2_mouse | wt siglo rep cell line v6.5 mouse embryonic stem cells /variation wildtype sirna control mesc vs stag2 ko sistag1 cell line v6.5 mouse embryonic stem cells /variation knockout sirna mesc |
| GSE144115_4_v_3_stag2_mouse | stag1 ko siglo rep cell line v6.5 mouse embryonic stem cells /variation knockout sirna control mesc vs stag2 ko sistag1 cell line v6.5 mouse embryonic stem cells /variation knockout sirna mesc |
| GSE133763_0_v_1_chd1_human | cell line 46 11 ipsc derived motor neuron /variation control. replicate vs cell line 46 11 ipsc derived motor neuron /variation knockout.chchd10.b knockout gene chchd10 replicate |
| GSE133763_0_v_2_chd1_human | cell line 46 11 ipsc derived motor neuron /variation control. replicate vs cell line 46 11 ipsc derived motor neuron /variation knockout.chchd10. knockout gene chchd10 replicate |
| GSE186633_2_v_0_chd1_human | source prostate benign prostatic hyperplasia (bph) epithelial cell line chd1 dmso bph1 vs ko source prostate benign prostatic hyperplasia (bph) epithelial cell line chd1 knockout alisertib bph1 |
| GSE186633_1_v_0_chd1_human | wt source prostate benign prostatic hyperplasia (bph) epithelial cell line chd1 wildtype alisertib bph1 vs ko source prostate benign prostatic hyperplasia (bph) epithelial cell line chd1 knockout alisertib bph1 |
| GSE191038_2_v_3_kcnma1_mouse | expression sample wt cor strain c57bl/6 cortex wild type vs expression sample ko hippo strain c57bl/6 hippocampus kcnma1 / |
| GSE191038_2_v_0_kcnma1_mouse | expression sample wt cor strain c57bl/6 cortex wild type vs expression sample ko cor strain c57bl/6 cortex kcnma1 / |
| GSE149139_1_v_0_carm1_mouse | ot cd8 cells /variation control ko wt vs ot cd8 cells /variation carm1 ko |
| GSE197197,GSE212981_1_v_0_carm1_mouse | carm1 ctrl rnaseq heart cardiomyocyte carm1fl/fl mouse injected aav gfp postnatal day vs carm1 ko rnaseq heart cardiomyocyte carm1fl/fl mouse injected aav cre postnatal day |
| GSE152666,GSE152668_2_v_1_carm1_mouse | mef wt mouse embryonic fibroblast carm1f/f er cre none vs mef ko mouse embryonic fibroblast carm1f/f er cre 4 oht |
| GSE189351_1_v_0_carm1_mouse | carm1 wildtype biological tibialis anterior muscle skm+/+ age 12 weeks old vs carm1 knockout biological tibialis anterior muscle skm / age 12 weeks old |
| GSE217156_2_v_3_trpc1_mouse | wt+lps heart strain c57bl/6 developmental stage adult sex male wt lps challenged time 4 h vs trpc1 / +lps heart strain c57bl/6 developmental stage adult sex male knockout lps challenged time 4 h |
| GSE217156_1_v_3_trpc1_mouse | wt+vehicle heart strain c57bl/6 developmental stage adult sex male wt vehicle time 4 h vs trpc1 / +lps heart strain c57bl/6 developmental stage adult sex male knockout lps challenged time 4 h |
| GSE237666,GSE237688_1_v_2_igf2bp1_mouse | mef wt ut biol rep embryonic cell line mouse fibroblast cells biological repeats untreated vs mef igf2bp1 ko wnt3a biol rep embryonic cell line mouse fibroblast cells knockout biological repeats |
| GSE146546,GSE146807_0_v_1_igf2bp1_human | wt cell line a549 genomic knockout control passages harvested 48h upon seeding lung cancer derived vs imp1 ko cell line a549 genomic knockout igf2bp1 passages harvested 48h upon seeding lung cancer derived |
| GSE206502_2_v_1_igf2bp1_human | plc 8024 cells sicontrol cell line hepatocellular carcinoma wt vs plc 8024 cells siigf2bp1 cell line hepatocellular carcinoma igf2bp1 knockdown |
| GSE154253_1_v_0_tnfaip8_human | control k562/a02 scrambled shrna lentivirus vs tnfaip8 knockdown k562/a02 shrna lentivirus |
| GSE240645_1_v_0_u90926_mouse | wild type female perigonadal white adipose replicate strain c57bl/6j sex vs u90926 ko male perigonadal white adipose replicate strain c57bl/6j sex |
| GSE240645_3_v_2_u90926_mouse | wild type male perigonadal white adipose replicate strain c57bl/6j sex vs u90926 ko female perigonadal white adipose replicate strain c57bl/6j sex |
| GSE173910,GSE173917_1_v_0_morc3_mouse | wt mommed mesc strain fvb/nj vs ko mommed mesc strain fvb/nj morc3d41/d41 |
| GSE173911,GSE173917_0_v_1_morc3_mouse | wt crispr mesc strain v6.5 vs ko crispr mesc strain v6.5 morc3 / |
| GSE194358,GSE194361_0_v_1_kdm5a_mouse | kdm5a wt cells replicate cell line id8 vs kdm5a ko cells replicate cell line id8 |
| GSE147435_1_v_0_kdm5a_mouse | lh wt strain background c57bl/6 /variation wild type age 6 8 weeks hippocampus vs lh 6 ko strain background c57bl/6 /variation kdm5a / age 8 weeks hippocampus |
| GSE85427_1_v_0_igfbp7_mouse | wt adult liver /variation wild type strain c57bl/6 mouse vs igfbp7 ko adult liver /variation knock strain c57bl/6 mouse |
| GSE191105_0_v_3_nat1_mouse | wt spg strain c57bl/6 spermatogonia wildtype vs nat10 sko spg strain c57bl/6 spermatogonia stra8 cre ko |
| GSE191105_2_v_3_nat1_mouse | wt prel strain c57bl/6 spermatocyte wildtype preleptotene stage spermatocyteâ vs nat10 sko spg strain c57bl/6 spermatogonia stra8 cre ko |
| GSE191105_2_v_4_nat1_mouse | wt prel strain c57bl/6 spermatocyte wildtype preleptotene stage spermatocyteâ vs nat10 sko prel strain c57bl/6 spermatocyte stra8 cre ko preleptotene stage spermatocyteâ |
| GSE191105_0_v_4_nat1_mouse | wt spg strain c57bl/6 spermatogonia wildtype vs nat10 sko prel strain c57bl/6 spermatocyte stra8 cre ko preleptotene stage spermatocyteâ |
| GSE178312_0_v_1_nat1_mouse | e18.5 nmnat1 fl/fl retina strain 129/sv e age embryonic day 18.5 (e18.5) control vs e18.5 nmnat1 / retina strain 129/sv e age embryonic day 18.5 (e18.5) knockout |
| GSE235516_0_v_1_zdhhc2_human | shcontrol 1 pancreas cell line panc cells pancreatic cancer control group knockdown zdhhc20 shrna transfection infection vs shzdhhc20 1 pancreas cell line panc cells pancreatic cancer treat group knockdown zdhhc20 shrna transfection infection |
| GSE220914_2_v_0_zdhhc2_mouse | wt strain mixed 129/svjae/c57bl/6 background pdac cell line parental cells (pda530 met) vs e4 strain mixed 129/svjae/c57bl/6 background pdac cell line zdhhc20 ko cells (single clone) |
| GSE220914_1_v_0_zdhhc2_mouse | wtctrl strain mixed 129/svjae/c57bl/6 background pdac cell line control cells (pda530 met single clone failed ko) vs e4 strain mixed 129/svjae/c57bl/6 background pdac cell line zdhhc20 ko cells (single clone) |
| GSE203485_1_v_0_zdhhc2_human | 786 cells control kidney cell line renal cancer wt vs 786 cells sizdhhc2 kidney cell line renal cancer zdhhc2 knockdown |
| GSE229580_2_v_1_creb1_human | thp1 cells lps 3h cell line human monocytes wt lipopolysaccharide vs thp1 cells creb1 kd cell line human monocytes knockdown pbs |
| GSE229580_0_v_3_creb1_human | thp1 cells control cell line human monocytes wt pbs vs thp1 cells creb1 kd plus lps cell line human monocytes knockdown lipopolysaccharide |
| GSE229580_2_v_3_creb1_human | thp1 cells lps 3h cell line human monocytes wt lipopolysaccharide vs thp1 cells creb1 kd plus lps cell line human monocytes knockdown lipopolysaccharide |
| GSE240344_1_v_0_uxs1_human | a549 ctrl replicate cell line lung disease adenocarcinoma condition crispr non targeting guide vs a549 uxs1 ko cell line lung disease adenocarcinoma condition crispr gene |
| GSE235682_1_v_0_rbl2_mouse | mci e2f4vp16 mef cell line mouse embryonic fibroblasts control mcidas overexpression day 4 vs sirbl2 mci mef cell line mouse embryonic fibroblasts mcidas overexpression day 4 |
| GSE235682_3_v_0_rbl2_mouse | sictl mci mef cell line mouse embryonic fibroblasts sirna control mcidas overexpression day 4 vs sirbl2 mci mef cell line mouse embryonic fibroblasts mcidas overexpression day 4 |
| GSE131071_0_v_1_nupr1_mouse | wt hscs strain c57bl/6 bone marrow /variation wildtype vs nupr1 ko hscs strain c57bl/6 bone marrow /variation / |
| GSE122101,GSE122103_3_v_1_ssu72_mouse | ssu72 wt hepatocyte strain c57bl/6 developmental stage purified hepatocytes 6weeks mice condition luciferase adenovirus infection vs ssu72 ko hepatocyte strain c57bl/6 developmental stage purified hepatocytes 6weeks mice condition cre recombinase adenovirus infection |
| GSE122101,GSE122103_3_v_4_ssu72_mouse | ssu72 wt hepatocyte strain c57bl/6 developmental stage purified hepatocytes 6weeks mice condition luciferase adenovirus infection vs ssu72 ko mef strain c57bl/6 embryonic fibroblast developmental stage day 13.5 condition cre recombinase adenovirus infection |
| GSE122101,GSE122103_0_v_1_ssu72_mouse | ssu72 wt mef strain c57bl/6 embryonic fibroblast developmental stage day 13.5 condition luciferase adenovirus infection vs ssu72 ko hepatocyte strain c57bl/6 developmental stage purified hepatocytes 6weeks mice condition cre recombinase adenovirus infection |
| GSE122101,GSE122103_0_v_4_ssu72_mouse | ssu72 wt mef strain c57bl/6 embryonic fibroblast developmental stage day 13.5 condition luciferase adenovirus infection vs ssu72 ko mef strain c57bl/6 embryonic fibroblast developmental stage day 13.5 condition cre recombinase adenovirus infection |
| GSE185953_2_v_0_tlr3_human | du145 d7 clone empty vector control /variation vs du145 b9 clone tlr3 overexpression /variation |
| GSE185953_2_v_3_tlr3_human | du145 d7 clone empty vector control /variation vs du145 c12 clone tlr3 overexpression /variation |
| GSE185953_1_v_0_tlr3_human | du145 a6 clone empty vector control /variation vs du145 b9 clone tlr3 overexpression /variation |
| GSE185953_1_v_3_tlr3_human | du145 a6 clone empty vector control /variation vs du145 c12 clone tlr3 overexpression /variation |
| GSE150895,GSE150896_0_v_1_kif15_human | c4 2b enzr cell control line prostate cancer /variation negative vs c4 2b enzr cell kif15 knockdown line prostate cancer /variation knocked |
| GSE220668_0_v_1_ncapg_human | hec 1 cells rnai cell line human endometrial adenocarcinoma control knockdown none vs hec 1 cells rnai cell line human endometrial adenocarcinoma ncapg knockdown none |
| GSE189609_1_v_0_hax1_human | hl 60 wt cell line vs hl 60 hax1 ko #1 cell line ko1 |
| GSE189609_1_v_2_hax1_human | hl 60 wt cell line vs hl 60 hax1 ko #2 cell line ko2 |
| GSE138468_3_v_6_dyrk1a_mouse | wt strain >90% c57/b6 sex hippocampus vs dp16/ ko strain background c57bl/6 /variation trisomy dyrk1a dosage corrected age 2 3 months hippocampus |
| GSE201110_0_v_1_sirt4_human | capan 2 cells ctrl cell line control without sirt4 overexpression pancreatic cancer vs capan 2 cells sirt4 cell line overexpression pancreatic cancer |
| GSE94768_5_v_4_pofut1_mouse | ff strain c57/bl6 age old (17 months) /variation pofut1flox/flox control quadriceps muscle vs screff strain c57/bl6 age old (17 months) /variation pofut1 knockout quadriceps muscle |
| GSE94768_3_v_2_pofut1_mouse | screplusplus strain c57/bl6 age months) /variation skeletal alpha actin cre/pofut1 wild type quadriceps muscle vs screff strain c57/bl6 age young (2 months) /variation pofut1 knockout quadriceps muscle |
| GSE94768_0_v_4_pofut1_mouse | ff strain c57/bl6 age young (2 months) /variation pofut1flox/flox control quadriceps muscle vs screff strain c57/bl6 age old (17 months) /variation pofut1 knockout quadriceps muscle |
| GSE94768_5_v_2_pofut1_mouse | ff strain c57/bl6 age old (17 months) /variation pofut1flox/flox control quadriceps muscle vs screff strain c57/bl6 age young (2 months) /variation pofut1 knockout quadriceps muscle |
| GSE202603_3_v_2_bhlhe40_mouse | min6 pmx ctrl biol rep cell line cells pancreatic beta wt without bhlhe40 overexpression vs min6 pmx bhlhe40 biol rep cell line cells pancreatic beta overexpression |
| GSE202603_1_v_2_bhlhe40_mouse | mouse islets 5% oxygen biol rep cell line primary cells pancreatic endocrine wt 5percent (24h) vs min6 pmx bhlhe40 biol rep cell line cells pancreatic beta overexpression |
| GSE253943_1_v_2_bhlhe40_human | wild type biological replicate cell line ipsc (wtc11) derived microglia wt vs bhlhe40 ko biological replicate cell line ipsc (wtc11) derived microglia 40ko |
| GSE202603_0_v_2_bhlhe40_mouse | min6 oxygen biol rep cell line cells pancreatic beta wt (6h) vs min6 pmx bhlhe40 biol rep cell line cells pancreatic beta overexpression |
| GSE233049_1_v_3_atf3_human | wild type a549 cells mock virus infection biological replicate lung epithelial adenocarcinoma cell line parental/wt vs atf3 knockout a549 cells mock virus infection biological replicate lung epithelial adenocarcinoma cell line / |
| GSE153341_2_v_3_atf3_mouse | wt 48h strain c57bl/6 spleen cd8 cells timepoint vs batf3.ko 72h strain c57bl/6 spleen cd8 cells batf3 ko timepoint |
| GSE102675_2_v_1_atf3_mouse | 4 hr wt sal whole pancreas strain c57bl6 /variation control hours saline vs 4 hr ko cip whole pancreas strain c57bl6 /variation atf3 / hours cerulein |
| GSE193999,GSE194000_1_v_0_atf3_mouse | wt strain c57bl/6 heart cells h/r model neonatal mouse cell vs ko strain c57bl/6 heart cells transfected ad atf3 h/r model neonatal mouse cell |
| GSE158893,GSE158916_0_v_1_atf3_human | non targeting control clone cell line karpas 299 anaplastic large lymphoma cells alk status alk+ wild type peripheral blood vs batf3 knockout clone cell line karpas 299 anaplastic large lymphoma cells alk status alk+ peripheral blood |
| GSE233049_1_v_0_atf3_human | wild type a549 cells mock virus infection biological replicate lung epithelial adenocarcinoma cell line parental/wt vs atf3 knockout a549 cells zikv virus infection biological replicate lung epithelial adenocarcinoma cell line / (10moi) |
| GSE193999,GSE194000_3_v_2_atf3_mouse | ko strain c57bl/6 heart atf3 control neonatal mouse cell vs ko strain c57bl/6 heart cells h/r model neonatal mouse cell |
| GSE153341_2_v_0_atf3_mouse | wt 48h strain c57bl/6 spleen cd8 cells timepoint vs batf3.ko 48h strain c57bl/6 spleen cd8 cells batf3 ko timepoint |
| GSE193999,GSE194000_4_v_0_atf3_mouse | wt strain c57bl/6 heart wild type control neonatal mouse cell vs ko strain c57bl/6 heart cells transfected ad atf3 h/r model neonatal mouse cell |
| GSE233049_2_v_0_atf3_human | wild type a549 cells zikv virus infection biological replicate lung epithelial adenocarcinoma cell line parental/wt (10moi) vs atf3 knockout a549 cells zikv virus infection biological replicate lung epithelial adenocarcinoma cell line / (10moi) |
| GSE140646_0_v_1_atf3_human | control gfp cell line tl om1 knockdown cells vs batf3 cell line tl om1 knockdown cells |
| GSE102675_3_v_0_atf3_mouse | 4 hr wt cip whole pancreas strain c57bl6 /variation control hours cerulein vs 4 hr ko sal whole pancreas strain c57bl6 /variation atf3 / hours saline |
| GSE212848_1_v_0_pum1_human | sgc7901 cells shcontrol cell line human gastric cancer wt vs sgc7901 cells shpum1 cell line human gastric cancer pum1 knockdown |
| GSE235644_1_v_0_fasn_mouse | lung ctrl rep cell line aec2 alveolar type 2 cells vs lung fasnko rep cell line aec2 alveolar type 2 cells specific fasn knockdown |
| GSE226316_4_v_2_tead2_mouse | serum escs rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE226316_11_v_2_tead2_mouse | 2i d3 rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE226316_3_v_2_tead2_mouse | 2i escs rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE226316_6_v_2_tead2_mouse | 2i rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE226316_1_v_2_tead2_mouse | 2i d6 rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE226316_0_v_2_tead2_mouse | serum rnaseq strain c57bl/6 culture method wildtype e14 cells vs 2i ko tead2 rnaseq strain c57bl/6 culture method knockout e14 cells |
| GSE123734_1_v_0_mien1_human | ht 29 wt wild type cell line cells replicate vs ht 29 ko mien1 pmien1 x (mien1 ko) cell line cells replicate |
| GSE140200_1_v_0_trim59_mouse | macrophage cell line raw 264.7 /variation control overexpression vector vs macrophage cell line raw 264.7 /variation trim59 knock |
| GSE140200_2_v_3_trim59_mouse | macrophage cell line raw 264.7 /variation control shrna vs macrophage cell line raw 264.7 /variation trim59 overexpression |
| GSE140200_1_v_3_trim59_mouse | macrophage cell line raw 264.7 /variation control overexpression vector vs macrophage cell line raw 264.7 /variation trim59 overexpression |
| GSE200352_5_v_0_pparg_mouse | f lf ko liver gender female hepatocyte specfic ppargamma 16 weeks control diet (34 weeks) disease state healthy mouse vs f n ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE111102,GSE111105_8_v_5_pparg_mouse | wt dmso strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE111102,GSE111105_3_v_7_pparg_mouse | wt il4 strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko rosi strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE160373_1_v_3_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE111102,GSE111105_4_v_5_pparg_mouse | wt strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE200352_4_v_0_pparg_mouse | f lf c liver gender female control mouse diet (34 weeks) disease state healthy vs f n ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE200352_11_v_8_pparg_mouse | n c liver gender male control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE160373_1_v_2_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged 0.5% cmc 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE200352_1_v_3_pparg_mouse | f hf c liver gender female control mouse diet high fat (34 weeks) disease state steatosis vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE160373_6_v_4_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged 0.5% cmc 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE160373_5_v_4_pparg_mouse | gavaged 0.5% cmc 28 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged 0.5% cmc 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE200352_10_v_0_pparg_mouse | hf c liver gender male control mouse diet high fat (34 weeks) disease state steatosis vs f n ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE200352_9_v_3_pparg_mouse | f n c liver gender female control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE111102,GSE111105_3_v_0_pparg_mouse | wt il4 strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko il4 strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE200352_1_v_8_pparg_mouse | f hf c liver gender female control mouse diet high fat (34 weeks) disease state steatosis vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE162276_2_v_0_pparg_mouse | hf/tzd c control mouse tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver vs hf ko hepatocyte specfic ppargamma hepatocytes nash disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE200352_10_v_6_pparg_mouse | hf c liver gender male control mouse diet high fat (34 weeks) disease state steatosis vs f hf ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE77795_2_v_1_pparg_mouse | control paired end replicate heart vs ppargc1a overexpression replicate heart |
| GSE200352_11_v_6_pparg_mouse | n c liver gender male control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs f hf ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE200352_10_v_3_pparg_mouse | hf c liver gender male control mouse diet high fat (34 weeks) disease state steatosis vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE200352_11_v_3_pparg_mouse | n c liver gender male control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE160373_5_v_7_pparg_mouse | gavaged 0.5% cmc 28 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE111102,GSE111105_2_v_0_pparg_mouse | ko dmso strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages vs ko il4 strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE111102,GSE111105_3_v_5_pparg_mouse | wt il4 strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE200352_5_v_8_pparg_mouse | f lf ko liver gender female hepatocyte specfic ppargamma 16 weeks control diet (34 weeks) disease state healthy mouse vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE160373_1_v_4_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged 0.5% cmc 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE111102,GSE111105_1_v_5_pparg_mouse | wt rosi strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE111102,GSE111105_4_v_0_pparg_mouse | wt strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko il4 strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE200352_10_v_8_pparg_mouse | hf c liver gender male control mouse diet high fat (34 weeks) disease state steatosis vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE162276_2_v_3_pparg_mouse | hf/tzd c control mouse tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE77795_2_v_3_pparg_mouse | control paired end replicate heart vs ppargc1a paired end overexpression replicate heart |
| GSE200352_4_v_8_pparg_mouse | f lf c liver gender female control mouse diet (34 weeks) disease state healthy vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE111102,GSE111105_8_v_0_pparg_mouse | wt dmso strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko il4 strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE160373_8_v_7_pparg_mouse | gavaged 0.5% cmc 90 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE160373_1_v_7_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE160373_6_v_2_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged 0.5% cmc 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE77795_0_v_3_pparg_mouse | control replicate heart vs ppargc1a paired end overexpression replicate heart |
| GSE160373_5_v_3_pparg_mouse | gavaged 0.5% cmc 28 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE162276_4_v_3_pparg_mouse | lf c control mouse disease healthy diet low fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE111102,GSE111105_8_v_7_pparg_mouse | wt dmso strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko rosi strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE200352_9_v_6_pparg_mouse | f n c liver gender female control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs f hf ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE160373_8_v_3_pparg_mouse | gavaged 0.5% cmc 90 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE200352_9_v_8_pparg_mouse | f n c liver gender female control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs n ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE160373_8_v_2_pparg_mouse | gavaged 0.5% cmc 90 days [wt strain c57bl/6 liver sex male wild type agent 0.5percent vs gavaged 0.5% cmc 28 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent 0.5percent |
| GSE200352_11_v_0_pparg_mouse | n c liver gender male control mouse diet high fat (18 weeks) followed 16 weeks cholestrol fructose disease state non alcoholic steatohepatitis vs f n ko liver gender female hepatocyte specfic ppargamma 16 weeks high fat diet (18 weeks) followed cholestrol fructose disease state non alcoholic steatohepatitis |
| GSE200352_4_v_3_pparg_mouse | f lf c liver gender female control mouse diet (34 weeks) disease state healthy vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE200352_5_v_3_pparg_mouse | f lf ko liver gender female hepatocyte specfic ppargamma 16 weeks control diet (34 weeks) disease state healthy mouse vs hf ko liver gender male hepatocyte specfic ppargamma 16 weeks high fat diet (34 weeks) disease state steatosis |
| GSE162276_4_v_0_pparg_mouse | lf c control mouse disease healthy diet low fat id pg liver vs hf ko hepatocyte specfic ppargamma hepatocytes nash disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE111102,GSE111105_4_v_7_pparg_mouse | wt strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko rosi strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE111102,GSE111105_1_v_0_pparg_mouse | wt rosi strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko il4 strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE111102,GSE111105_1_v_7_pparg_mouse | wt rosi strain background c57bl/6 age 8.5 weeks /variation control thioglycollate elicited peritoneal macrophages vs ko rosi strain background c57bl/6 age 8.5 weeks /variation ppargammampko thioglycollate elicited peritoneal macrophages |
| GSE160373_6_v_3_pparg_mouse | gavaged dehpï¼x88625 mg/kg bwï¼x89 28 days [wt strain c57bl/6 liver sex male wild type agent bw) vs gavaged dehpï¼x88625 mg/kg bwï¼x89 90 days [ko strain c57bl/6 liver sex male macrophage specific pparg knockout agent bw) |
| GSE162276_5_v_3_pparg_mouse | hf c control mouse disease non alcoholic steatohepatitis diet high fat id pg liver vs hf/tzd ko hepatocyte specfic ppargamma hepatocytes nash tzd (rosiglitazone maleate) disease non alcoholic steatohepatitis diet high fat id pg liver |
| GSE190177_1_v_0_sgpl1_human | h295r wt adrenocortical cell line vs h295r ko adrenocortical cell line sgpl1 |
| GSE186005_1_v_2_klf5_mouse | control e4.5 embryo replicate cell line preimplantation embryos harvested c57bl/5j mice mouse treated scramble sirna vs klf5 knockdown e4.5 embryo replicate cell line preimplantation embryos harvested c57bl/5j mice mouse treated sirna |
| GSE248659_1_v_0_klf5_human | skov3 nc ovary cell line ovarian cancer wt vs skov3 sh klf5 ovary cell line ovarian cancer knockdown |
| GSE146982_7_v_5_gpd1_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_4_v_5_gpd1_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_4_v_6_gpd1_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE146982_4_v_2_gpd1_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE146982_0_v_5_gpd1_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_3_v_1_gpd1_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE146982_7_v_1_gpd1_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE146982_0_v_2_gpd1_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE146982_0_v_6_gpd1_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE146982_0_v_1_gpd1_human | 786 vectorcontrol cell line /variation vector control cancer type kidney none vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE146982_3_v_5_gpd1_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs 786 gpd1 cell line /variation overexpression cancer type kidney none |
| GSE146982_3_v_2_gpd1_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs 786 gpd1 metformin cell line /variation overexpression cancer type kidney |
| GSE146982_7_v_6_gpd1_human | 786 vectorcontrol metformin cell line /variation vector control cancer type kidney vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE146982_3_v_6_gpd1_human | a549 vectorcontrol metformin cell line /variation vector control cancer type lung vs a549 gpd1 cell line /variation overexpression cancer type lung none |
| GSE146982_4_v_1_gpd1_human | a549 vectorcontrol cell line /variation vector control cancer type lung none vs a549 gpd1 metformin cell line /variation overexpression cancer type lung |
| GSE93309_5_v_4_prmt1_mouse | heavy control strain mix background osteosarcoma age post natal day 299 wild type cells vs total prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE126127_5_v_3_prmt1_mouse | prmt1 nescre cortex (ff ) brain strain c57bl/6 age postnatal day 0 sex wild type vs prmt1 nescre whole brain (ffcre) strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE93309_1_v_4_prmt1_mouse | total control strain mix background osteosarcoma age post natal day 299 wild type cells vs total prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE240258_0_v_1_prmt1_human | b16 f10 cells ctrl cell line melanoma wt vs b16 f10 cells prmt1 sg1 cell line melanoma knockout |
| GSE93309_5_v_3_prmt1_mouse | heavy control strain mix background osteosarcoma age post natal day 299 wild type cells vs heavy prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE126127_5_v_1_prmt1_mouse | prmt1 nescre cortex (ff ) brain strain c57bl/6 age postnatal day 0 sex wild type vs prmt1 nescre cortex (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE93309_2_v_4_prmt1_mouse | light control strain mix background osteosarcoma age post natal day 299 wild type cells vs total prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE93309_5_v_0_prmt1_mouse | heavy control strain mix background osteosarcoma age post natal day 299 wild type cells vs light prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE126127_2_v_3_prmt1_mouse | prmt1 nescre cerebellum (ff ) brain strain c57bl/6 age postnatal day 0 sex female wild type vs prmt1 nescre whole brain (ffcre) strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE240258_0_v_1_prmt1_mouse | b16 f10 cells ctrl cell line melanoma wt vs b16 f10 cells prmt1 sg1 cell line melanoma knockout |
| GSE126127_0_v_1_prmt1_mouse | prmt1 nescre whole brain (ff ) strain c57bl/6 age postnatal day 0 sex wild type vs prmt1 nescre cortex (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE126127_5_v_4_prmt1_mouse | prmt1 nescre cortex (ff ) brain strain c57bl/6 age postnatal day 0 sex wild type vs prmt1 nescre cerebellum (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE126127_2_v_4_prmt1_mouse | prmt1 nescre cerebellum (ff ) brain strain c57bl/6 age postnatal day 0 sex female wild type vs prmt1 nescre cerebellum (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE126127_2_v_1_prmt1_mouse | prmt1 nescre cerebellum (ff ) brain strain c57bl/6 age postnatal day 0 sex female wild type vs prmt1 nescre cortex (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE93309_2_v_0_prmt1_mouse | light control strain mix background osteosarcoma age post natal day 299 wild type cells vs light prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE126127_0_v_4_prmt1_mouse | prmt1 nescre whole brain (ff ) strain c57bl/6 age postnatal day 0 sex wild type vs prmt1 nescre cerebellum (ffcre) brain strain c57bl/6 age postnatal day 0 sex female knockout |
| GSE114894_1_v_0_prmt1_mouse | control strain c57bl developmental stage e14.5 /variation prmt1 fl/fl embryo palatal shelve lysates vs conditional deletion prmt1 strain c57bl developmental stage e14.5 /variation wnt1 cre fl/fl embryo palatal shelve lysates |
| GSE93309_1_v_3_prmt1_mouse | total control strain mix background osteosarcoma age post natal day 299 wild type cells vs heavy prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE93309_1_v_0_prmt1_mouse | total control strain mix background osteosarcoma age post natal day 299 wild type cells vs light prmt1 ko strain mix background osteosarcoma age post natal day 299 / cells |
| GSE124920_1_v_2_prmt1_mouse | wt cell line e14 cells wide type mouse embryonic stem vs cell line e14 cells prmt1 knockout mouse embryonic stem |
| GSE191138_3_v_0_fmo3_mouse | wt tcdd strain c57bl6/j liver fmo3+/+ vs ko coil strain c57bl6/j liver fmo3 / corn oil vehicle |
| GSE191138_2_v_0_fmo3_mouse | wt coil strain c57bl6/j liver fmo3+/+ corn oil vehicle vs ko coil strain c57bl6/j liver fmo3 / corn oil vehicle |
| GSE191138_2_v_4_fmo3_mouse | wt coil strain c57bl6/j liver fmo3+/+ corn oil vehicle vs ko tcdd strain c57bl6/j liver fmo3 / |
| GSE191138_3_v_4_fmo3_mouse | wt tcdd strain c57bl6/j liver fmo3+/+ vs ko tcdd strain c57bl6/j liver fmo3 / |
| GSE205316,GSE205317_0_v_1_nrip1_mouse | heart control tac/mi nrip1 f/f cre surgery cardiac specific rip140 ko vs heart nkx2.5 rip140ko tac/mi nrip1 f/f cre+ surgery cardiac specific rip140 ko |
| GSE205316,GSE205317_2_v_3_nrip1_mouse | heart control sham nrip1 f/f cre surgery cardiac specific rip140 ko vs heart nkx2.5 rip140ko sham nrip1 f/f cre+ surgery cardiac specific rip140 ko |
| GSE205316,GSE205317_2_v_1_nrip1_mouse | heart control sham nrip1 f/f cre surgery cardiac specific rip140 ko vs heart nkx2.5 rip140ko tac/mi nrip1 f/f cre+ surgery cardiac specific rip140 ko |
| GSE205316,GSE205317_0_v_3_nrip1_mouse | heart control tac/mi nrip1 f/f cre surgery cardiac specific rip140 ko vs heart nkx2.5 rip140ko sham nrip1 f/f cre+ surgery cardiac specific rip140 ko |
| GSE98755,GSE98756_1_v_0_fbxl19_mouse | fbxl19fl unt cell line fbxl19fl/fl mouse embryonic stem cells replicate passage 13 20 treated none (untreated) differentiation molecule subtype nascent rna vs fbxl19 fl ko ra cell line fbxl19fl/fl mouse embryonic stem cells replicate passage 13 20 treated 800nm 4 hydroxytamoxifen 72 h differentiation 1âµm retinoic acid hrs molecule subtype nascent rna |
| GSE98755,GSE98756_3_v_0_fbxl19_mouse | fbxl19 fl wt ra cell line fbxl19fl/fl mouse embryonic stem cells replicate passage 13 20 treated none (untreated) differentiation 1âµm retinoic acid 72 hrs molecule subtype nascent rna vs fbxl19 fl ko ra cell line fbxl19fl/fl mouse embryonic stem cells replicate passage 13 20 treated 800nm 4 hydroxytamoxifen 72 h differentiation 1âµm retinoic acid hrs molecule subtype nascent rna |
| GSE208171_0_v_1_zc4h2_human | cell line neural stem control vs zc4h2 cell line neural stem knockdown |
| GSE232558_0_v_2_fbxl12_human | mda mb 231 cells fbxl12 wt control replicate cell line basal like breast cancer vs mda mb 231 cells fbxl12 ko #1 replicate cell line basal like breast cancer |
| GSE232558_0_v_1_fbxl12_human | mda mb 231 cells fbxl12 wt control replicate cell line basal like breast cancer vs mda mb 231 cells fbxl12 ko #2 replicate cell line basal like breast cancer |
| GSE87404,GSE87812_1_v_3_hoxa9_mouse | wt strain c57bl/6 wildtype satellite cells age 3 4 months skeletal muscle hindlimbs vs ko strain c57bl/6 hoxa9 knock satellite cells age 3 4 months skeletal muscle hindlimbs |
| GSE87404,GSE87812_2_v_3_hoxa9_mouse | wt strain c57bl/6 wildtype satellite cells age 22 28 months skeletal muscle hindlimbs vs ko strain c57bl/6 hoxa9 knock satellite cells age 3 4 months skeletal muscle hindlimbs |
| GSE87404,GSE87812_2_v_0_hoxa9_mouse | wt strain c57bl/6 wildtype satellite cells age 22 28 months skeletal muscle hindlimbs vs ko strain c57bl/6 hoxa9 knock satellite cells age 22 28 months skeletal muscle hindlimbs |
| GSE87404,GSE87812_1_v_0_hoxa9_mouse | wt strain c57bl/6 wildtype satellite cells age 3 4 months skeletal muscle hindlimbs vs ko strain c57bl/6 hoxa9 knock satellite cells age 22 28 months skeletal muscle hindlimbs |
| GSE119498_0_v_5_setd5_mouse | wt e9.5 strain c57bl/6j whole embryo age wild type vs hc ko strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) cmv cre setd5 fl/+ |
| GSE119498_2_v_4_setd5_mouse | cfc 1h wt strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) wild type vs ko e9.5 strain c57bl/6j whole embryo age cmv cre setd5 fl/+ |
| GSE119498_6_v_4_setd5_mouse | cfc wt strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) wild type vs ko e9.5 strain c57bl/6j whole embryo age cmv cre setd5 fl/+ |
| GSE119498_0_v_7_setd5_mouse | wt e9.5 strain c57bl/6j whole embryo age wild type vs cfc 1h ko strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) cmv cre setd5 fl/+ |
| GSE119498_2_v_5_setd5_mouse | cfc 1h wt strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) wild type vs hc ko strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) cmv cre setd5 fl/+ |
| GSE119498_0_v_10_setd5_mouse | wt e9.5 strain c57bl/6j whole embryo age wild type vs cfc ko strain c57bl/6j left hippocampus ca region age adult (2 3.5 months old) cmv cre setd5 fl/+ |
| GSE162575,GSE162609_5_v_4_tfe3_human | hek at3 cell line control type overexpression human vs hek cdelta fl tfe3 cell line full length overexpression human |
| GSE162575,GSE162609_3_v_2_tfe3_human | hek fl tfe3 cell line control full length overexpression human vs hek cdelta at3 cell line type overexpression human |
| GSE98705_1_v_0_mdm2_mouse | etoh p53 null control vehicle vs 4oht p53 null mdm2 deletion deleted |
| GSE118187_0_v_1_prdm12_mouse | prdm12 wt strain c57bl6 age e11.5 wild type dorsal root ganglia spinal cord vs prdm12 ko strain c57bl6 age e11.5 / dorsal root ganglia spinal cord |
| GSE179880_7_v_5_e2f4_mouse | atf3 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_10_v_5_e2f4_mouse | e2f4 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_10_v_6_e2f4_mouse | e2f4 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs tead1 sh3 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_9_v_5_e2f4_mouse | p3 mice fibroblasts mrna strain c57bl/6 / skin fibroblast untreated vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_10_v_13_e2f4_mouse | e2f4 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs tead1 sh4 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_8_v_5_e2f4_mouse | p7 mice fibroblasts mrna strain c57bl/6 / skin fibroblast untreated vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_10_v_3_e2f4_mouse | e2f4 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs atf3 sh6 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_10_v_12_e2f4_mouse | e2f4 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs atf3 sh5 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_1_v_5_e2f4_mouse | p1 mice fibroblasts mrna strain c57bl/6 / skin fibroblast untreated vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_4_v_5_e2f4_mouse | p5 mice fibroblasts mrna strain c57bl/6 / skin fibroblast untreated vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE179880_2_v_5_e2f4_mouse | tead1 nt mrna strain c57bl/6 / skin fibroblast knockdown control vs e2f4 sh1 mrna strain c57bl/6 / skin fibroblast knockdown shrna |
| GSE165704_0_v_1_rif1_mouse | female rif1 mesc pre deletion wt] strain background c57bl/6j 129/svj x mus musculus castaneus rs26+/creert / vs female rif1 2d eb strain background c57bl/6j 129/svj x mus musculus castaneus rs26+/creert 4 hydroxytamoxifen (oht)+ differentiation / embryoid bodies |
| GSE189683_1_v_2_rif1_mouse | v strain background 129sv embryonic stem cells /variation wt escs vs rif1 strain background 129sv induced trophoblast stem cells /variation ko itscs |
| GSE189683_3_v_0_rif1_mouse | v strain background 129sv trophoblast stem cells /variation wt tscs vs rif1 strain background 129sv embryonic stem cells /variation ko |
| GSE189683_3_v_2_rif1_mouse | v strain background 129sv trophoblast stem cells /variation wt tscs vs rif1 strain background 129sv induced trophoblast stem cells /variation ko itscs |
| GSE224763_1_v_0_rif1_mouse | e14 mes control cell line mouse embryonic stem cells wt 2i medium day 0 vs e14 mes rif1 ko cell line mouse embryonic stem cells 2i medium day 0 |
| GSE189683_1_v_0_rif1_mouse | v strain background 129sv embryonic stem cells /variation wt escs vs rif1 strain background 129sv embryonic stem cells /variation ko |
| GSE213611_1_v_0_nuf2_human | ovcar3 shnc replicate cell line ovarian cancer cells wt transfected vs ovcar3 shnuf2 replicate cell line ovarian cancer cells nuf2 knockdown transfected |
| GSE140284_0_v_1_hhex_mouse | cre control nk spleen strain c57bl/6 cell markers c45+cd3 nk1.1+nkp46+cd49b+ sorted splenic cells vs hhex ko nk spleen strain c57bl/6 cell markers c45+cd3 nk1.1+nkp46+cd49b+ sorted splenic cells |
| GSE148647_4_v_2_scgb1a1_mouse | scgb1a1 wt 12 wk replicate strain c57bl/6 /variation scgb1a1+/+ lung age alveolar macrophage vs scgb1a1 ko 40 wk replicate strain c57bl/6 /variation / lung age alveolar macrophage |
| GSE171712_0_v_1_scgb1a1_mouse | control sample flow sorted scgb1a1 lineage traced lung epithelial cells vs knockout sample yap1/wwtr1 flow sorted scgb1a1 lineage traced lung epithelial cells |
| GSE148647_1_v_2_scgb1a1_mouse | scgb1a1 wt wk replicate strain c57bl/6 /variation scgb1a1+/+ lung age alveolar macrophage vs scgb1a1 ko 40 wk replicate strain c57bl/6 /variation / lung age alveolar macrophage |
| GSE148647_1_v_7_scgb1a1_mouse | scgb1a1 wt wk replicate strain c57bl/6 /variation scgb1a1+/+ lung age alveolar macrophage vs scgb1a1 ko 12 wk replicate strain c57bl/6 /variation / lung age alveolar macrophage |
| GSE148647_4_v_0_scgb1a1_mouse | scgb1a1 wt 12 wk replicate strain c57bl/6 /variation scgb1a1+/+ lung age alveolar macrophage vs scgb1a1 ko wk replicate strain c57bl/6 /variation / lung age alveolar macrophage |
| GSE148647_3_v_2_scgb1a1_mouse | scgb1a1 wt 40 wk replicate strain c57bl/6 /variation scgb1a1+/+ lung age alveolar macrophage vs scgb1a1 ko 40 wk replicate strain c57bl/6 /variation / lung age alveolar macrophage |
| GSE153124_4_v_0_dsg2_mouse | wt heart strain c57bl/6 wild type age 10 weeks sex vs ko heart strain c57bl/6 dsg2 / age 10 weeks sex |
| GSE153124_4_v_3_dsg2_mouse | wt heart strain c57bl/6 wild type age 10 weeks sex vs ko heart strain c57bl/6 dsg2 / age 2 weeks sex |
| GSE209898,GSE209899_0_v_1_flcn_human | hela flcn ko dmso cell line epithelial vs hela flcn ko trametinib cell line epithelial |
| GSE105173,GSE105175_1_v_0_dhx36_human | wildtype rna seq cell line hek293 /variation wild type cells vs dhx36 ko rna seq cell line hek293 /variation crispr/cas9 mediated knockout |
| GSE105169,GSE105175_0_v_1_dhx36_human | wildtype chrrna seq cell line hek293 /variation wild type passages 15 20 cells vs dhx36 ko chrrna seq cell line hek293 /variation crispr/cas9 mediated knockout passages 15 20 |
| GSE105170,GSE105175_1_v_0_dhx36_human | wildtype cpds rna seq cell line hek293 /variation wild type passages 15 20 treated 2 âµm carboxypyridostatin (cpds) cells vs dhx36 ko cpds rna seq cell line hek293 /variation crispr/cas9 mediated knockout passages 15 20 treated 2 âµm carboxypyridostatin (cpds) |
| GSE118532_0_v_1_rnf168_human | control nec esophagus cancer cell passages 15 18 passage /variation cells vs sirnf168 nec esophagus cancer cell passages 15 18 passage /variation rnf168 knockdown cells |
| GSE158502,GSE158506_3_v_0_fat1_mouse | control background mixed k14cre ryfp skin scc vs adcre fat ko background mixed kras p53 fat1fl/fl ryfp lung cancer |
| GSE185922_1_v_2_riok2_human | control individual primary human hematopoietic stem progenitor cells vs riok2 ko individual primary human hematopoietic stem progenitor cells |
| GSE207787_1_v_2_pdha1_human | huvec cells p3 sicontrol 16hr tnf biol rep cell line primary endothlelial ctrl 10ng/ml vs huvec cells p3 sipdha1 0hr tnf biol rep cell line primary endothlelial pdha1 knockdown vehicle |
| GSE207787_1_v_4_pdha1_human | huvec cells p3 sicontrol 16hr tnf biol rep cell line primary endothlelial ctrl 10ng/ml vs huvec cells p3 sipdha1 16hr tnf biol rep cell line primary endothlelial pdha1 knockdown 10ng/ml |
| GSE207787_3_v_4_pdha1_human | huvec cells p3 sicontrol 0hr tnf biol rep cell line primary endothlelial ctrl vehicle vs huvec cells p3 sipdha1 16hr tnf biol rep cell line primary endothlelial pdha1 knockdown 10ng/ml |
| GSE207787_3_v_2_pdha1_human | huvec cells p3 sicontrol 0hr tnf biol rep cell line primary endothlelial ctrl vehicle vs huvec cells p3 sipdha1 0hr tnf biol rep cell line primary endothlelial pdha1 knockdown vehicle |
| GSE132433,GSE132436_1_v_0_nr2f2_human | cell line mcf7 breast /variation wild type 12hr vs nr2f2 ko cell line mcf7 breast /variation 12hr |
| GSE144500_8_v_2_ventx_human | vo es derived primordial germ cells sorting profie mcherry+ epcam+ ventx wild type (vo) day 4 merged vs ko pop3 es derived primordial germ cells sorting profie gfp+ mcherry+ epcam cd49f ventx knock (ko) day 4 |
| GSE144500_7_v_6_ventx_human | vo pop3 es derived primordial germ cells sorting profie gfp+ mcherry+ epcam cd49f ventx wild type (vo) day 4 vs ko 4 es derived primordial germ cells sorting profie mcherry+ epcam+ ventx knock (ko) day |
| GSE144500_8_v_11_ventx_human | vo es derived primordial germ cells sorting profie mcherry+ epcam+ ventx wild type (vo) day 4 merged vs ko es derived primordial germ cells sorting profie mcherry+ ventx knock (ko) day 4 |
| GSE144500_8_v_6_ventx_human | vo es derived primordial germ cells sorting profie mcherry+ epcam+ ventx wild type (vo) day 4 merged vs ko 4 es derived primordial germ cells sorting profie mcherry+ epcam+ ventx knock (ko) day |
| GSE172019_2_v_8_rnf2_human | condw cell line hela rnf219 ko + wt actd vs condhela cell line hela parental actd |
| GSE172019_2_v_3_rnf2_human | condw cell line hela rnf219 ko + wt actd vs condko cell line hela rnf219 ko actd |
| GSE139975_3_v_0_rnf2_mouse | rnf20/40 control isolated adult cms r26fscas9 2a gfp/+ myh7yfp/+ age postnatal 4 weeks sample type (gfp+) aav tnt cre vs rnf20/40 ko isolated adult cms r26fscas9 2a gfp/+ myh7yfp/+ age postnatal 4 weeks sample type (yfp+) aav tnt cre u6 rnf20/40grnas |
| GSE139975_3_v_1_rnf2_mouse | rnf20/40 control isolated adult cms r26fscas9 2a gfp/+ myh7yfp/+ age postnatal 4 weeks sample type (gfp+) aav tnt cre vs gata4/6 ko facs sorted p6 cms r26mtmg/mtmg gata4fx/fx gata6fx/fx age postnatal day 6 sample type (gfp+) aav tnt cre |
| GSE231339_1_v_0_itgav_human | rnaseq mda231 cell line mda mb 231 breast cancer cells sgctrl control vs rnaseq mda231 cell line mda mb 231 breast cancer cells sgitgav itgav knockout |
| GSE230646_0_v_2_rbpms_human | shrna control 1 kasumi rna seq peripheral blood cell line myeloblast leukemic 8 21 chromosome translocation scramble vs shrbpms 1 kasumi rna seq peripheral blood cell line myeloblast leukemic 8 21 chromosome translocation rbpms knockdown |
| GSE202359_1_v_0_rbpms_mouse | 4 cells non silencing morpholino embryos control injected vs 4 cells rbpms2 morpholino embryos knockdown injected |
| GSE138228,GSE138230_2_v_1_cdkn1c_mouse | e16 control strain background cd1 age cdkn1c locus cre emx1 cortex madm chr. 7 vs e16 ko strain background cd1 age cdkn1c locus cre emx1 cortex madm chr. 7 |
| GSE126402_5_v_7_tal1_mouse | ctrl lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs tal1ko hsc rag2gfpneg rag2 gfp negative cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_2_v_0_tal1_mouse | ctrl lmpp rag2gfppos rag2 gfp positive cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_5_v_6_tal1_mouse | ctrl lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs tal1ko lmpp rag2gfppos rag2 gfp positive cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_1_v_6_tal1_mouse | ctrl hsc rag2gfpneg rag2 gfp negative cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko lmpp rag2gfppos rag2 gfp positive cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_4_v_0_tal1_mouse | ctrl hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_2_v_7_tal1_mouse | ctrl lmpp rag2gfppos rag2 gfp positive cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs tal1ko hsc rag2gfpneg rag2 gfp negative cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_2_v_3_tal1_mouse | ctrl lmpp rag2gfppos rag2 gfp positive cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs tal1ko hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_5_v_3_tal1_mouse | ctrl lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe wild type (tal1 f/f) rag2gfp bone marrow cd135+lsk vs tal1ko hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_1_v_0_tal1_mouse | ctrl hsc rag2gfpneg rag2 gfp negative cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs lmpp rag2gfpneg rag2 gfp negative cd135 positive genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_4_v_7_tal1_mouse | ctrl hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko hsc rag2gfpneg rag2 gfp negative cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_1_v_3_tal1_mouse | ctrl hsc rag2gfpneg rag2 gfp negative cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_4_v_6_tal1_mouse | ctrl hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko lmpp rag2gfppos rag2 gfp positive cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow cd135+ lsk |
| GSE126402_1_v_7_tal1_mouse | ctrl hsc rag2gfpneg rag2 gfp negative cd135 genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko hsc rag2gfpneg rag2 gfp negative cd135 genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE126402_4_v_3_tal1_mouse | ctrl hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe wild type (tal1 f/f) rag2gfp bone marrow lsk vs tal1ko hsc rag2gfppos rag2 gfp positive cd135 negative genoytpe vavicre tal1f/f rag2gfp tal1 ko bone marrow lsk |
| GSE122425_1_v_0_nsun2_human | wt strain hek293 passages 8 12 kidney vs nsun2 ko strain hek293 passages 8 12 kidney |
| GSE214685_0_v_1_nsun2_human | y79 cells shcontrol cell line human retinoblastoma wt vs y79 cells shnsun2 cell line human retinoblastoma nsun2 knockdown |
| GSE211126_1_v_0_hapln1_mouse | fibroblasts kpc biol. rep. solid tumor cell line primary cafs fibroblast wildtype none vs kpc hapln1 biol. rep. solid tumor cell line krasg12d trp53r172h elas creer overexpression none |
| GSE211126_3_v_4_hapln1_mouse | fibroblasts kpc hapln1 biol. rep. solid tumor cell line primary cafs fibroblast wildtype none vs kpc hapln1 ascites biol. rep. cell line tumor krasg12d trp53r172h elas creer overexpression none |
| GSE211126_3_v_0_hapln1_mouse | fibroblasts kpc hapln1 biol. rep. solid tumor cell line primary cafs fibroblast wildtype none vs kpc hapln1 biol. rep. solid tumor cell line krasg12d trp53r172h elas creer overexpression none |
| GSE211126_1_v_4_hapln1_mouse | fibroblasts kpc biol. rep. solid tumor cell line primary cafs fibroblast wildtype none vs kpc hapln1 ascites biol. rep. cell line tumor krasg12d trp53r172h elas creer overexpression none |
| GSE137137_1_v_0_rcor1_mouse | wt treg replicate wild type foxp3+ yfp sorted regulatory cell vs rcor1 treg replicate deletion foxp3+ yfp sorted regulatory cell |
| GSE146070_1_v_0_edem3_human | hepg2 cell hepatoma cells wt edem3 clone transfected lentivirus containing crispr/cas9 control sgrna vs hepg2 cell hepatoma cells ko edem3 clone transfected lentivirus containing crispr/cas9 sgrna |
| GSE168070_3_v_2_erbb4_mouse | strain background c57bl/6 erbb4 floxxed (wt) bone marrow macrophage (m1) wt vs strain background c57bl/6 lysmcre/erbb4 floxxed (ko) bone marrow macrophage (m1) ko |
| GSE219195_4_v_2_rbm12_human | ineuron wt drug cell line human ipsc derived neurons glutamatergic excitatory vs ineuron rbm12 knockdown isoproterenol cell line human ipsc derived neurons glutamatergic excitatory crispr interference beta 2 adrenergic receptor induced (1 um isoproterenol) |
| GSE219195_1_v_3_rbm12_human | hek293 wt drug cell line human embryonic kidney vs hek293 rbm12 ko drug cell line human embryonic kidney crispr knockout guide |
| GSE219195_0_v_5_rbm12_human | ineuron wt isoproterenol cell line human ipsc derived neurons glutamatergic excitatory beta 2 adrenergic receptor induced (1 um isoproterenol) vs ineuron rbm12 knockdown drug cell line human ipsc derived neurons glutamatergic excitatory crispr interference |
| GSE219195_4_v_5_rbm12_human | ineuron wt drug cell line human ipsc derived neurons glutamatergic excitatory vs ineuron rbm12 knockdown drug cell line human ipsc derived neurons glutamatergic excitatory crispr interference |
| GSE219195_1_v_5_rbm12_human | hek293 wt drug cell line human embryonic kidney vs ineuron rbm12 knockdown drug cell line human ipsc derived neurons glutamatergic excitatory crispr interference |
| GSE219195_1_v_2_rbm12_human | hek293 wt drug cell line human embryonic kidney vs ineuron rbm12 knockdown isoproterenol cell line human ipsc derived neurons glutamatergic excitatory crispr interference beta 2 adrenergic receptor induced (1 um isoproterenol) |
| GSE219195_0_v_2_rbm12_human | ineuron wt isoproterenol cell line human ipsc derived neurons glutamatergic excitatory beta 2 adrenergic receptor induced (1 um isoproterenol) vs ineuron rbm12 knockdown isoproterenol cell line human ipsc derived neurons glutamatergic excitatory crispr interference beta 2 adrenergic receptor induced (1 um isoproterenol) |
| GSE148263_6_v_0_trim3_human | rpe1 cell line htert geneotype wild type drug human retinal pigmented epithelial cells vs rpe1 trim37 ko cell line htert geneotype knockout drug human retinal pigmented epithelial cells |
| GSE148263_6_v_9_trim3_human | rpe1 cell line htert geneotype wild type drug human retinal pigmented epithelial cells vs rpe1 trim37 ko cell line htert geneotype knockout drug human retinal pigmented epithelial cells |
| GSE214248_0_v_1_cxcl8_human | cells glioblastoma cell line glioma stem wt vs cells glioblastoma cell line glioma stem cxcl8 knockdown |
| GSE246983_1_v_0_cdk12_human | c4 2 cells human prostate tumor cell line cancer epithelial like wt none vs c4 2 cells human prostate tumor cell line cancer epithelial like cdk12 knockout none |
| GSE166767_1_v_2_ctcfl_human | ovcar3 control ctcfl none cell line biological replicate vs ovcar3 boris oe ctcfl overexpression cell line biological replicate |
| GSE118816_2_v_1_myo1c_human | control knockdown podocytes (glomerulus cells) /variation differentiation 14 days immortalized human cell lines vs myo1c knockdown podocytes (glomerulus cells) /variation differentiation 14 days immortalized human cell lines |
| GSE118816_0_v_1_myo1c_human | control knockdown podocytes (glomerulus cells) /variation differentiation 14 days tgfbeta immortalized human cell lines vs myo1c knockdown podocytes (glomerulus cells) /variation differentiation 14 days immortalized human cell lines |
| GSE118816_2_v_3_myo1c_human | control knockdown podocytes (glomerulus cells) /variation differentiation 14 days immortalized human cell lines vs myo1c knockdown podocytes (glomerulus cells) /variation differentiation 14 days tgfbeta immortalized human cell lines |
| GSE118816_0_v_3_myo1c_human | control knockdown podocytes (glomerulus cells) /variation differentiation 14 days tgfbeta immortalized human cell lines vs myo1c knockdown podocytes (glomerulus cells) /variation differentiation 14 days tgfbeta immortalized human cell lines |
| GSE129244_3_v_5_lmo2_mouse | wild type dn2/3 replicate cd4 cells cell subtype vs lmo2tg ldb1 ko dn4 replicate cd4 cells cell subtype |
| GSE129244_0_v_5_lmo2_mouse | wild type dn4 replicate cd4 cells cell subtype vs lmo2tg ldb1 ko dn4 replicate cd4 cells cell subtype |
| GSE129244_3_v_1_lmo2_mouse | wild type dn2/3 replicate cd4 cells cell subtype vs lmo2tg ldb1 ko dn2/3 replicate cd4 cells cell subtype |
| GSE129244_0_v_1_lmo2_mouse | wild type dn4 replicate cd4 cells cell subtype vs lmo2tg ldb1 ko dn2/3 replicate cd4 cells cell subtype |
| GSE165307_3_v_0_gfi1_human | floating a549 ctrl cell line lung adenocarcinoma control force suspension 48hrs vs floating a549 gfi1 cell line lung adenocarcinoma overexpression force suspension 48hrs overexpress |
| GSE165308_1_v_0_gfi1_human | h1155 wt cell line neuroendocrine large lung cancer wildtype vs h1155 gfi1ko cell line neuroendocrine large lung cancer gfi1 knockout knock |
| GSE165307_2_v_0_gfi1_human | attached a549 gfi1 cell line lung adenocarcinoma overexpression untreated overexpress vs floating a549 gfi1 cell line lung adenocarcinoma overexpression force suspension 48hrs overexpress |
| GSE165307_1_v_0_gfi1_human | attached a549 ctrl cell line lung adenocarcinoma control untreated vs floating a549 gfi1 cell line lung adenocarcinoma overexpression force suspension 48hrs overexpress |
| GSE161170,GSE161268_0_v_3_med1_human | control lncap etoh vehicle time course androgen deprivation 3 days cell line disease prostate cancer cells vs alternative med19 lncap etoh vehicle overexpression time course androgen deprivation 3 days cell line disease prostate cancer cells |
| GSE242096,GSE242098_1_v_0_med1_mouse | kpc1199 lacz 1 cell line pancreatic tumor wt vs kpc1199 med12 cell line pancreatic tumor knockout |
| GSE242083,GSE242098_3_v_5_med1_human | mia lacz cell line miapaca2 pancreatic tumor wt vs panc1 med12 sg4 cell line pancreatic tumor knockout |
| GSE140651,GSE140653_2_v_6_med1_human | p3hr1 cells control med12 tada2b ko cell line burkitt lymphoma vs p3hr1 cells smc1a ko cell line burkitt lymphoma |
| GSE242083,GSE242098_2_v_1_med1_human | panc1 lacz cell line pancreatic tumor wt vs mia med12 sg5 cell line miapaca2 pancreatic tumor knockout |
| GSE140651,GSE140653_3_v_7_med1_human | p3hr1 cells control smc1a supt16h ko cell line burkitt lymphoma vs p3hr1 cells med12 ko cell line burkitt lymphoma |
| GSE140651,GSE140653_2_v_7_med1_human | p3hr1 cells control med12 tada2b ko cell line burkitt lymphoma vs p3hr1 cells med12 ko cell line burkitt lymphoma |
| GSE242083,GSE242098_2_v_5_med1_human | panc1 lacz cell line pancreatic tumor wt vs panc1 med12 sg4 cell line pancreatic tumor knockout |
| GSE161170,GSE161268_1_v_2_med1_human | control lncap r1881 10 nm overnight time course androgen deprivation 3 days cell line disease prostate cancer cells vs med19 lncap r1881 10 nm overnight overexpression time course androgen deprivation 3 days cell line disease prostate cancer cells |
| GSE242083,GSE242098_2_v_4_med1_human | panc1 lacz cell line pancreatic tumor wt vs mia med12 sg4 cell line miapaca2 pancreatic tumor knockout |
| GSE242083,GSE242098_3_v_0_med1_human | mia lacz cell line miapaca2 pancreatic tumor wt vs panc1 med12 sg5 cell line pancreatic tumor knockout |
| GSE140651,GSE140653_2_v_1_med1_human | p3hr1 cells control med12 tada2b ko cell line burkitt lymphoma vs p3hr1 cells supt16h ko cell line burkitt lymphoma |
| GSE140651,GSE140653_5_v_7_med1_human | akata ebv+ cells control myc ko burkitt lymphoma vs p3hr1 cells med12 ko cell line burkitt lymphoma |
| GSE242083,GSE242098_3_v_1_med1_human | mia lacz cell line miapaca2 pancreatic tumor wt vs mia med12 sg5 cell line miapaca2 pancreatic tumor knockout |
| GSE242083,GSE242098_3_v_4_med1_human | mia lacz cell line miapaca2 pancreatic tumor wt vs mia med12 sg4 cell line miapaca2 pancreatic tumor knockout |
| GSE242083,GSE242098_2_v_0_med1_human | panc1 lacz cell line pancreatic tumor wt vs panc1 med12 sg5 cell line pancreatic tumor knockout |
| GSE161170,GSE161268_1_v_3_med1_human | control lncap r1881 10 nm overnight time course androgen deprivation 3 days cell line disease prostate cancer cells vs alternative med19 lncap etoh vehicle overexpression time course androgen deprivation 3 days cell line disease prostate cancer cells |
| GSE161170,GSE161268_0_v_2_med1_human | control lncap etoh vehicle time course androgen deprivation 3 days cell line disease prostate cancer cells vs med19 lncap r1881 10 nm overnight overexpression time course androgen deprivation 3 days cell line disease prostate cancer cells |
| GSE140651,GSE140653_2_v_0_med1_human | p3hr1 cells control med12 tada2b ko cell line burkitt lymphoma vs akata ebv+ cells myc ko burkitt lymphoma |
| GSE193624_1_v_0_med1_mouse | strain c57bl/6 spleen wt cd8 cells vs strain c57bl/6 spleen med1 ko cd8 cells |
| GSE140651,GSE140653_2_v_4_med1_human | p3hr1 cells control med12 tada2b ko cell line burkitt lymphoma vs p3hr1 cells tada2b ko cell line burkitt lymphoma |
| GSE239578_5_v_4_cxadr_mouse | control mouse gmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse mep population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_1_v_7_cxadr_mouse | control mouse cmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse lsk population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_0_v_7_cxadr_mouse | control mouse lsk population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse lsk population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_1_v_3_cxadr_mouse | control mouse cmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse gmp population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_2_v_7_cxadr_mouse | control mouse mep population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse lsk population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_2_v_3_cxadr_mouse | control mouse mep population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse gmp population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_0_v_6_cxadr_mouse | control mouse lsk population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse cmp population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_0_v_4_cxadr_mouse | control mouse lsk population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse mep population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_0_v_3_cxadr_mouse | control mouse lsk population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse gmp population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_5_v_6_cxadr_mouse | control mouse gmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse cmp population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_1_v_4_cxadr_mouse | control mouse cmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse mep population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE239578_5_v_7_cxadr_mouse | control mouse gmp population bone marrow (mx1 cre cxadrfl/fl) vs cxadr ko mouse lsk population bone marrow (mx1 cre+ cxadrfl/fl) |
| GSE149769_1_v_0_nlrp12_mouse | wt tumor strain background c57bl6/j age 20 weeks wild type colorectal vs nlrp12 ko tumor strain background c57bl6/j age 20 weeks / colorectal |
| GSE206729_3_v_1_trps1_human | biol rep cell line hct116 epithelial wt vs biol rep cell line sw480 epithelial trps1 mt overexpression |
| GSE206729_4_v_1_trps1_human | sw480trps1 biol rep cell line sw480 epithelial trps1 wt overexpression vs biol rep cell line sw480 epithelial trps1 mt overexpression |
| GSE206729_2_v_0_trps1_human | biol rep cell line sw480 epithelial wt vs biol rep cell line hct116 epithelial trps1 mt overexpression |
| GSE206729_5_v_0_trps1_human | biol rep cell line hct116 epithelial trps1 wt overexpression vs biol rep cell line hct116 epithelial trps1 mt overexpression |
| GSE206729_5_v_1_trps1_human | biol rep cell line hct116 epithelial trps1 wt overexpression vs biol rep cell line sw480 epithelial trps1 mt overexpression |
| GSE206729_4_v_0_trps1_human | sw480trps1 biol rep cell line sw480 epithelial trps1 wt overexpression vs biol rep cell line hct116 epithelial trps1 mt overexpression |
| GSE206729_2_v_1_trps1_human | biol rep cell line sw480 epithelial wt vs biol rep cell line sw480 epithelial trps1 mt overexpression |
| GSE206729_3_v_0_trps1_human | biol rep cell line hct116 epithelial wt vs biol rep cell line hct116 epithelial trps1 mt overexpression |
| GSE210911_1_v_0_crem_human | chl 1 control rep cell line melanoma cells wt sirna vs chl 1 crem kd rep cell line melanoma cells knockdown sirna |
| GSE200159_1_v_0_setd4_mouse | nscs adv gfp control brain cell line primary neural stem wt vs nscs setd4 oe brain cell line primary neural stem overexpression adv gfp |
| GSE211226_1_v_2_sirpa_mouse | sirpa ntc cell line b16f10 melanoma cells non target control vs sirpa oe cell line b16f10 melanoma cells overexpression |
| GSE211226_1_v_0_sirpa_mouse | sirpa ntc cell line b16f10 melanoma cells non target control vs sirpa kd cell line b16f10 melanoma cells knockdown |
| GSE73628_1_v_2_igf1_human | gfp control overexpressed hmec cells mammary epithelial overexpression breast vs humanigf1r overexpressed hmec cells mammary epithelial overexpression igf1r breast |
| GSE131798,GSE131804_5_v_0_igf1_mouse | wt ol day14 /variation scxcreert2 / igf1rflox/flox tamoxifen yes plantaris tendon vs ko ol day7 /variation scxcreert2+/+ igf1rflox/flox tamoxifen yes plantaris tendon |
| GSE73628_8_v_2_igf1_human | gfp control overexpressed hmec cells mammary epithelial overexpression breast vs humanigf1r overexpressed hmec cells mammary epithelial overexpression igf1r breast |
| GSE131798,GSE131804_1_v_0_igf1_mouse | wt ol day7 /variation scxcreert2 / igf1rflox/flox tamoxifen yes plantaris tendon vs ko ol day7 /variation scxcreert2+/+ igf1rflox/flox tamoxifen yes plantaris tendon |
| GSE131798,GSE131804_2_v_0_igf1_mouse | wt noc day0 /variation scxcreert2 / igf1rflox/flox tamoxifen plantaris tendon vs ko ol day7 /variation scxcreert2+/+ igf1rflox/flox tamoxifen yes plantaris tendon |
| GSE200687,GSE200688_1_v_0_sox15_mouse | mesc wt mouse embryonic stem cells vs mesc sox15 ko mouse embryonic stem cells |
| GSE190864,GSE190907_1_v_0_cacybp_human | cacybp ko wt human skin organoid vs cacybp ko human skin organoid |
| GSE136869_1_v_0_lpar2_mouse | wildtype mouse strain 129.c57bl6 hippocampus age 10 12 wks gender male wildtye control vs lpar2 / mouse strain 129.c57bl6 hippocampus age 10 12 wks gender male knockout |
| GSE225647_1_v_3_srsf1_mouse | ctrl strain c57bl/6 cortex srsf10 flox /flox nestin cre vs npc kd strain c57bl/6 cortex cell line primary cultured neural progenitor cells srsf10 knockdown |
| GSE244710_3_v_2_srsf1_human | cal 27 cells nc2 tongue cell line oral squamous carcinoma wt vs scc 4 cells kd1 tongue cell line oral squamous carcinoma srsf1 knockdown |
| GSE244710_3_v_0_srsf1_human | cal 27 cells nc2 tongue cell line oral squamous carcinoma wt vs cal 27 cells kd2 tongue cell line oral squamous carcinoma srsf1 knockdown |
| GSE225647_0_v_3_srsf1_mouse | npc ctrl strain c57bl/6 cortex cell line primary cultured neural progenitor cells wt vs npc kd strain c57bl/6 cortex cell line primary cultured neural progenitor cells srsf10 knockdown |
| GSE244710_1_v_2_srsf1_human | scc 4 cells nc1 tongue cell line oral squamous carcinoma wt vs scc 4 cells kd1 tongue cell line oral squamous carcinoma srsf1 knockdown |
| GSE244710_1_v_0_srsf1_human | scc 4 cells nc1 tongue cell line oral squamous carcinoma wt vs cal 27 cells kd2 tongue cell line oral squamous carcinoma srsf1 knockdown |
| GSE245418_0_v_2_cd109_human | control nasopharynx cell line 5 8f nasopharyngeal carcinoma wt vs shcd109 nasopharynx cell line 5 8f nasopharyngeal carcinoma cd109 knockdown |
| GSE254848_9_v_3_ptges_mouse | proximal colon b6d wt 10 weeks sample strain sex male age vs proximal colon b6d ko 10 weeks sample strain sex male age ptges1 |
| GSE254848_4_v_13_ptges_mouse | proximal colon ad wt 10 weeks sample strain sex male age vs proximal colon b6d ko 10 weeks sample strain sex male age ptges1 |
| GSE254848_9_v_13_ptges_mouse | proximal colon b6d wt 10 weeks sample strain sex male age vs proximal colon b6d ko 10 weeks sample strain sex male age ptges1 |
| GSE254848_4_v_3_ptges_mouse | proximal colon ad wt 10 weeks sample strain sex male age vs proximal colon b6d ko 10 weeks sample strain sex male age ptges1 |
| GSE254848_9_v_8_ptges_mouse | proximal colon b6d wt 10 weeks sample strain sex male age vs proximal colon ad ko 10 weeks sample strain sex male age ptges1 |
| GSE214583,GSE214585_1_v_0_steap1_human | 22rv1 wt cell line human prostate epithelial cells wildtype none vs 22rv1 steap1 cell line human prostate epithelial cells knockout none |
| GSE111035,GSE111040_10_v_12_plag1_mouse | ut wt uterus mouse id vs ut ko plag1ko uterus mouse id |
| GSE111035,GSE111040_3_v_12_plag1_mouse | myo wt myometrium mouse id uterus vs ut ko plag1ko uterus mouse id |
| GSE111035,GSE111040_8_v_13_plag1_mouse | endo wt endometrium mouse id uterus vs endo ko plag1ko endometrium mouse id uterus |
| GSE140576_0_v_2_plag1_mouse | wt strain brown swiss epididymis age 7 weeks wild type vs ko strain brown swiss epididymis age 7 weeks plag1 / |
| GSE111035,GSE111040_3_v_13_plag1_mouse | myo wt myometrium mouse id uterus vs endo ko plag1ko endometrium mouse id uterus |
| GSE111035,GSE111040_8_v_9_plag1_mouse | endo wt endometrium mouse id uterus vs myo ko plag1ko myometrium mouse id uterus |
| GSE111035,GSE111040_8_v_12_plag1_mouse | endo wt endometrium mouse id uterus vs ut ko plag1ko uterus mouse id |
| GSE111035,GSE111040_8_v_5_plag1_mouse | endo wt endometrium mouse id uterus vs myo ko plag1ko myometrium mouse id uterus |
| GSE111035,GSE111040_10_v_9_plag1_mouse | ut wt uterus mouse id vs myo ko plag1ko myometrium mouse id uterus |
| GSE111035,GSE111040_10_v_13_plag1_mouse | ut wt uterus mouse id vs endo ko plag1ko endometrium mouse id uterus |
| GSE190316,GSE190324_4_v_11_rbm4_human | sy5y rbm45ko dmso sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate control 0.1% seven days vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE190316,GSE190324_10_v_9_rbm4_human | sy5y korescue dmso sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate control 0.1% seven days vs sy5y rbm45ko gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate culture media |
| GSE220613_0_v_1_rbm4_human | ctl cell line kyse150 esophageal squamous carcinoma wt infected lentivirus time cultured 4 days vs rbm4 cell line kyse150 esophageal squamous carcinoma knockdown infected lentivirus time cultured 4 days |
| GSE190316,GSE190324_0_v_11_rbm4_human | sy5y korescue ra sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate differentiation 10 âµm 0.1% dmso seven days vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE190316,GSE190324_10_v_11_rbm4_human | sy5y korescue dmso sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate control 0.1% seven days vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE190316,GSE190324_0_v_9_rbm4_human | sy5y korescue ra sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate differentiation 10 âµm 0.1% dmso seven days vs sy5y rbm45ko gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate culture media |
| GSE190316,GSE190324_6_v_9_rbm4_human | sy5y control gm sk n sh neuroblastoma subline strain crl 2266 cas9 grna isogenic clonal isolate culture media vs sy5y rbm45ko gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate culture media |
| GSE190316,GSE190324_6_v_11_rbm4_human | sy5y control gm sk n sh neuroblastoma subline strain crl 2266 cas9 grna isogenic clonal isolate culture media vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE147893,GSE147897_2_v_1_rbm4_human | wild type replicate cell line hap1 kbm 7 derived near haploid vs rbm4 ko clone cell line hap1 kbm 7 derived near haploid |
| GSE190316,GSE190324_1_v_11_rbm4_human | sy5y control dmso sk n sh neuroblastoma subline strain crl 2266 cas9 grna isogenic clonal isolate 0.1% seven days vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE190316,GSE190324_5_v_11_rbm4_human | sy5y rbm45ko ra sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate differentiation 10 âµm 0.1% dmso seven days vs sy5y korescue gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko +f ha tagged mut{delta}grna isogenic clonal isolate culture media |
| GSE190322,GSE190324_3_v_4_rbm4_mouse | mhippoe2 control transformed mouse hippocampal neuron cell strain crl cfw(sw) 024 library ribo depleted rna seq cas9 grna isogenic clonal isolate mhippoe 2 vs mhippoe2 korescue transformed mouse hippocampal neuron cell strain crl cfw(sw) 024 library ribo depleted rna seq cas9 guided rbm45 ko +f ha tagged mut[delta]grna isogenic clonal isolate mhippoe 2 |
| GSE190316,GSE190324_1_v_9_rbm4_human | sy5y control dmso sk n sh neuroblastoma subline strain crl 2266 cas9 grna isogenic clonal isolate 0.1% seven days vs sy5y rbm45ko gm sk n sh neuroblastoma subline strain crl 2266 cas9 guided rbm45 ko isogenic clonal isolate culture media |
| GSE126776_2_v_1_pelp1_human | 3d lxsn 7l cell line mcf luminal breast cancer pelp1 crispr ko transfected vector control cells vs 3d cytopelp 7l cell line mcf luminal breast cancer pelp1 crispr ko transfected nls mutant cells |
| GSE126776_0_v_1_pelp1_human | 3d wtpelp 7l cell line mcf luminal breast cancer pelp1 crispr ko transfected wt cells vs 3d cytopelp 7l cell line mcf luminal breast cancer pelp1 crispr ko transfected nls mutant cells |
| GSE209928_0_v_1_kmt2b_human | hela vc cell line epithelial wild type control vs hela kmt2b cell line epithelial stable overexpression |
| GSE79572_2_v_1_pax8_human | wt skov3 human ovarian adenocarcinoma cell line skov 3 sirna si rna ctr transfected cancer cells vs pax8 ko skov 3 human ovarian adenocarcinoma cell line sirna si rna transfected cancer cells |
| GSE79572_0_v_1_pax8_human | wt ft 194 immortalized fallopian tube secretory epithelial cell line sirna si rna ctr transfected cells vs pax8 ko skov 3 human ovarian adenocarcinoma cell line sirna si rna transfected cancer cells |
| GSE139072_0_v_2_pabpn1_mouse | pabpn1l wt strain background c57bl/6 /variation embryo vs pabpn1l ko strain background c57bl/6 /variation embryo |
| GSE105406_2_v_3_ptcd1_mouse | hngjvafxx heart wild type control vs hngjvafxx heart ptcd1 knockout cmc |
| GSE105406_0_v_3_ptcd1_mouse | hngjvafxx heart wild type cmc treated vs hngjvafxx heart ptcd1 knockout cmc |
| GSE134986_1_v_3_oma1_human | wt untreated gene knockdown drug hek293t vs oma1 kd oligomycin gene knockdown oma1(sgrna i1) drug hek293t |
| GSE134986_2_v_8_oma1_human | oma1 kd untreated gene knockdown oma1(sgrna i1) drug hek293t vs hri kd oligomycin gene knockdown (sgrna i1) drug hek293t |
| GSE96057_1_v_2_oma1_mouse | c57 mp strain/background c57bl/6jolahsd /variation wild type age 12 weeks sex male heart isoproterenol wt vs oma mp strain/background c57bl/6jolahsd /variation oma1 ko age 12 weeks sex male heart isoproterenol |
| GSE134986_2_v_0_oma1_human | oma1 kd untreated gene knockdown oma1(sgrna i1) drug hek293t vs dele1 kd oligomycin gene knockdown (sgrna i1) drug hek293t |
| GSE134986_7_v_3_oma1_human | wt oligomycin gene knockdown non targeting control(1872) drug hek293t vs oma1 kd oligomycin gene knockdown oma1(sgrna i1) drug hek293t |
| GSE196835_0_v_1_ddx1_human | a549 sictrl cell line human lung adenocarcinoma /variation control plasmid cells (human line) vs a549 siddx17 cell line human lung adenocarcinoma /variation ddx17 knockdown cells (human line) |
| GSE201217_2_v_6_usf2_mouse | pwk unirradiated control tail primary fibroblast wt none vs usf2 shrna treated pwk irradiated 6 hours tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_2_v_1_usf2_mouse | pwk unirradiated control tail primary fibroblast wt none vs usf2 shrna treated pwk senescent days tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_3_v_6_usf2_mouse | pwk senescent tail primary fibroblast wt ionizing radiation 15 gy vs usf2 shrna treated pwk irradiated 6 hours tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_4_v_6_usf2_mouse | usf2 shrna treated pwk unirradiated control tail primary fibroblast knockdown none vs usf2 shrna treated pwk irradiated 6 hours tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_5_v_1_usf2_mouse | scrambled shrna treated pwk 2 tail primary fibroblast control ionizing radiation 15 gy vs usf2 shrna treated pwk senescent days tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_3_v_1_usf2_mouse | pwk senescent tail primary fibroblast wt ionizing radiation 15 gy vs usf2 shrna treated pwk senescent days tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE201217_4_v_1_usf2_mouse | usf2 shrna treated pwk unirradiated control tail primary fibroblast knockdown none vs usf2 shrna treated pwk senescent days tail primary fibroblast knockdown ionizing radiation 15 gy |
| GSE191022,GSE191031_0_v_1_igf2bp2_human | kgn cells nc cell line control plasmid vs kgn cells oe igf2bp2 cell line overexpression expression |
| GSE166176_1_v_2_igf2bp2_mouse | wt strain c57bl/6 myeloid biased hsc igf2bp2 age 3 months vs ko strain c57bl/6 myeloid biased hsc igf2bp2 age 3 months |
| GSE71468,GSE76476_0_v_3_rbfox1_human | control norbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) vs hnrnpm k +rbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) |
| GSE71468,GSE76476_2_v_3_rbfox1_human | control +rbfox1 human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) vs hnrnpm k +rbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) |
| GSE167373_0_v_3_rbfox1_human | exp 2 control rep cell line hek293 doxycycline condition (parental) vs exp rbfox1 oe rep cell line hek293 flp / <delta>fox2 flag mfox1 doxycycline condition overexpression âx96³fox2 |
| GSE167373_2_v_3_rbfox1_human | exp 1 control rep cell line hek293 flp / <delta>fox2 flag mfox1 treated condition âx96³fox2 vs exp rbfox1 oe rep cell line hek293 flp / <delta>fox2 flag mfox1 doxycycline condition overexpression âx96³fox2 |
| GSE71468,GSE76476_2_v_1_rbfox1_human | control +rbfox1 human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) vs hnrnpm k norbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) |
| GSE71468,GSE76476_0_v_1_rbfox1_human | control norbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) vs hnrnpm k norbfox human embryonic kidney expression rbfox1 hnrnp express flp rex 293 rbfox2 knockout cells (clone 7) |
| GSE182075_3_v_1_btn1a1_mouse | btn1a1 wt strain c57bl/6 lactating mammary gland age lactation 1 day wild type vs btn1a1 ko strain c57bl/6 lactating mammary gland age lactation 1 day / |
| GSE133213_4_v_15_znrf3_mouse | liver r&z wt phx 21d adult wild type chronic damage partial hepatectomy yes 21 days strain c57bl/6 vs liver r&z ko 1m 1 adult rnf43 znrf3 mutant chronic damage partial hepatectomy month strain c57bl/6 |
| GSE133213_11_v_3_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage partial hepatectomy 7 months strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_11_v_15_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage partial hepatectomy 7 months strain c57bl/6 vs liver r&z ko 1m 1 adult rnf43 znrf3 mutant chronic damage partial hepatectomy month strain c57bl/6 |
| GSE133213_6_v_1_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage 7 months strain c57bl/6 vs liver r&z ko adult rnf43 znrf3 mutant chronic damage partial hepatectomy months strain c57bl/6 |
| GSE133213_9_v_3_znrf3_mouse | liver r&z wt 3m 3 adult wild type chronic damage partial hepatectomy months strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_6_v_13_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage 7 months strain c57bl/6 vs liver r&z ko phx 7d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 7 days strain c57bl/6 |
| GSE133213_4_v_13_znrf3_mouse | liver r&z wt phx 21d adult wild type chronic damage partial hepatectomy yes 21 days strain c57bl/6 vs liver r&z ko phx 7d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 7 days strain c57bl/6 |
| GSE133213_6_v_15_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage 7 months strain c57bl/6 vs liver r&z ko 1m 1 adult rnf43 znrf3 mutant chronic damage partial hepatectomy month strain c57bl/6 |
| GSE133213_9_v_13_znrf3_mouse | liver r&z wt 3m 3 adult wild type chronic damage partial hepatectomy months strain c57bl/6 vs liver r&z ko phx 7d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 7 days strain c57bl/6 |
| GSE133213_9_v_5_znrf3_mouse | liver r&z wt 3m 3 adult wild type chronic damage partial hepatectomy months strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE133213_2_v_1_znrf3_mouse | liver r&z wt 1m adult wild type chronic damage partial hepatectomy 1 month strain c57bl/6 vs liver r&z ko adult rnf43 znrf3 mutant chronic damage partial hepatectomy months strain c57bl/6 |
| GSE133213_10_v_5_znrf3_mouse | liver r&z wt phx 7d adult wild type chronic damage partial hepatectomy yes 7 days strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE133213_11_v_5_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage partial hepatectomy 7 months strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE133213_10_v_3_znrf3_mouse | liver r&z wt phx 7d adult wild type chronic damage partial hepatectomy yes 7 days strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_6_v_5_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage 7 months strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE133213_9_v_15_znrf3_mouse | liver r&z wt 3m 3 adult wild type chronic damage partial hepatectomy months strain c57bl/6 vs liver r&z ko 1m 1 adult rnf43 znrf3 mutant chronic damage partial hepatectomy month strain c57bl/6 |
| GSE133213_4_v_3_znrf3_mouse | liver r&z wt phx 21d adult wild type chronic damage partial hepatectomy yes 21 days strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_6_v_3_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage 7 months strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_2_v_5_znrf3_mouse | liver r&z wt 1m adult wild type chronic damage partial hepatectomy 1 month strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE133213_11_v_13_znrf3_mouse | liver r&z wt 7m adult wild type chronic damage partial hepatectomy 7 months strain c57bl/6 vs liver r&z ko phx 7d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 7 days strain c57bl/6 |
| GSE133213_2_v_3_znrf3_mouse | liver r&z wt 1m adult wild type chronic damage partial hepatectomy 1 month strain c57bl/6 vs liver r&z ko cd adult rnf43 znrf3 mutant chronic damage yes days strain c57bl/6 |
| GSE133213_4_v_5_znrf3_mouse | liver r&z wt phx 21d adult wild type chronic damage partial hepatectomy yes 21 days strain c57bl/6 vs liver r&z ko phx 21d adult rnf43 znrf3 mutant chronic damage partial hepatectomy yes 21 days strain c57bl/6 |
| GSE209942_0_v_1_lhx2_human | shnc cell line esophageal squamous carcinoma cells wt shrna vs shlhx2 cell line esophageal squamous carcinoma cells lhx2 knockdown shrna |
| GSE210093_3_v_2_taf15_human | a549 cells sh nc cell line lung adenocarcinoma wt vs a549 cells sh taf15 cell line lung adenocarcinoma knockdown |
| GSE210093_0_v_2_taf15_human | a549 cells vector cell line lung adenocarcinoma wt vs a549 cells sh taf15 cell line lung adenocarcinoma knockdown |
| GSE241792_3_v_1_elf3_human | jeg 3 cells wt cell line vs jeg 3 cells sgelf3 cell line elf3 knockout |
| GSE202825_2_v_1_ano1_human | wt bxpc3 pancreas cell line epithelial vs oeano1 pancreas cell line bxpc3 epithelial ano1 overexpression |
| GSE199874_2_v_5_gabpb1_mouse | gabpb1(hetro x hetro) strains b6d2f1 developmental stage blastocyst wt hetero mouse embryo vs gabpb1(hetro x hetro)ko strains b6d2f1 developmental stage morula gabpb1 ko mouse embryo |
| GSE199874_4_v_5_gabpb1_mouse | alyref(hetro x hetro) strains b6d2f1 developmental stage blastocyst wt hetero mouse embryo vs gabpb1(hetro x hetro)ko strains b6d2f1 developmental stage morula gabpb1 ko mouse embryo |
| GSE199874_3_v_5_gabpb1_mouse | wt strains b6d2f1 developmental stage blastocyst mouse embryo vs gabpb1(hetro x hetro)ko strains b6d2f1 developmental stage morula gabpb1 ko mouse embryo |
| GSE246567_0_v_1_acat2_human | hgc 27 shnc stomach cell line gastric cancer cells wt transfected psih h1 puro vs hgc 27 shacat2 stomach cell line gastric cancer cells acat2 knockdown transfected psih h1 puro |
| GSE111138,GSE111149_1_v_0_runx3_mouse | wild type day 5 replicate strain c57bl/6 /variation runx3+/+ flow sorted cd8+ cells post lcmv arm infection p14 vs runx3 ko day 8 replicate read1 strain c57bl/6 /variation runx3fl/fl flow sorted cd8+ cells post lcmv arm infection p14 |
| GSE111138,GSE111149_1_v_3_runx3_mouse | wild type day 5 replicate strain c57bl/6 /variation runx3+/+ flow sorted cd8+ cells post lcmv arm infection p14 vs runx3 ko day 5 replicate strain c57bl/6 /variation runx3fl/fl flow sorted cd8+ cells post lcmv arm infection p14 |
| GSE129772_2_v_1_runx3_mouse | wt effector cd8 positive cell lymphocyte vs runx3ko effector cd8 positive cell runx3 ko lymphocyte |
| GSE129772_2_v_3_runx3_mouse | wt effector cd8 positive cell lymphocyte vs mazrko runx3ko effector cd8 positive cell mazr/runx3 ko lymphocyte |
| GSE181059_2_v_1_runx3_human | hspcs ctrl hspc cord blood control vs hspcs runx3 hspc cord blood overexpression |
| GSE250560_1_v_0_foxo1_mouse | control /r kidney disease state ischemia reperfusion injury induced acute wt vs myeloid specific foxo1 knockout /r kidney disease state ischemia reperfusion injury induced acute |
| GSE128634,GSE128636_4_v_3_foxo1_human | rnaseq control 32h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 24h (replicate huvecs time primary pooled donors |
| GSE128634,GSE128636_4_v_5_foxo1_human | rnaseq control 32h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 16h (replicate huvecs time primary pooled donors |
| GSE128634,GSE128636_2_v_0_foxo1_human | rnaseq control 16h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 32h (replicate huvecs time primary pooled donors |
| GSE161027,GSE161028_1_v_3_foxo1_mouse | wt pancreatic beta cells sex male age 6 8 month old fac sorted vs dko pancreatic beta cells sex male age 6 8 month old cell specific foxo1 hnf4a double knockout fac sorted |
| GSE128634,GSE128636_1_v_5_foxo1_human | rnaseq control 24h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 16h (replicate huvecs time primary pooled donors |
| GSE90754_0_v_1_foxo1_mouse | wildtype liver control hepatic vs foxo1 liver hepatic knockout |
| GSE128634,GSE128636_2_v_5_foxo1_human | rnaseq control 16h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 16h (replicate huvecs time primary pooled donors |
| GSE128634,GSE128636_2_v_3_foxo1_human | rnaseq control 16h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 24h (replicate huvecs time primary pooled donors |
| GSE128634,GSE128636_4_v_0_foxo1_human | rnaseq control 32h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 32h (replicate huvecs time primary pooled donors |
| GSE255410,GSE255416_1_v_0_foxo1_human | cd19 aavs1 donor primary human cells foxo1 wt vs cd19 foxo1ko donor primary human cells foxo1 ko |
| GSE128634,GSE128636_1_v_3_foxo1_human | rnaseq control 24h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 24h (replicate huvecs time primary pooled donors |
| GSE128634,GSE128636_1_v_0_foxo1_human | rnaseq control 24h (replicate huvecs time primary pooled donors vs rnaseq foxo1a3 overexpression 32h (replicate huvecs time primary pooled donors |
| GSE175787_4_v_2_rhoc_human | mcf10a wild type replicate cell line vs sum190 crispr rhoc ko replicate cell line |
| GSE175787_8_v_6_rhoc_human | mcf7 wild type replicate cell line vs mda231 crispr rhoc ko replicate cell line |
| GSE175787_13_v_2_rhoc_human | mda231 wild type replicate cell line vs sum190 crispr rhoc ko replicate cell line |
| GSE175787_4_v_0_rhoc_human | mcf10a wild type replicate cell line vs mcf7 crispr rhoc ko replicate cell line |
| GSE175787_4_v_7_rhoc_human | mcf10a wild type replicate cell line vs vari068 crispr rhoc ko replicate cell line |
| GSE175787_5_v_9_rhoc_human | vari068 wild type replicate cell line vs mcf10a crispr rhoc ko replicate cell line |
| GSE175787_8_v_10_rhoc_human | mcf7 wild type replicate cell line vs sum149 crispr rhoc ko replicate cell line |
| GSE175787_5_v_0_rhoc_human | vari068 wild type replicate cell line vs mcf7 crispr rhoc ko replicate cell line |
| GSE175787_11_v_2_rhoc_human | sum149 wild type replicate cell line vs sum190 crispr rhoc ko replicate cell line |
| GSE175787_11_v_9_rhoc_human | sum149 wild type replicate cell line vs mcf10a crispr rhoc ko replicate cell line |
| GSE175787_13_v_9_rhoc_human | mda231 wild type replicate cell line vs mcf10a crispr rhoc ko replicate cell line |
| GSE175787_13_v_0_rhoc_human | mda231 wild type replicate cell line vs mcf7 crispr rhoc ko replicate cell line |
| GSE175787_5_v_6_rhoc_human | vari068 wild type replicate cell line vs mda231 crispr rhoc ko replicate cell line |
| GSE175787_8_v_7_rhoc_human | mcf7 wild type replicate cell line vs vari068 crispr rhoc ko replicate cell line |
| GSE175787_4_v_10_rhoc_human | mcf10a wild type replicate cell line vs sum149 crispr rhoc ko replicate cell line |
| GSE175787_8_v_2_rhoc_human | mcf7 wild type replicate cell line vs sum190 crispr rhoc ko replicate cell line |
| GSE175787_5_v_7_rhoc_human | vari068 wild type replicate cell line vs vari068 crispr rhoc ko replicate cell line |
| GSE175787_8_v_0_rhoc_human | mcf7 wild type replicate cell line vs mcf7 crispr rhoc ko replicate cell line |
| GSE175787_11_v_0_rhoc_human | sum149 wild type replicate cell line vs mcf7 crispr rhoc ko replicate cell line |
| GSE175787_11_v_10_rhoc_human | sum149 wild type replicate cell line vs sum149 crispr rhoc ko replicate cell line |
| GSE175787_13_v_7_rhoc_human | mda231 wild type replicate cell line vs vari068 crispr rhoc ko replicate cell line |
| GSE175787_8_v_9_rhoc_human | mcf7 wild type replicate cell line vs mcf10a crispr rhoc ko replicate cell line |
| GSE175787_4_v_6_rhoc_human | mcf10a wild type replicate cell line vs mda231 crispr rhoc ko replicate cell line |
| GSE175787_13_v_6_rhoc_human | mda231 wild type replicate cell line vs mda231 crispr rhoc ko replicate cell line |
| GSE175787_11_v_6_rhoc_human | sum149 wild type replicate cell line vs mda231 crispr rhoc ko replicate cell line |
| GSE175787_13_v_10_rhoc_human | mda231 wild type replicate cell line vs sum149 crispr rhoc ko replicate cell line |
| GSE175787_5_v_2_rhoc_human | vari068 wild type replicate cell line vs sum190 crispr rhoc ko replicate cell line |
| GSE175787_11_v_7_rhoc_human | sum149 wild type replicate cell line vs vari068 crispr rhoc ko replicate cell line |
| GSE175787_5_v_10_rhoc_human | vari068 wild type replicate cell line vs sum149 crispr rhoc ko replicate cell line |
| GSE225900_1_v_0_hsdl2_human | rbe cells sh#nc human bile duct cell line cholangiocarcinoma wt routine culture vs rbe cells sh#hsdl2 human bile duct cell line cholangiocarcinoma knockdown routine culture |
| GSE256181_1_v_3_etv2_human | df control cell line nhdf ad dermal fibroblast wt none vs df etv2 sox17 cell line nhdf ad dermal fibroblast overexpression ec transdifferentiation |
| GSE256181_2_v_0_etv2_human | huvec control cell line endothelial wt none vs df etv2 cell line nhdf ad dermal fibroblast overexpression ec transdifferentiation |
| GSE256181_1_v_0_etv2_human | df control cell line nhdf ad dermal fibroblast wt none vs df etv2 cell line nhdf ad dermal fibroblast overexpression ec transdifferentiation |
| GSE256181_2_v_3_etv2_human | huvec control cell line endothelial wt none vs df etv2 sox17 cell line nhdf ad dermal fibroblast overexpression ec transdifferentiation |
| GSE181589_2_v_0_spred1_mouse | lsk spred1 wt cml mice leukemic stem cells (lsk) lin sca 1+c kit+ strain background c57bl/6 /variation vs lsk ec spred1 ko cml mice leukemic stem cells (lsk) lin sca 1+c kit+ strain background c57bl/6 /variation |
| GSE181589_1_v_0_spred1_mouse | lsk hsc spred1 wt cml mice leukemic stem cells (lsk) lin sca 1+c kit+ strain background c57bl/6 /variation vs lsk ec spred1 ko cml mice leukemic stem cells (lsk) lin sca 1+c kit+ strain background c57bl/6 /variation |
| GSE200320_1_v_0_mfge8_mouse | cd36 wt strain c57b6 intestine vs mfge8 null strain c57b6 enterocytes ko |
| GSE200320_3_v_0_mfge8_mouse | mfge8 wt strain c57b6 enterocytes vs mfge8 null strain c57b6 enterocytes ko |
| GSE200320_3_v_2_mfge8_mouse | mfge8 wt strain c57b6 enterocytes vs cd36 null strain c57b6 intestine ko |
| GSE242167_1_v_2_cd40_mouse | wt spleen strain c57bl/6 cd4+ cells î±cd40l antibody vs ko spleen strain c57bl/6 cd4+ cells cre isotype antibody |
| GSE196535_1_v_0_gpr151_mouse | wt strain c57bl/6 gpr151 diet high fat age 4 weeks liver vs ko strain c57bl/6 gpr151 diet high fat age 4 weeks liver |
| GSE198971_0_v_2_ncor2_mouse | mike disease state induced eae wt strain c57bl/6 sex male age p90 astrocytes condition sgncor2 vs disease state eae background strain c57bl/6 astrocytes xbp1 ko |
| GSE201668_0_v_1_ncor2_human | t265 cell shcontrol line schwann wt vs t265 cell shncor2 line schwann ncor2 knockdown |
| GSE246660_1_v_0_lmo3_human | yuuki condition panc 10.05 ctrl cell line control pancreatic cancer vs yuuki condition panc 10.05 lmo3 overexpression cell line plmo3 transgene pancreatic cancer |
| GSE217570_1_v_0_otud1_human | t24 cells sgnc bladder cancer cell line empty vector negative control vs t24 cells sgotud1 bladder cancer cell line otud1 knockout |
| GSE232786_1_v_0_otud1_human | skov3 cells sgnc cell line ovarian cancer empty vector negative control n/ vs skov3 cells sgotud1 cell line ovarian cancer otud1 knockout n/ |
| GSE142154_0_v_1_otud1_mouse | wt strain c57bl/6 age 18 weeks wild type colon vs ko strain c57bl/6 age 18 weeks otud1 / colon |
| GSE207914_1_v_6_nudt7_mouse | nudt7 / knockout male control diet liver strain c57bl/6j crispr/cas9 sex vs nudt7 / knockout male western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_5_v_6_nudt7_mouse | wildtype female western diet liver strain c57bl/6j wt sex vs nudt7 / knockout male western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_3_v_6_nudt7_mouse | nudt7 / knockout female control diet liver strain c57bl/6j crispr/cas9 sex vs nudt7 / knockout male western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_2_v_6_nudt7_mouse | wildtype male control diet liver strain c57bl/6j wt sex vs nudt7 / knockout male western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_1_v_7_nudt7_mouse | nudt7 / knockout male control diet liver strain c57bl/6j crispr/cas9 sex vs nudt7 / knockout female western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_4_v_7_nudt7_mouse | wildtype male western diet liver strain c57bl/6j wt sex vs nudt7 / knockout female western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_0_v_6_nudt7_mouse | wildtype female control diet liver strain c57bl/6j wt sex vs nudt7 / knockout male western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_2_v_7_nudt7_mouse | wildtype male control diet liver strain c57bl/6j wt sex vs nudt7 / knockout female western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE207914_0_v_7_nudt7_mouse | wildtype female control diet liver strain c57bl/6j wt sex vs nudt7 / knockout female western diet liver strain c57bl/6j crispr/cas9 sex |
| GSE202587_1_v_0_xrn1_mouse | cas9 cell line b16/f10 murine melanoma tumor gene manipulation control inoculation cells inoculated c57bl/6 mice vs ko9 cell line b16/f10 murine melanoma tumor gene manipulation xrn1 depletion ko inoculation cells inoculated c57bl/6 mice mock |
| GSE202587_1_v_2_xrn1_mouse | cas9 cell line b16/f10 murine melanoma tumor gene manipulation control inoculation cells inoculated c57bl/6 mice vs ko9 p g cell line b16/f10 murine melanoma tumor gene manipulation xrn1 depletion ko inoculation cells inoculated c57bl/6 mice gvax plus pd 1 antibody |
| GSE186287_2_v_0_ufm1_human | wt mock rep crispr ko wild type control 293t cells vs ufm1 ko senv rep crispr 293t cells |
| GSE186287_1_v_0_ufm1_human | wt senv rep crispr ko wild type control 293t cells vs ufm1 ko senv rep crispr 293t cells |
| GSE186287_1_v_3_ufm1_human | wt senv rep crispr ko wild type control 293t cells vs ufm1 ko mock rep crispr 293t cells |
| GSE186287_2_v_3_ufm1_human | wt mock rep crispr ko wild type control 293t cells vs ufm1 ko mock rep crispr 293t cells |
| GSE131680_1_v_0_macroh2a1_human | huh 7 ctl cell line immortalized hepatocellular carcinoma source liver 57 years old japanese male /variation control rin vs huh 7 macroh2a1 knock (kd) cell line immortalized hepatocellular carcinoma source liver 57 years old japanese male /variation knockdown rin |
| GSE138815,GSE138817_3_v_1_kdm6a_mouse | day 0 con strain 11004 mouse embryonic fibroblasts (mefs) /variation control time 2 days post infection mefs day0 vs day 3 oe strain 11004 mouse embryonic fibroblasts (mefs) /variation kdm6a overexpression time 5 days post infection mefs day3 |
| GSE138815,GSE138817_0_v_2_kdm6a_mouse | day 3 con strain 11004 mouse embryonic fibroblasts (mefs) /variation control time 5 days post infection mefs day3 vs day 0 oe strain 11004 mouse embryonic fibroblasts (mefs) /variation kdm6a overexpression time 2 days post infection mefs day0 |
| GSE138815,GSE138817_0_v_1_kdm6a_mouse | day 3 con strain 11004 mouse embryonic fibroblasts (mefs) /variation control time 5 days post infection mefs day3 vs day 3 oe strain 11004 mouse embryonic fibroblasts (mefs) /variation kdm6a overexpression time 5 days post infection mefs day3 |
| GSE223609,GSE223610_0_v_1_kdm6a_human | u937 cells shcontrol rna seq replicate blood cell line adult acute monocytic leukemia scrambled shrna control none vs u937 cells shkdm6a rna seq replicate blood cell line adult acute monocytic leukemia kdm6a knockdown none |
| GSE138815,GSE138817_3_v_2_kdm6a_mouse | day 0 con strain 11004 mouse embryonic fibroblasts (mefs) /variation control time 2 days post infection mefs day0 vs day 0 oe strain 11004 mouse embryonic fibroblasts (mefs) /variation kdm6a overexpression time 2 days post infection mefs day0 |
| GSE223609,GSE223610_0_v_2_kdm6a_human | u937 cells shcontrol rna seq replicate blood cell line adult acute monocytic leukemia scrambled shrna control none vs u937 cells shkdm6a+6b rna seq replicate blood cell line adult acute monocytic leukemia kdm6a kdm6b knockdown none |
| GSE136769_2_v_1_csmd1_mouse | testis spermatocyte strain c57bl/6 wt vs whole testis strain c57bl/6 csmd1 ko |
| GSE114685_1_v_0_grin2b_human | control grin2b mutation cell line origin gm07492 number passages lysed 5 ipsc dervied cortical neurons vs lof grin2b mutation frame deletion glutamate binding domain cell line origin gm07492 number passages lysed 5 ipsc dervied cortical neurons |
| GSE115363_3_v_5_esrrb_mouse | ns dmso (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown non targeting shrna vs shesrrb dex (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown |
| GSE115363_2_v_4_esrrb_mouse | shesrrb dmso (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown vs shnr3c1 dex (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown |
| GSE184133,GSE184137_2_v_9_esrrb_mouse | wt replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived 2il withdrawal hours vs ko3 24h replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal 24 hours |
| GSE184133,GSE184137_2_v_5_esrrb_mouse | wt replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived 2il withdrawal hours vs ko1 replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal hours |
| GSE184133,GSE184137_1_v_0_esrrb_mouse | ko1 2il replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko untreated (2il) vs ko2 replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal hours |
| GSE184133,GSE184137_1_v_9_esrrb_mouse | ko1 2il replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko untreated (2il) vs ko3 24h replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal 24 hours |
| GSE115363_2_v_0_esrrb_mouse | shesrrb dmso (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown vs ns dex (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown non targeting shrna |
| GSE184133,GSE184137_2_v_0_esrrb_mouse | wt replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived 2il withdrawal hours vs ko2 replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal hours |
| GSE184133,GSE184137_1_v_4_esrrb_mouse | ko1 2il replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko untreated (2il) vs ko3 replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal hours |
| GSE115363_1_v_5_esrrb_mouse | shnr3c1 dmso (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown vs shesrrb dex (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown |
| GSE115363_2_v_5_esrrb_mouse | shesrrb dmso (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown vs shesrrb dex (rna seq) background strain fvbn tal1/lmo2 thymic tumor cell line rnai knockdown |
| GSE184133,GSE184137_1_v_5_esrrb_mouse | ko1 2il replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko untreated (2il) vs ko1 replicate (rna seq) cell line e14 mouse embryonic stem cells blastocyst derived esrrb ko 2il withdrawal hours |
| GSE184137,GSE217802_1_v_0_esrrb_mouse | e14 iempty 48 cell line mouse embryonic stem cells wt hours differentiation time 48h vs ko iesrrb 48 cell line e14 mouse embryonic stem cells conditional hours differentiation time 48h |
| GSE247775_1_v_0_tmprss2_mouse | mccd control âx80x93 rep cell line mccdcl1 spontaneously transformed mouse ccd primary cultures wt none vs mccd tmprss2 ko rep cell line mccdcl1 spontaneously transformed mouse ccd primary cultures / crispr |
| GSE186810,GSE186813_7_v_5_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_2_v_0_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps background c57bl/6 age 8 weeks furin ko sex anti cd3 cd28 stimulation cd8+ cells |
| GSE186810,GSE186813_7_v_0_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps background c57bl/6 age 8 weeks furin ko sex anti cd3 cd28 stimulation cd8+ cells |
| GSE186810,GSE186813_3_v_5_furin_mouse | 3dps background c57bl/6 age 8 weeks wt sex anti cd3 cd28 stimulation cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_2_v_1_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_7_v_1_furin_mouse | 3dps tgfb1 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_3_v_1_furin_mouse | 3dps background c57bl/6 age 8 weeks wt sex anti cd3 cd28 stimulation cd8+ cells vs 3dps tgfb1 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE186810,GSE186813_2_v_5_furin_mouse | 3dps il12 background c57bl/6 age 8 weeks wt sex female anti cd3 cd28 stimulation + recombinant cd8+ cells vs 3dps il12 background c57bl/6 age 8 weeks furin ko sex female anti cd3 cd28 stimulation + recombinant cd8+ cells |
| GSE220942_2_v_1_galnt7_human | du145 cells oecontrol biol rep prostate cancer cell line lenti orf control vs du145 cells galnt7 oe biol rep prostate cancer cell line overexpression |
| GSE143662_0_v_1_dcp2_human | wild type immortalized 293ts s4u feed vs dcp2 ko immortalized 293ts s4u feed |
| GSE143662_3_v_1_dcp2_human | js1902 wild type immortalized 293ts s4u feed vs dcp2 ko immortalized 293ts s4u feed |
| GSE153258_1_v_0_dcp2_human | strain wild type cp21 s4u feed yes immortalized 293ts vs strain dcp2 ko s4u feed immortalized 293ts |
| GSE153010_1_v_0_sprr2f_mouse | uuo d5 wt (bw strain c57/bl6 time left kidney vs uuo d0 ko (bw strain c57/bl6 sprr2f time left kidney |
| GSE249098_3_v_0_mthfd1l_human | pc 3 cells sicontrol cell line prostate cancer wt vs pc 3 cells simthfd1l cell line prostate cancer mthfd1l knockdown |
| GSE249098_1_v_0_mthfd1l_human | c4 2 cells sicontrol cell line prostate cancer wt vs pc 3 cells simthfd1l cell line prostate cancer mthfd1l knockdown |
| GSE249098_1_v_2_mthfd1l_human | c4 2 cells sicontrol cell line prostate cancer wt vs c4 2 cells simthfd1l cell line prostate cancer mthfd1l knockdown |
| GSE249098_3_v_2_mthfd1l_human | pc 3 cells sicontrol cell line prostate cancer wt vs c4 2 cells simthfd1l cell line prostate cancer mthfd1l knockdown |
| GSE146949_1_v_0_hemgn_mouse | cd45.2+lin sca 1+ cells isolated primary recipients 6h transplantation donor cell source bone marrow (bm) wt mice received bm vs 289 cd45.2+lin sca 1+ cells isolated primary recipients 6h transplantation donor cell source bone marrow (bm) hemgn / mice ko received bm |
| GSE212010_1_v_0_ermap_mouse | raw01 raw264.7 cell line celll wt vs ermap shrna01 raw264.7 shrna cell line celll knockdown |
| GSE209911_0_v_1_ncstn_human | skin cell line hacat keratinocytes wt vs skin cell line hacat keratinocytes ncstn knockdown |
| GSE160077,GSE160084_3_v_0_bin1_mouse | tibialis anterior wt pbs 7w strain c57bl/6n sex male age muscles vs tibialis anterior ko pbs 7w strain c57bl/6n bin1mck / sex male age muscles |
| GSE160077,GSE160084_2_v_0_bin1_mouse | tibialis anterior wt aso 7w strain c57bl/6n sex male age muscles vs tibialis anterior ko pbs 7w strain c57bl/6n bin1mck / sex male age muscles |
| GSE130864_0_v_1_tincr_mouse | kidney wildtype replicate (alc1 wt whole vs kidney knockout replicate (alc1 ko b actincreert2+tfap2bfl/fl mice whole |
| GSE155567_2_v_0_cd33_human | cd33ko shctrl cd33 knockout cell line thp1 monocytes shrna control plasmid macrophages vs cd33ko shptpn6 cd33 knockout cell line thp1 monocytes knockdown ptpn6 using shrna macrophages |
| GSE155567_3_v_0_cd33_human | wt shptpn6 wild type cell line thp1 monocytes knockdown ptpn6 using shrna macrophages vs cd33ko shptpn6 cd33 knockout cell line thp1 monocytes knockdown ptpn6 using shrna macrophages |
| GSE155567_1_v_0_cd33_human | wt shctrl wild type cell line thp1 monocytes shrna control plasmid macrophages vs cd33ko shptpn6 cd33 knockout cell line thp1 monocytes knockdown ptpn6 using shrna macrophages |
| GSE187005_5_v_2_atf4_mouse | tac heart overexpression control vs sham heart overexpression atf4 |
| GSE76771_1_v_3_atf4_mouse | wild type 6 hr 0.3% dmso l004 r1 001] strain c57bl/6 liver mouse vs lsatf4 ko 6 hr 1 mg/kg tunicamycin l004 r1 001] strain c57bl/6 liver / mouse |
| GSE187005_5_v_4_atf4_mouse | tac heart overexpression control vs tac heart overexpression atf4 |
| GSE173578_3_v_0_atf4_mouse | atf4fl fl rf 6h wt group refed liver age 8 weeks vs lko rf 6h atf4 knockout group refed liver age 8 weeks |
| GSE173578_1_v_0_atf4_mouse | atf4fl fl fast wt group liver age 8 weeks vs lko rf 6h atf4 knockout group refed liver age 8 weeks |
| GSE76771_2_v_3_atf4_mouse | lsatf4 ko 6 hr 0.3% dmso l005 r1 001] strain c57bl/6 liver / mouse vs lsatf4 ko 6 hr 1 mg/kg tunicamycin l004 r1 001] strain c57bl/6 liver / mouse |
| GSE187005_3_v_4_atf4_mouse | sham heart overexpression control vs tac heart overexpression atf4 |
| GSE149000_2_v_0_cyp3a5_human | rsem ct 1 cell line aspc pancreatic cancer disease pancreas /variation control vs rsem sicyp3a5 1 cell line aspc pancreatic cancer disease pancreas /variation cyp3a5 knockdown |
| GSE211286_1_v_6_tcf12_mouse | tcf12 wt ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv time day 14.5 vs tcf12 cko ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv conditional knockout time day 14.5 |
| GSE211286_4_v_3_tcf12_mouse | tcf12 wt 2 cell rep strain c57bl/6 embryos developmental stage mouse time day 23 26 vs tcf12 cko fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv conditional knockout time day 23 26 |
| GSE211286_4_v_6_tcf12_mouse | tcf12 wt 2 cell rep strain c57bl/6 embryos developmental stage mouse time day 23 26 vs tcf12 cko ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv conditional knockout time day 14.5 |
| GSE211286_1_v_3_tcf12_mouse | tcf12 wt ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv time day 14.5 vs tcf12 cko fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv conditional knockout time day 23 26 |
| GSE211286_7_v_3_tcf12_mouse | tcf12 wt fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv time day 23 26 vs tcf12 cko fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv conditional knockout time day 23 26 |
| GSE211286_4_v_5_tcf12_mouse | tcf12 wt 2 cell rep strain c57bl/6 embryos developmental stage mouse time day 23 26 vs tcf12 cko 4 cell rep strain c57bl/6 embryos developmental stage mouse conditional knockout time day 23 26 |
| GSE211286_7_v_6_tcf12_mouse | tcf12 wt fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv time day 23 26 vs tcf12 cko ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv conditional knockout time day 14.5 |
| GSE211286_7_v_5_tcf12_mouse | tcf12 wt fgv rep strain c57bl/6 oocytes developmental stage mouse fully grown gv time day 23 26 vs tcf12 cko 4 cell rep strain c57bl/6 embryos developmental stage mouse conditional knockout time day 23 26 |
| GSE211286_1_v_5_tcf12_mouse | tcf12 wt ggv rep strain c57bl/6 oocytes developmental stage mouse growing gv time day 14.5 vs tcf12 cko 4 cell rep strain c57bl/6 embryos developmental stage mouse conditional knockout time day 23 26 |
| GSE200446_0_v_3_srsf2_mouse | wt (mx1 cre lin c kit+ (lk) cells strain c57bl/6 mouse lk hematopoeitic progenitors vs double (srsf2p95h/+ runx / mx1 cre lin c kit+ (lk) cells strain c57bl/6 mouse lk p95h srsf2 runx1 ko hematopoeitic progenitors |
| GSE200446_1_v_2_srsf2_mouse | runx1 ko (runx1 / mx1 cre lin c kit+ (lk) cells strain c57bl/6 mouse lk wt srsf2 hematopoeitic progenitors vs p95 (srsf2p95h/+ mx1 cre lin c kit+ (lk) cells strain c57bl/6 mouse lk p95h srsf2 hematopoeitic progenitors |
| GSE107581_0_v_1_cd27_human | vec cell line u251 comparative vector control lentivirus passage 5 10 glioblastoma vs cd274 cell line u251 stable transfected pd l1 overexpression vector lentivirus passage 5 10 glioblastoma |
| GSE98579_0_v_1_tfam_mouse | e13.5 tfam ctrl strain c57bl/6 primary age /variation control heart vs e13.5 tfam ko strain c57bl/6 primary age /variation heart |
| GSE162384_1_v_0_tfam_human | a549 cells ctrl cell line (control plasmid) lines vs a549 cells tfam oe cell line overexpression lines |
| GSE184356_3_v_2_tfam_human | control stimulated tgfî² primary dermal fibroblast tgfbeta rna isolation knockdown target non sirna donor fibroblasts vs tfam knockdown stimulated tgfî² primary dermal fibroblast tgfbeta rna isolation target sirna donor fibroblasts |
| GSE249893_1_v_0_tfam_mouse | wt b cells stimulated lymphocytes anti igm+anti cd40 vs ko b cells stimulated lymphocytes tfam anti igm+anti cd40 |
| GSE184356_1_v_2_tfam_human | control primary dermal fibroblast pbs rna isolation knockdown target non sirna donor fibroblasts vs tfam knockdown stimulated tgfî² primary dermal fibroblast tgfbeta rna isolation target sirna donor fibroblasts |
| GSE184356_1_v_0_tfam_human | control primary dermal fibroblast pbs rna isolation knockdown target non sirna donor fibroblasts vs tfam knockdown primary dermal fibroblast pbs rna isolation target sirna donor fibroblasts |
| GSE184356_3_v_0_tfam_human | control stimulated tgfî² primary dermal fibroblast tgfbeta rna isolation knockdown target non sirna donor fibroblasts vs tfam knockdown primary dermal fibroblast pbs rna isolation target sirna donor fibroblasts |
| GSE180575_1_v_0_fmo5_mouse | wt liver strain background c57bl/6 wild type vs fmo5( / ) ko liver strain background c57bl/6 |
| GSE234340_10_v_2_muc2_mouse | wt control organoids 10 nm il17a 12 hours (il17a 12h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_9_v_2_muc2_mouse | wt control organoids 12 hours (control 12h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_9_v_7_muc2_mouse | wt control organoids 12 hours (control 12h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_1_v_2_muc2_mouse | wt control organoids 10 nm il1a+il1b 12 hours (il1î±+il1î² 12h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_1_v_7_muc2_mouse | wt control organoids 10 nm il1a+il1b 12 hours (il1î±+il1î² 12h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_10_v_7_muc2_mouse | wt control organoids 10 nm il17a 12 hours (il17a 12h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_12_v_7_muc2_mouse | wt control organoids 10 nm il1a+il1b 72 hours (il1î±+il1î² 72h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_4_v_7_muc2_mouse | wt control organoids 10 nm il17a 72 hours (il17a 72h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_12_v_2_muc2_mouse | wt control organoids 10 nm il1a+il1b 72 hours (il1î±+il1î² 72h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_3_v_2_muc2_mouse | wt control organoids 72 hours (control 72h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_3_v_7_muc2_mouse | wt control organoids 72 hours (control 72h intestinal epithelium colonic time intestine vs gli1creert2 alk3 loxp mice muc2 mcherry cells colon (ga3m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE234340_4_v_2_muc2_mouse | wt control organoids 10 nm il17a 72 hours (il17a 72h intestinal epithelium colonic time intestine vs gli1creert2 smad4 loxp mice muc2 mcherry cells colon (gs4m2 intestinal epithelium positive knockout gli1+ tamoxifen subcutaneous injection time day 30 intestine |
| GSE226793_1_v_0_ccr5_mouse | osteoclast precursor wt bone marrow csf 2 days rankl (differentiated) precursors (pocs) vs osteoclast precursor ccr5 ko bone marrow csf 2 days rankl (differentiated) precursors (pocs) |
| GSE210101,GSE210114_2_v_9_urod_human | h446 cells non targeting grna clone 10 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_11_v_3_urod_human | h446 cells neurod1 grna #297 clone 12 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_4_v_3_urod_human | h446 cells non targeting grna clone 3 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_0_v_9_urod_human | h446 cells neurod1 grna #297 clone 15 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_5_v_9_urod_human | h446 cells non targeting grna clone 3 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_7_v_9_urod_human | h446 cells neurod1 grna #297 clone 2 1 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_8_v_3_urod_human | h446 cells non targeting grna clone 13 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_11_v_9_urod_human | h446 cells neurod1 grna #297 clone 12 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_8_v_9_urod_human | h446 cells non targeting grna clone 13 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_6_v_9_urod_human | h446 cells non targeting grna clone 10 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE122990,GSE123061_0_v_1_urod_mouse | /strain neurod1 floxed/floxed c56bl/j age 12 week isolated pancreatic islets control vs nd /strain neurod1 floxed/floxed rip cre+ c56bl/j age 12 week isolated pancreatic islets beta cell specific ko |
| GSE210101,GSE210114_2_v_3_urod_human | h446 cells non targeting grna clone 10 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_11_v_10_urod_human | h446 cells neurod1 grna #297 clone 12 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_5_v_3_urod_human | h446 cells non targeting grna clone 3 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_1_v_9_urod_human | h446 cells non targeting grna clone 13 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_4_v_9_urod_human | h446 cells non targeting grna clone 3 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 2 1 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_8_v_10_urod_human | h446 cells non targeting grna clone 13 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_0_v_3_urod_human | h446 cells neurod1 grna #297 clone 15 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_7_v_10_urod_human | h446 cells neurod1 grna #297 clone 2 1 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_5_v_10_urod_human | h446 cells non targeting grna clone 3 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_1_v_10_urod_human | h446 cells non targeting grna clone 13 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_7_v_3_urod_human | h446 cells neurod1 grna #297 clone 2 1 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_2_v_10_urod_human | h446 cells non targeting grna clone 10 jq1 biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_6_v_3_urod_human | h446 cells non targeting grna clone 10 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_4_v_10_urod_human | h446 cells non targeting grna clone 3 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_1_v_3_urod_human | h446 cells non targeting grna clone 13 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 12 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_0_v_10_urod_human | h446 cells neurod1 grna #297 clone 15 dmso biol rep cell line small lung cancer sclc n subtype knockout time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE210101,GSE210114_6_v_10_urod_human | h446 cells non targeting grna clone 10 dmso biol rep cell line small lung cancer sclc n subtype wt time 24 hours vs h446 cells neurod1 grna #297 clone 15 jq1 biol rep cell line small lung cancer sclc n subtype knockout time 24 hours |
| GSE139120_1_v_0_urod_mouse | lewis lung carcinoma cells scrambled urod wildtype mouse cancer vs lewis lung carcinoma cells urod kd knockdown mouse cancer |
| GSE119701_0_v_1_phf7_mouse | wt rs strain background c57bl/6 /variation wild type week old 8 wk / round spermatids female vs ko rs strain background c57bl/6 /variation phf7 knockout week old 8 wk / round spermatids female |
| GSE218171_1_v_0_foxn3_human | h1299 cells sicontrol cell line epithelial like derived non small lung cancer wt transfect using rnaimax vs h1299 cells sifoxn3 cell line epithelial like derived non small lung cancer foxn3 knockdown transfect using rnaimax |
| GSE199606_2_v_0_csf2_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_6_v_4_csf2_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_3_v_0_csf2_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_6_v_7_csf2_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_3_v_7_csf2_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_3_v_4_csf2_mouse | wt 0h lung sex female strain c57bl/6n untreated time (h) 0 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_1_v_4_csf2_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_5_v_7_csf2_mouse | wt 72h lung sex female strain c57bl/6n treated ricin time (h) 72 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_1_v_0_csf2_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_5_v_4_csf2_mouse | wt 72h lung sex female strain c57bl/6n treated ricin time (h) 72 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE199606_6_v_0_csf2_mouse | wt 4h lung sex female strain c57bl/6n treated ricin time (h) 4 wild type cells vs ko 72h lung sex female strain c57bl/6n treated ricin time (h) 72 csf2ra / cells |
| GSE199606_1_v_7_csf2_mouse | ko 0h lung sex female strain c57bl/6n untreated time (h) 0 csf2ra / cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_2_v_7_csf2_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 4h lung sex female strain c57bl/6n treated ricin time (h) 4 csf2ra / cells |
| GSE199606_2_v_4_csf2_mouse | wt 12h lung sex female strain c57bl/6n treated ricin time (h) 12 wild type cells vs ko 12h lung sex female strain c57bl/6n treated ricin time (h) 12 csf2ra / cells |
| GSE227137,GSE227139_2_v_3_themis2_mouse | na㯠wt spleen natural killer cells cell subset naive nk creert2 ly49h status ly49h+ infection day 0 vs memory ko spleen natural killer cells cell subset themis2 nk creert2 ly49h status ly49h+ infection day 28 post mcmv |
| GSE227137,GSE227139_0_v_1_themis2_mouse | memory wt spleen natural killer cells cell subset nk creert2 ly49h status ly49h+ infection day 28 post mcmv vs na㯠ko spleen natural killer cells cell subset naive themis2 nk creert2 ly49h status ly49h+ infection day 0 |
| GSE212299_3_v_1_abi3_mouse | brown adipose abi3 wt rep sub scapular depot sex male vs brown adipose abi3 ko rep sub scapular depot sex male |
| GSE212299_3_v_0_abi3_mouse | brown adipose abi3 wt rep sub scapular depot sex male vs hypothalamus abi3 ko rep sex male |
| GSE212299_2_v_1_abi3_mouse | hypothalamus abi3 wt rep sex male vs brown adipose abi3 ko rep sub scapular depot sex male |
| GSE146253_0_v_2_stat4_mouse | cd4+ cells wt th1 strain c57bl/6 spleen wild type vs cd4+ cells ko th0 strain c57bl/6 spleen stat4 / |
| GSE146253_0_v_5_stat4_mouse | cd4+ cells wt th1 strain c57bl/6 spleen wild type vs cd4+ cells ko th1 strain c57bl/6 spleen stat4 / |
| GSE210373_0_v_1_cntnap4_human | vector control cell line 143b osteosarcoma cells transfected plasmid 48 h vs cntnap4 ko cell line 143b osteosarcoma cells transfected plasmid 48 h |
| GSE113329,GSE113335_3_v_4_taf6l_mouse | j1 ( taf kos) cell line /variation wildtype embryonic stem vs taf6l ko cell line j1 /variation embryonic stem |
| GSE113329,GSE113335_2_v_4_taf6l_mouse | j1 ( myc ko) cell line embryonic stem /variation wild type control escs vs taf6l ko cell line j1 /variation embryonic stem |
| GSE192771_2_v_1_mt1g_human | huh7 cell lines dmso line cells liver cancer vs huh7 cell lines mt1g oe line cells liver overexpression cancer |
| GSE100102_2_v_5_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 14 mefs d42 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 14 mefs d42 |
| GSE100102_0_v_5_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 12 mefs d36 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 14 mefs d42 |
| GSE100102_4_v_5_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 11 mefs d33 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 14 mefs d42 |
| GSE100102_0_v_3_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 12 mefs d36 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 12 mefs d36 |
| GSE100102_4_v_6_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 11 mefs d33 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 11 mefs d33 |
| GSE220693_1_v_0_cgas_mouse | cgas ko neutrophils untreated strain c57b/l6 neutrophil knockout media control time 2 hours vs cgas ko neutrophils lps 2 hours strain c57b/l6 neutrophil knockout time |
| GSE100102_4_v_3_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 11 mefs d33 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 12 mefs d36 |
| GSE100102_0_v_6_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 12 mefs d36 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 11 mefs d33 |
| GSE100102_2_v_6_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 14 mefs d42 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 11 mefs d33 |
| GSE100102_2_v_3_cgas_mouse | wt strain c57b1/6 primary mouse embryonic fibroblast passages 14 mefs d42 vs cgas strain c57b1/6 ko primary mouse embryonic fibroblast passages 12 mefs d36 |
| GSE198794_0_v_3_usp18_human | control differentation repl. 7304.1 skeletal muscle cell line untreated vs usp18 knockdown proliferation repl. 7304.1 skeletal muscle cell line (sirna) |
| GSE198794_2_v_3_usp18_human | control proliferation repl. 7304.1 skeletal muscle cell line untreated vs usp18 knockdown proliferation repl. 7304.1 skeletal muscle cell line (sirna) |
| GSE198794_2_v_1_usp18_human | control proliferation repl. 7304.1 skeletal muscle cell line untreated vs usp18 knockdown differentiation repl. 7304.1 skeletal muscle cell line (sirna) |
| GSE198794_0_v_1_usp18_human | control differentation repl. 7304.1 skeletal muscle cell line untreated vs usp18 knockdown differentiation repl. 7304.1 skeletal muscle cell line (sirna) |
| GSE167474_2_v_3_naa40_human | hct116 cells scramble (scr) control replicate cell line colon cancer scr doxycycline culture vs hct116 cells doxycycline treated naa40 knockdown replicate cell line colon cancer culture |
| GSE167474_2_v_0_naa40_human | hct116 cells scramble (scr) control replicate cell line colon cancer scr doxycycline culture vs hct116 cells naa40 knockdown replicate cell line colon cancer doxycycline culture |
| GSE167474_1_v_3_naa40_human | hct116 cells doxycycline treated scramble (scr) control replicate cell line colon cancer scr culture vs hct116 cells doxycycline treated naa40 knockdown replicate cell line colon cancer culture |
| GSE167474_1_v_0_naa40_human | hct116 cells doxycycline treated scramble (scr) control replicate cell line colon cancer scr culture vs hct116 cells naa40 knockdown replicate cell line colon cancer doxycycline culture |
| GSE246716_0_v_1_trappc1_mouse | wt fresh mlns spleens vs trappc1 fresh mlns spleens ko |
| GSE180800,GSE180801_0_v_5_tex10_mouse | cell types pgclcs derived epilcs strain 129sv/j untreated tex10 overexpression clone vs cell types pgclcs derived epilcs strain 129sv/j dtag13 (500 nm) treated day rep |
| GSE217132_0_v_1_pfkfb4_human | mda mb 231 wt biol rep cell line breast cancer cells vs mda mb 231 pfkfb4 ko biol rep cell line breast cancer cells knock |
| GSE217132_0_v_1_pfkfb4_mouse | mda mb 231 wt biol rep cell line breast cancer cells vs mda mb 231 pfkfb4 ko biol rep cell line breast cancer cells knock |
| GSE186647,GSE217288_1_v_4_hnrnpc_human | mda gctrl nuc cell line mb 231 metastatic capacity poorly rna nuclear /variation control breast cancer vs mda ghnrnpc cyto cell line mb 231 metastatic capacity poorly rna cytoplasmic /variation hnrnpc knockdown breast cancer |
| GSE186647,GSE217288_11_v_4_hnrnpc_human | mda lm2 24h dmso cell line mb 231 metastatic capacity highly lungs rna total breast cancer vs mda ghnrnpc cyto cell line mb 231 metastatic capacity poorly rna cytoplasmic /variation hnrnpc knockdown breast cancer |
| GSE180789_1_v_0_hnrnpc_human | mhcc97h shcontrol cell line human highly metastatic hcc control vs mhcc97h shhnrnpc cell line human highly metastatic hcc hnrnpc knockdown specific shrna(hnrnpc shrna) |
| GSE186647,GSE217288_2_v_4_hnrnpc_human | mda lm2 dmso cell line mb 231 metastatic capacity highly lungs rna total breast cancer vs mda ghnrnpc cyto cell line mb 231 metastatic capacity poorly rna cytoplasmic /variation hnrnpc knockdown breast cancer |
| GSE186647,GSE217288_11_v_7_hnrnpc_human | mda lm2 24h dmso cell line mb 231 metastatic capacity highly lungs rna total breast cancer vs mda ghnrnpc nuc cell line mb 231 metastatic capacity poorly rna nuclear /variation hnrnpc knockdown breast cancer |
| GSE186647,GSE217288_1_v_7_hnrnpc_human | mda gctrl nuc cell line mb 231 metastatic capacity poorly rna nuclear /variation control breast cancer vs mda ghnrnpc nuc cell line mb 231 metastatic capacity poorly rna nuclear /variation hnrnpc knockdown breast cancer |
| GSE186647,GSE217288_2_v_7_hnrnpc_human | mda lm2 dmso cell line mb 231 metastatic capacity highly lungs rna total breast cancer vs mda ghnrnpc nuc cell line mb 231 metastatic capacity poorly rna nuclear /variation hnrnpc knockdown breast cancer |
| GSE186647,GSE217287_1_v_3_hnrnpc_human | mda sgctrl (rna seq) cell line mb 231 metastatic capacity poorly /variation control breast cancer vs mda sghnrnpc (rna seq) cell line mb 231 metastatic capacity poorly /variation hnrnpc knockdown breast cancer |
| GSE140965_2_v_4_mybpc3_human | ipsc derived cardiomyocytes control vs ipsc derived cardiomyocytes mybpc3 start site deletion |
| GSE140965_2_v_3_mybpc3_human | ipsc derived cardiomyocytes control vs ipsc derived cardiomyocytes mybpc3 promoter deletion |
| GSE140965_1_v_4_mybpc3_human | ipsc derived cardiomyocytes control (crispr edited negative) vs ipsc derived cardiomyocytes mybpc3 start site deletion |
| GSE146604_1_v_0_ftsj1_human | pc9 oe cell line human adenocarcinoma derived cells control vs pc9 oe ftsj1 cell line human adenocarcinoma derived cells overexpression |
| GSE153757,GSE153758_1_v_2_ftsj1_mouse | 8 wk ctrl brain total trna fragment miseq strain c57bl/6 wt mouse vs 8 wk ko brain total trna miseq strain c57bl/6 ftsj1 mouse |
| GSE153757,GSE153758_0_v_2_ftsj1_mouse | 8 wk ctrl brain ribosome contained trna miseq strain c57bl/6 wt mouse vs 8 wk ko brain total trna miseq strain c57bl/6 ftsj1 mouse |
| GSE153757,GSE153758_1_v_3_ftsj1_mouse | 8 wk ctrl brain total trna fragment miseq strain c57bl/6 wt mouse vs 8 wk ko brain ribosome contained trna miseq strain c57bl/6 ftsj1 mouse |
| GSE153757,GSE153758_0_v_3_ftsj1_mouse | 8 wk ctrl brain ribosome contained trna miseq strain c57bl/6 wt mouse vs 8 wk ko brain ribosome contained trna miseq strain c57bl/6 ftsj1 mouse |
| GSE146840,GSE146842_1_v_2_qrich1_human | tm treated wt cells cell line ht29 lentiviral transduction non targeting guide cas9 expressing vs tm treated qrich1 ko cells cell line ht29 lentiviral transduction targeting guide cas9 expressing |
| GSE146840,GSE146842_0_v_2_qrich1_human | qrich1 ko cells cell line ht29 tm dmso lentiviral transduction targeting guide cas9 expressing vs tm treated qrich1 ko cells cell line ht29 lentiviral transduction targeting guide cas9 expressing |
| GSE146840,GSE146842_3_v_2_qrich1_human | wt cells cell line ht29 tm dmso lentiviral transduction non targeting guide cas9 expressing vs tm treated qrich1 ko cells cell line ht29 lentiviral transduction targeting guide cas9 expressing |
| GSE126504_0_v_1_hpse_human | sw480 nc cells /variation control colorectal cancer cell line vs sw480 45 cells /variation hpse knockdown colorectal cancer cell line |
| GSE127790_11_v_3_zcchc8_mouse | ko icm strain bdf1 inner cell mass blastocyst /variation zcchc8 oocyte wt sperm vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE127790_10_v_3_zcchc8_mouse | wt 4cell strain bdf1 four cell stage embryos /variation wild type vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE127790_11_v_2_zcchc8_mouse | ko icm strain bdf1 inner cell mass blastocyst /variation zcchc8 oocyte wt sperm vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_4_v_2_zcchc8_mouse | 4cell control strain bdf1 four cell stage embryos /variation wild type vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_6_v_2_zcchc8_mouse | ko 4cell strain bdf1 four cell stage embryos /variation zcchc8 oocyte wt sperm vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_13_v_3_zcchc8_mouse | totalrna c strain bdf1 derived esc /variation wild type actinomycin ercc spike added. rna vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE127790_5_v_3_zcchc8_mouse | wt icm strain bdf1 inner cell mass blastocyst /variation wild type vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE127790_5_v_2_zcchc8_mouse | wt icm strain bdf1 inner cell mass blastocyst /variation wild type vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_9_v_2_zcchc8_mouse | blastocyst control strain bdf1 stage embryos /variation wild type vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_4_v_3_zcchc8_mouse | 4cell control strain bdf1 four cell stage embryos /variation wild type vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE165689_0_v_1_zcchc8_mouse | wild type rep salivary gland cell line sims cells vs zcchc8 ko clone rep salivary gland cell line sims cells |
| GSE127790_6_v_3_zcchc8_mouse | ko 4cell strain bdf1 four cell stage embryos /variation zcchc8 oocyte wt sperm vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE127790_13_v_2_zcchc8_mouse | totalrna c strain bdf1 derived esc /variation wild type actinomycin ercc spike added. rna vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_10_v_2_zcchc8_mouse | wt 4cell strain bdf1 four cell stage embryos /variation wild type vs ko gv strain bdf1 oocytes /variation zcchc8 |
| GSE127790_9_v_3_zcchc8_mouse | blastocyst control strain bdf1 stage embryos /variation wild type vs totalrna ko strain bdf1 derived esc /variation zcchc8 actinomycin ercc spike added. rna |
| GSE223241_2_v_3_cdkn2a_human | d0 si ctrl cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors control adipogenic differentiation time day 0 3d sictrl vs d0 si cdkn cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors cdkn2a knockdown adipogenic differentiation time day 0 3d sicdkn2a |
| GSE223241_1_v_3_cdkn2a_human | d10 si ctrl cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors control adipogenic differentiation time day 10 3d sictrl vs d0 si cdkn cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors cdkn2a knockdown adipogenic differentiation time day 0 3d sicdkn2a |
| GSE223241_2_v_0_cdkn2a_human | d0 si ctrl cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors control adipogenic differentiation time day 0 3d sictrl vs d10 si cdkn cell line hipsc bap human induced pluripotent stem cells differentiated brown adipocytes progenitors cdkn2a knockdown adipogenic differentiation time day 10 3d sicdkn2a |
| GSE181821_1_v_3_mov10_mouse | wild type rnaseq stability strain j1 antibody na embryonic stem cell vs mov10 ko rnaseq stability strain j1 antibody na embryonic stem cell |
| GSE87862_0_v_1_mov10_mouse | wt n cell line neuro 2a neuroblastoma /variation wild type passages p5 p6 status vs ko n cell line neuro 2a neuroblastoma /variation crispr cas knockout lines mov10 passages p5 p6 status |
| GSE181821_1_v_4_mov10_mouse | wild type rnaseq stability strain j1 antibody na embryonic stem cell vs mov10 ko rnaseq input riboseq strain j1 antibody na embryonic stem cell |
| GSE203072_2_v_3_rpl3l_mouse | control c2c12 rna seq replicate empty cells vs rpl3l ko heart rna seq replicate |
| GSE159967_3_v_0_arid5a_mouse | wt kpc cells cell line (lsl krasg12d/+ lsl trp53r172h/+ pdx 1 cre) strain mice il 6 stimulation 48 h vs ko kpc cells cell line (lsl krasg12d/+ lsl trp53r172h/+ pdx 1 cre) strain arid5a gene knockout (ko) mice il 6 stimulation 48 h |
| GSE97870,GSE97871_1_v_2_ctcf_mouse | mouse wild type erythroid cells replicate strain c57bl6 phenylhydrazine treated spleen genes analysed genome wide vs mouse erytrhoid cells knockout ctcf binding site hs29 replicate strain c57bl6 phenylhydrazine treated spleen genes analysed genome wide erythroid |
| GSE84175,GSE84176_0_v_1_ctcf_mouse | wt repeat strain c57/bl /variation wild type hippocampus vs cko knockout repeat strain c57/bl /variation ctcf hippocampus |
| GSE185881,GSE185884_2_v_3_ctcf_mouse | wt rnaseq dentritic cells strain c57bl/6 creer none bmdc vs ko rnaseq dentritic cells strain c57bl/6 creer ctcf fl/fl none bmdc |
| GSE97870,GSE97871_1_v_0_ctcf_mouse | mouse wild type erythroid cells replicate strain c57bl6 phenylhydrazine treated spleen genes analysed genome wide vs mouse erytrhoid cells knockout ctcf binding site hs38 hs39 replicate strain c57bl6 phenylhydrazine treated spleen genes analysed genome wide erythroid |
| GSE120781,GSE174528_4_v_1_ctcf_human | ck b cells sem (dsmz) blood /variation wild type vs treat b cells sem (dsmz) blood /variation ctcf deletion |
| GSE179775,GSE198264_0_v_2_ctcf_mouse | rna seq wt wild type splenocytes cd8 cells cell phenotype ctv+gfp+tcrbeta+cd8+ stim rnaseq vs rna seq ctcf ko / splenocytes cd8 cells cell phenotype ctv+gfp+tcrbeta+cd8+ deficient stim rnaseq |
| GSE223908,GSE223909_1_v_3_serpinb3_human | yuuki pancreatic cancer cell line condition panc 10.05 serpinb3 overexpression 1 panc10.05 ctrl vs bxpc cell line 3 serpinb3 pancreatic cancer |
| GSE223908,GSE223909_1_v_6_serpinb3_human | yuuki pancreatic cancer cell line condition panc 10.05 serpinb3 overexpression 1 panc10.05 ctrl vs sb myci 1 cell line aspc myc inhibitor serpinb3 expressing transgene pancreatic cancer |
| GSE223908,GSE223909_1_v_8_serpinb3_human | yuuki pancreatic cancer cell line condition panc 10.05 serpinb3 overexpression 1 panc10.05 ctrl vs yuuki pancreatic cancer cell line condition aspc 1 serpinb3 overexpression sb |
| GSE223908,GSE223909_4_v_8_serpinb3_human | panc10.05 sb dmso cell line panc 10.05 serpinb3 expressing transgene pancreatic cancer vs yuuki pancreatic cancer cell line condition aspc 1 serpinb3 overexpression sb |
| GSE223908,GSE223909_7_v_8_serpinb3_human | bxpc nc cell line 3 control vector pancreatic cancer vs yuuki pancreatic cancer cell line condition aspc 1 serpinb3 overexpression sb |
| GSE129858,GSE129859_1_v_3_robo1_mouse | cell line 4t1 k1 dox inducible shrna targeting id1 id3 sirna non control replicate vs cell line 4t1 k1 dox inducible shrna targeting id1 id3 sirna robo1 knockdown replicate |
| GSE231641_0_v_1_robo1_mouse | shctrl rna seq bone marrow hematopoietic stem progenitor cells wt scramble shrna control vs shrobo1 rna seq bone marrow hematopoietic stem progenitor cells robo1 knockdown |
| GSE163589_1_v_0_rora_human | lp1 vector b lymphoblast tumor type mutiple myeloma cell line lp 1 innfected virus sgrna none targeting (nt control) control vs lp1 sgaurka b lymphoblast tumor type mutiple myeloma cell line lp 1 innfected virus sgrna targeting aurka gene (aurora ko) aurora ko |
| GSE253089_0_v_1_ephb2_human | ephb2 wt skin cell line primary human dermal fibroblast wild type tgf b1 vs ephb2 ko skin cell line primary human dermal fibroblast knock tgf b1 |
| GSE74383_1_v_0_ror2_human | mcf7 ctl cell line er positive breast cancer mcf 7 control empty vector (pcdna) cells vs mcf7 ror2 cell line er positive breast cancer mcf 7 overexpression construct cells |
| GSE161864,GSE161866_1_v_3_ror2_human | mcf7 pror2 cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected hror2 overexpression plasmid (pror2). cells treated control sirna (sictl #sc 37007 santa cruz). mcf 7 vs mcf7 pcdna siwnt11 cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected empty vector (pcdna). cells treated sirna wnt11 (siwnt11 #sc 41120 santa cruz). mcf 7 |
| GSE174506_0_v_1_ror2_mouse | 2225l basal like tp53 null organoid lineage depleted tumor cells shrna shluc model luciferase control vs 2225l basal like tp53 null organoid lineage depleted tumor cells shrna shror2 model ror2 knockdown |
| GSE161864,GSE161866_4_v_3_ror2_human | mcf7 pror2 wt cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected hror2 overexpression plasmid (pror2). mcf 7 cells vs mcf7 pcdna siwnt11 cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected empty vector (pcdna). cells treated sirna wnt11 (siwnt11 #sc 41120 santa cruz). mcf 7 |
| GSE74383_2_v_3_ror2_human | mcf7 wnt5a cell line er positive breast cancer mcf 7 control empty vector (pcdna) stimulation recombinant cells vs mcf7 ror2 wnt5a cell line er positive breast cancer mcf 7 overexpression construct stimulation recombinant cells |
| GSE74383_1_v_3_ror2_human | mcf7 ctl cell line er positive breast cancer mcf 7 control empty vector (pcdna) cells vs mcf7 ror2 wnt5a cell line er positive breast cancer mcf 7 overexpression construct stimulation recombinant cells |
| GSE74383_2_v_0_ror2_human | mcf7 wnt5a cell line er positive breast cancer mcf 7 control empty vector (pcdna) stimulation recombinant cells vs mcf7 ror2 cell line er positive breast cancer mcf 7 overexpression construct cells |
| GSE161864,GSE161866_0_v_2_ror2_human | mcf7 pcdna wt cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected empty vector (pcdna). mcf 7 cells vs mcf7 pror2 siwnt11 cell line (atcc htb 22) mammary gland breast derived metastatic site pleural effusion epithelial transfected hror2 overexpression plasmid (pror2). cells treated sirna wnt11 (siwnt11 #sc 41120 santa cruz). mcf 7 |
| GSE210388_2_v_0_ror2_human | sbc3 control lung cell line sbc 3 small cancer vs sbc3 ror2ko lung cell line sbc 3 small cancer ror2 knockout |
| GSE138818_2_v_0_nanog_mouse | wt 12h [e14 e14tg2a embryonic stem cell vs nanogko [bt12 bt12 embryonic stem cell nanog ko |
| GSE138818_1_v_0_nanog_mouse | wt 24h [e14 e14tg2a embryonic stem cell vs nanogko [bt12 bt12 embryonic stem cell nanog ko |
| GSE107505_0_v_2_nanog_mouse | ts cell female technical replicate line nanog state wildtype sex vs knockout nanog embryo state sex e3.5 |
| GSE107505_1_v_2_nanog_mouse | xen cell male technical replicate line nanog state wildtype sex vs knockout nanog embryo state sex e3.5 |
| GSE138818_1_v_3_nanog_mouse | wt 24h [e14 e14tg2a embryonic stem cell vs nanogko 24h [bt12 bt12 embryonic stem cell nanog ko |
| GSE107505_3_v_2_nanog_mouse | es cell serum free technical replicate line nanog state wildtype sex vs knockout nanog embryo state sex e3.5 |
| GSE121246_1_v_0_stat5b_mouse | wild type replicate background strain c57bl/6n bone marrow bcr/ablp185+ transformed cell lines wt vs stat5b ko replicate background strain c57bl/6n bone marrow bcr/ablp185+ transformed cell lines |
| GSE99112_0_v_1_upf3b_mouse | wt mouse strain c57bl/6 /variation wildtype frontal cortex vs upf3b ko mouse strain c57bl/6 /variation frontal cortex |
| GSE157262,GSE157268_3_v_0_ythdc1_mouse | rna esc wt strain c57bl/6 blastocyst derived es cells embryonic stem vs rna esc w378a strain c57bl/6 blastocyst derived es cells ythdc1 flox/flox creert2 overexpression embryonic stem |
| GSE244940_0_v_1_edf1_mouse | multiciliated ependymal cell wt 6day induction strain background c57bl/6j differentiation vs multiciliated ependymal cell edf1 ko 6day induction strain background c57bl/6j differentiation |
| GSE189756_1_v_2_rbpj_mouse | ikcr tam control one allele p48 creert knock lsl krasd12d (c57bl/6) pancreatic cells (mainly acinar cells) oil treated mouse pancreas (p48 krasg12d rbpjflox/flox) vs ikcr +tam rbpj ko context krasg12d expression acinar cells (c57bl/6) pancreatic (mainly cells) tamoxifen treated mouse pancreas (p48 creert lsl rbpjflox/flox) |
| GSE150215_1_v_2_etl4_mouse | eg1 strain background c57bl/6 wild type cell line androgenetic haploid escs vs odg etl4 ko strain background c57bl/6 cell line androgenetic haploid escs |
| GSE150215_1_v_0_etl4_mouse | eg1 strain background c57bl/6 wild type cell line androgenetic haploid escs vs eg1 etl4 ko strain background c57bl/6 cell line androgenetic haploid escs |
| GSE145171_0_v_1_prox1_human | rd control samp cell line rhabdomyosarcoma knockdown scrambled shrna (control) vs rd shprox1 samp cell line rhabdomyosarcoma knockdown |
| GSE226285_3_v_1_nr0b1_human | a549 shnc cell line non small lung cancer wt knockdown control none vs a549 shnr0b1 cell line non small lung cancer nr0b1 knockdown none |
| GSE226285_3_v_0_nr0b1_human | a549 shnc cell line non small lung cancer wt knockdown control none vs a549 nr0b1 oe cell line non small lung cancer overexpression none |
| GSE226285_2_v_1_nr0b1_human | a549 oec cell line non small lung cancer wt overexpression control none vs a549 shnr0b1 cell line non small lung cancer nr0b1 knockdown none |
| GSE226285_2_v_0_nr0b1_human | a549 oec cell line non small lung cancer wt overexpression control none vs a549 nr0b1 oe cell line non small lung cancer overexpression none |
| GSE89569_3_v_0_nr0b1_human | dmso cancer type nsclc cell line h460 cells vs h460 shnr0b1 cell line cells length knockdown 72hrs target nr0b1 |
| GSE145215_0_v_1_krt13_mouse | control tongue p20 biological rep age vs krt13 ko tongue p20 biological rep age |
| GSE145215_0_v_3_krt13_mouse | control tongue p20 biological rep age vs krt13 ko tongue p0 biological rep age |
| GSE145215_2_v_1_krt13_mouse | control tongue p0 biological rep age vs krt13 ko tongue p20 biological rep age |
| GSE145215_2_v_3_krt13_mouse | control tongue p0 biological rep age vs krt13 ko tongue p0 biological rep age |
| GSE171292_1_v_0_ehhadh_mouse | strain b6/129 liver age weeks wt saline vs strain b6/129 liver age weeks ehhadh ko l ac |
| GSE171292_5_v_2_ehhadh_mouse | strain b6/129 liver age weeks wt l ac vs strain b6/129 liver age weeks ehhadh ko saline |
| GSE171292_6_v_0_ehhadh_mouse | strain b6/129 liver age weeks wt saline vs strain b6/129 liver age weeks ehhadh ko l ac |
| GSE179031_0_v_1_foxp1_mouse | foxp1 control overexpression rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct empty vector vs foxp1 knockdown rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct shrna |
| GSE118617,GSE118619_2_v_1_foxp1_mouse | luminal control strain foxp1(fl/fl) mammary epithelium epithelial cell foxp1 vs luminal foxp1 knockout strain mmtv cre/foxp1(fl/fl) mammary epithelium epithelial cell |
| GSE179031_0_v_2_foxp1_mouse | foxp1 control overexpression rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct empty vector vs foxp1 overexpression rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct constituent |
| GSE118617,GSE118619_2_v_3_foxp1_mouse | luminal control strain foxp1(fl/fl) mammary epithelium epithelial cell foxp1 vs basal foxp1 knockout strain mmtv cre/foxp1(fl/fl) mammary epithelium epithelial cell |
| GSE210770_0_v_1_foxp1_mouse | u14 cervical cell line wt vs u14 cervical cell line overexpression oefoxp1 |
| GSE118617,GSE118619_0_v_3_foxp1_mouse | basal control strain foxp1(fl/fl) mammary epithelium epithelial cell foxp1 vs basal foxp1 knockout strain mmtv cre/foxp1(fl/fl) mammary epithelium epithelial cell |
| GSE118617,GSE118619_0_v_1_foxp1_mouse | basal control strain foxp1(fl/fl) mammary epithelium epithelial cell foxp1 vs luminal foxp1 knockout strain mmtv cre/foxp1(fl/fl) mammary epithelium epithelial cell |
| GSE108500_1_v_0_foxp1_human | wt cell line a549 lung adenocarcinoma wild type linesï¼x9bcontrol vs foxp1 knockdown cell line a549 lung adenocarcinoma |
| GSE179031_3_v_1_foxp1_mouse | foxp1 control knockdown rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct scrambled shrna vs foxp1 knockdown rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct shrna |
| GSE179031_3_v_2_foxp1_mouse | foxp1 control knockdown rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct scrambled shrna vs foxp1 overexpression rna seq cell line 3t3 l1 cells adipocytes strain swiss mouse expression construct constituent |
| GSE145507_2_v_5_hopx_mouse | p8 strain background c57bl/6 age 8 weeks /variation hopx wildtype bone marrow long term hsc (lt hscs) lt vs strain background c57bl/6 age 8 weeks /variation hopx knockout bone marrow type multipotent progenitors |
| GSE145476_1_v_0_hopx_mouse | w mn1 bone marrow strain c57bl/6 age 16 weeks hopx wildtype + overexpression wt mice bm cells vs h old bone marrow strain c57bl/6 age 18 weeks hopx knockout aged / mice bm cells |
| GSE145476_2_v_3_hopx_mouse | w old bone marrow strain c57bl/6 age 18 weeks hopx wildtype aged wt mice bm cells vs h mn1 bone marrow strain c57bl/6 age 16 weeks hopx knockout + overexpression / mice bm cells |
| GSE145476_2_v_0_hopx_mouse | w old bone marrow strain c57bl/6 age 18 weeks hopx wildtype aged wt mice bm cells vs h old bone marrow strain c57bl/6 age 18 weeks hopx knockout aged / mice bm cells |
| GSE221101_1_v_0_hopx_human | cell line a375 human malignant melanoma wt vs cell line a375 human malignant melanoma hopx overexpression |
| GSE237812,GSE237813_3_v_2_hmgb2_mouse | wt arm d8 spleen p14 vs hmgb2 cl13 spleen ko p14 |
| GSE237812,GSE237813_4_v_2_hmgb2_mouse | wt cl13 d8 spleen p14 vs hmgb2 cl13 spleen ko p14 |
| GSE134608,GSE134609_2_v_6_dlx5_mouse | 1st 2nd pharyngeal arches wild type replicate (rna seq) kat6a +/+ dlx5 2 strain c57bl/6 developmental stage e10.5 vs 1st 2nd pharyngeal arches kat6a homozygous knockout replicate (rna seq) / dlx5 +/+ 2 strain c57bl/6 developmental stage e10.5 |
| GSE186316_0_v_1_ccn2_mouse | strain c57bl/6 wild type injury state iri kidney cortex vs strain c57bl/6 ccn2 knockout injury state iri kidney cortex |
| GSE228619_0_v_1_cdh11_human | scr (control intestine cell line primary human intestinal epithelial cells myofibroblasts wild type scrambled (si)rna vs kd (cdh11 knockdown intestine cell line primary human intestinal epithelial cells myofibroblasts cdh11 sirna |
| GSE254649_2_v_0_cstf2_human | huh7 control liver cell line hepatocellular carcinoma cells wt none vs huh7 cstf2 ko liver cell line hepatocellular carcinoma cells knockout none |
| GSE254649_3_v_1_cstf2_human | plc/prf/5 control liver cell line hepatocellular carcinoma cells wt none vs plc/prf/5 cstf2 ko liver cell line hepatocellular carcinoma cells knockout none |
| GSE254649_2_v_1_cstf2_human | huh7 control liver cell line hepatocellular carcinoma cells wt none vs plc/prf/5 cstf2 ko liver cell line hepatocellular carcinoma cells knockout none |
| GSE254649_3_v_0_cstf2_human | plc/prf/5 control liver cell line hepatocellular carcinoma cells wt none vs huh7 cstf2 ko liver cell line hepatocellular carcinoma cells knockout none |
| GSE200839,GSE233826_2_v_4_tnrc18_human | ht29 wt cell line ht 29 human colon adenocarcinoma tnrc18 vs ht29 tnrc18ko cell line ht 29 human colon adenocarcinoma tnrc18 ko |
| GSE200839,GSE233826_3_v_6_tnrc18_human | hek293 wt cell line human embryonic kidney tnrc18 vs hek293 tnrc18ko cell line human embryonic kidney tnrc18 ko |
| GSE200839,GSE233826_5_v_0_tnrc18_human | snu1 wt cell line snu 1 human gastric carcinoma tnrc18 vs snu1 tnrc18ko cell line snu 1 human gastric carcinoma tnrc18 ko |
| GSE200839,GSE233826_2_v_0_tnrc18_human | ht29 wt cell line ht 29 human colon adenocarcinoma tnrc18 vs snu1 tnrc18ko cell line snu 1 human gastric carcinoma tnrc18 ko |
| GSE200839,GSE233826_5_v_6_tnrc18_human | snu1 wt cell line snu 1 human gastric carcinoma tnrc18 vs hek293 tnrc18ko cell line human embryonic kidney tnrc18 ko |
| GSE200839,GSE233826_3_v_4_tnrc18_human | hek293 wt cell line human embryonic kidney tnrc18 vs ht29 tnrc18ko cell line ht 29 human colon adenocarcinoma tnrc18 ko |
| GSE200839,GSE233826_5_v_4_tnrc18_human | snu1 wt cell line snu 1 human gastric carcinoma tnrc18 vs ht29 tnrc18ko cell line ht 29 human colon adenocarcinoma tnrc18 ko |
| GSE200839,GSE233826_2_v_6_tnrc18_human | ht29 wt cell line ht 29 human colon adenocarcinoma tnrc18 vs hek293 tnrc18ko cell line human embryonic kidney tnrc18 ko |
| GSE200839,GSE233826_3_v_0_tnrc18_human | hek293 wt cell line human embryonic kidney tnrc18 vs snu1 tnrc18ko cell line snu 1 human gastric carcinoma tnrc18 ko |
| GSE124932_2_v_1_sarm1_mouse | sarm1 ko background strain c57bl/6j brain age 2m / infected uninfected vs sarm1 ko rml background strain c57bl/6j brain age 6m / infected prion |
| GSE132948,GSE132949_4_v_1_msi2_mouse | lsk msi2 ada normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar fusion 48hr transduction sorted lsks c57/b6j mice vs lsc mig leukemic stem cells overexpression overexpressing empty vector 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_0_v_3_msi2_mouse | lsk msi2 dcd normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 dcd leukemic stem cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_2_v_3_msi2_mouse | lsk mig normal hematopoietic stem progenitor cells overexpression overexpressing empty vector 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 dcd leukemic stem cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_2_v_5_msi2_mouse | lsk mig normal hematopoietic stem progenitor cells overexpression overexpressing empty vector 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 ada leukemic stem cells overexpression overexpressing hyperadar fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_4_v_5_msi2_mouse | lsk msi2 ada normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar fusion 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 ada leukemic stem cells overexpression overexpressing hyperadar fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_0_v_5_msi2_mouse | lsk msi2 dcd normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 ada leukemic stem cells overexpression overexpressing hyperadar fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_0_v_1_msi2_mouse | lsk msi2 dcd normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted lsks c57/b6j mice vs lsc mig leukemic stem cells overexpression overexpressing empty vector 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE132948,GSE132949_4_v_3_msi2_mouse | lsk msi2 ada normal hematopoietic stem progenitor cells overexpression overexpressing hyperadar fusion 48hr transduction sorted lsks c57/b6j mice vs lsc msi2 dcd leukemic stem cells overexpression overexpressing hyperadar catalytic dead fusion 48hr transduction sorted c kit high (top 10%) quaternary mll af9 actin dsred mice |
| GSE216394_2_v_0_pfkp_mouse | r1 cells sh ctrl eb formation 6d cell line mouse embryonic stem shrna wt vs r1 cells sh pfkp eb formation 6d cell line mouse embryonic stem shrna knockdown |
| GSE174424,GSE174425_5_v_1_cnot8_mouse | cnot8 wt strain icr differentiation hour epilc wild type mouse esc cell line vs cnot8 5 ko rep1 strain icr differentiation hour epilc mouse esc cell line |
| GSE174424,GSE174425_5_v_6_cnot8_mouse | cnot8 wt strain icr differentiation hour epilc wild type mouse esc cell line vs cnot8 8 ko rep2 strain icr differentiation hour epilc mouse esc cell line |
| GSE249146_2_v_1_dusp6_mouse | aml12 nc cell line liver cells wt vs aml12 sidusp6 cell line liver cells dusp6 knockdown |
| GSE231524,GSE231526_0_v_1_dusp6_human | mda mb 453 scrambled sample id cell line her2+ breast cancer wt vs mda mb 453 dusp6 knockdown sample id cell line her2+ breast cancer kd |
| GSE249146_2_v_3_dusp6_mouse | aml12 nc cell line liver cells wt vs aml12 gfp dusp6 cell line liver cells overexpression |
| GSE172490_5_v_1_junb_mouse | th2 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th2 ko strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE172490_4_v_1_junb_mouse | th1 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th2 ko strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE172490_5_v_3_junb_mouse | th2 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th0 ko 1 strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE172490_0_v_1_junb_mouse | th0 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th2 ko strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE172490_0_v_3_junb_mouse | th0 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th0 ko 1 strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE172490_4_v_3_junb_mouse | th1 wt strain c57bl/6 junbfl/fl polarizing condition naive cd4+ cells splenocytes vs th0 ko 1 strain c57bl/6 junbfl/flcd4cre polarizing condition naive cd4+ cells splenocytes |
| GSE113844_1_v_0_dnmt3l_mouse | rna wt [wt strain background c57bl/6 /variation wild type mesenchymal stem cells (mscs) cell subtype passage 4 mscs vs rna d3lko [mut strain background c57bl/6 /variation dnmt3l ko mesenchymal stem cells (mscs) cell subtype passage 4 mscs |
| GSE197630_1_v_0_ruvbl1_human | c4 2b enzr cell control line prostate cancer /variation negative vs c4 2b enzr cell ruvbl1 knockdown line prostate cancer /variation |
| GSE113267_0_v_1_rfx7_mouse | bonemarrow strain/background c57bl/6 /variation rfx7 wt source organ bone marrow natural killer (nk) cells wild type nk âx80x93 replicate vs spnk strain/background c57bl/6 /variation rfx7 ko source organ spleen natural killer (nk) cells knock nk âx80x93 replicate |
| GSE113267_3_v_2_rfx7_mouse | spnk strain/background c57bl/6 /variation rfx7 wt source organ spleen natural killer (nk) cells wild type nk âx80x93 replicate vs bonemarrow strain/background c57bl/6 /variation rfx7 ko source organ bone marrow natural killer (nk) cells knock nk âx80x93 replicate |
| GSE167984,GSE167987_0_v_1_setd1b_mouse | setd1b wt rnaseq germinal vesicle oocytes strain c57bl6 floxed/floxed gdf9 cre negative age 21 days d21 gv vs setd1b ko rnaseq germinal vesicle oocytes strain c57bl6 floxed/floxed gdf9 cre positive age 21 days d21 gv |
| GSE94814_2_v_3_reck_mouse | wt cortex strain mixed age p0 wild type brain vs reck vko subcortex strain mixed age p0 vascular ko flex2/îx94ex1 tie2cre brain |
| GSE94814_1_v_3_reck_mouse | wt subcortex strain mixed age p0 wild type brain vs reck vko subcortex strain mixed age p0 vascular ko flex2/îx94ex1 tie2cre brain |
| GSE94814_2_v_0_reck_mouse | wt cortex strain mixed age p0 wild type brain vs reck vko cortex strain mixed age p0 vascular ko flex2/îx94ex1 tie2cre brain |
| GSE94814_1_v_0_reck_mouse | wt subcortex strain mixed age p0 wild type brain vs reck vko cortex strain mixed age p0 vascular ko flex2/îx94ex1 tie2cre brain |
| GSE111385_2_v_1_tgfbr2_mouse | p7802 mac wt strain c57bl/6 knockout status lane 1 macrophages vs p7802 mac ko strain c57bl/6 knockout status tgfbr2 lane 1 macrophages |
| GSE111385_2_v_3_tgfbr2_mouse | p7802 mac wt strain c57bl/6 knockout status lane 1 macrophages vs p7802 ug ko strain c57bl/6 knockout status tgfbr2 lane 1 microglia |
| GSE209590_2_v_0_tgfbr2_mouse | day 30 wt tim3+ spleen cell line p14 cells cd8 lcmv clone 13 infection days post subset vs day 30 ko tim3+ spleen cell line p14 cells cd8 tgfbr2 lcmv clone 13 infection days post subset |
| GSE209577_0_v_1_tgfbr2_mouse | wt spleen cell line p14 cells cd8 lcmv clone 13 infection vs ko spleen cell line p14 cells cd8 tgfbr2 lcmv clone 13 infection |
| GSE111385_0_v_3_tgfbr2_mouse | p7802 ug wt strain c57bl/6 knockout status lane 1 microglia vs p7802 ug ko strain c57bl/6 knockout status tgfbr2 lane 1 microglia |
| GSE209598_0_v_3_tgfbr2_mouse | day wt tim3+ spleen cell line p14 cells cd8 lcmv clone 13 infection days post subset vs day ko cxcr5+ spleen cell line p14 cells cd8 tgfbr2ko lcmv clone 13 infection days post subset |
| GSE209598_1_v_3_tgfbr2_mouse | day 15 wt cxcr5+ spleen cell line p14 cells cd8 lcmv clone 13 infection days post subset vs day ko cxcr5+ spleen cell line p14 cells cd8 tgfbr2ko lcmv clone 13 infection days post subset |
| GSE209598_1_v_2_tgfbr2_mouse | day 15 wt cxcr5+ spleen cell line p14 cells cd8 lcmv clone 13 infection days post subset vs day ko tim3+ spleen cell line p14 cells cd8 tgfbr2ko lcmv clone 13 infection days post subset |
| GSE111385_0_v_1_tgfbr2_mouse | p7802 ug wt strain c57bl/6 knockout status lane 1 microglia vs p7802 mac ko strain c57bl/6 knockout status tgfbr2 lane 1 macrophages |
| GSE218451_2_v_0_txnip_human | k562shtxnipc cell line k562 chronic myelogenous leukemia control cells vs k562shtxnip cell line k562 chronic myelogenous leukemia txnip knockdown k562cells shtxnip |
| GSE249569_1_v_0_ncapd3_human | spc 1 cells sh nc none cell line human lung adenocarcinoma wt vs spc 1 cells sh ncapd3 none cell line human lung adenocarcinoma knockdown |
| GSE227415_1_v_0_ucp1_mouse | control epididymal white adipose cl316 243 vs ubko epididymal white adipose ucp1 cre driven ctnnb1 knockout cl316 243 |
| GSE186112_1_v_0_med23_human | ctrl vein endothelial cell line huvec control human umbilical cells vs med23si vein endothelial cell line huvec med23 knockdown human umbilical cells |
| GSE112358,GSE112359_0_v_1_med23_mouse | rna wt strain c57bl/6 bone marrow wt(med23floxp/flowp) hematopoietic stem cells vs rna ko strain c57bl/6 bone marrow ko(mx1 cre med23floxp/flowp) hematopoietic stem cells |
| GSE77007_3_v_1_med23_mouse | p ctrl strain c57bl/6 age newborn wt calvaria vs p ko strain c57bl/6 age newborn med23 / (mensenchymal stem cells specific deletion) calvaria |
| GSE77007_0_v_1_med23_mouse | r wt strain c57bl/6 age newborn calvaria vs p ko strain c57bl/6 age newborn med23 / (mensenchymal stem cells specific deletion) calvaria |
| GSE146747_0_v_1_nr4a1_mouse | wt 2 hour stim strain c57bl/6 agent 10 microg/ml anti igm nr4a1+/+ age weeks spleen lymph node vs ko 2 hour stim strain c57bl/6 agent 10 microg/ml anti igm nr4a1 / age weeks spleen lymph node |
| GSE230174_0_v_1_dagla_human | hep3b cells shcontrol cell line human hepatocellular carcinoma (hcc) control vs hep3b cells shdagla cell line human hepatocellular carcinoma (hcc) dagla knockdown |
| GSE163052,GSE163198_5_v_0_hira_mouse | wt hsc h2b gfp high rna rep strain c57bl/6 bone marrow hematopoietic stem cells expression vs ko mpp h2b gfp low rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE66931,GSE73382_1_v_0_hira_mouse | hira rna seq [gdf9 cre+] strain c57bl/6 /variation hiraf/f oocyte developmental stage mii wt vs hira rna seq [gdf9 cre+] strain c57bl/6 /variation hiraf/f gdf9 cre+ oocyte developmental stage mii ko |
| GSE73381,GSE73382_0_v_1_hira_mouse | hira rna seq [zp3 cre] /variation hiraf/f oocyte developmental stage mii wt vs hira rna seq [zp3 cre] /variation hiraf/f zp3 cre oocyte developmental stage mii ko |
| GSE163052,GSE163198_2_v_7_hira_mouse | wt mpp h2b gfp low rna rep strain c57bl/6 bone marrow multipotent progenitors expression vs ko hsc h2b gfp high rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE230744,GSE237803_5_v_2_hira_human | r1 ad1 flagha h3f3a hira ko biol rep cell line prostate cancer cells ar wt flag ha knock 5' orf gene vs r1 ad1 flagha h3f3a ar ko biol rep cell line prostate cancer cells flag ha knock 5' orf gene |
| GSE163052,GSE163198_4_v_8_hira_mouse | wt hsc rna rep strain c57bl/6 bone marrow hematopoietic stem cells h2b gfp expression none vs ko mpp h2b gfp high rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE163052,GSE163198_4_v_3_hira_mouse | wt hsc rna rep strain c57bl/6 bone marrow hematopoietic stem cells h2b gfp expression none vs ko hsc h2b gfp low rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE163052,GSE163198_6_v_7_hira_mouse | wt mpp h2b gfp high rna rep strain c57bl/6 bone marrow multipotent progenitors expression vs ko hsc h2b gfp high rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE230744,GSE237803_5_v_3_hira_human | r1 ad1 flagha h3f3a hira ko biol rep cell line prostate cancer cells ar wt flag ha knock 5' orf gene vs r1 ad1 flagha h3f3a ar ko dex 4h biol rep cell line prostate cancer cells flag ha knock 5' orf gene 100 nm dexamethasone |
| GSE163052,GSE163198_4_v_0_hira_mouse | wt hsc rna rep strain c57bl/6 bone marrow hematopoietic stem cells h2b gfp expression none vs ko mpp h2b gfp low rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE146894_3_v_8_hira_mouse | gfp 2cell strain background c57bl/6 /variation control developmental stage/ 2 cell embryos vs hira gv ko strain background c57bl/6 /variation developmental stage/ oocytes |
| GSE163052,GSE163198_1_v_0_hira_mouse | wt hsc h2b gfp low rna rep strain c57bl/6 bone marrow hematopoietic stem cells expression vs ko mpp h2b gfp low rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE163052,GSE163198_2_v_3_hira_mouse | wt mpp h2b gfp low rna rep strain c57bl/6 bone marrow multipotent progenitors expression vs ko hsc h2b gfp low rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE163052,GSE163198_1_v_8_hira_mouse | wt hsc h2b gfp low rna rep strain c57bl/6 bone marrow hematopoietic stem cells expression vs ko mpp h2b gfp high rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE163052,GSE163198_5_v_8_hira_mouse | wt hsc h2b gfp high rna rep strain c57bl/6 bone marrow hematopoietic stem cells expression vs ko mpp h2b gfp high rna rep strain c57bl/6 hira bone marrow multipotent progenitors expression |
| GSE163052,GSE163198_5_v_3_hira_mouse | wt hsc h2b gfp high rna rep strain c57bl/6 bone marrow hematopoietic stem cells expression vs ko hsc h2b gfp low rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE230744,GSE237803_0_v_3_hira_human | r1 ad1 flagha h3f3a hira ko dex 4h biol rep cell line prostate cancer cells ar wt flag ha knock 5' orf gene 100 nm dexamethasone vs r1 ad1 flagha h3f3a ar ko dex 4h biol rep cell line prostate cancer cells flag ha knock 5' orf gene 100 nm dexamethasone |
| GSE161055,GSE161056_1_v_0_hira_mouse | c2c12 strain source c3h cell line skeletal muscle wt vs hira ko strain source c3h cell line c2c12 skeletal muscle / |
| GSE163052,GSE163198_6_v_3_hira_mouse | wt mpp h2b gfp high rna rep strain c57bl/6 bone marrow multipotent progenitors expression vs ko hsc h2b gfp low rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE230744,GSE237803_0_v_2_hira_human | r1 ad1 flagha h3f3a hira ko dex 4h biol rep cell line prostate cancer cells ar wt flag ha knock 5' orf gene 100 nm dexamethasone vs r1 ad1 flagha h3f3a ar ko biol rep cell line prostate cancer cells flag ha knock 5' orf gene |
| GSE163052,GSE163198_4_v_7_hira_mouse | wt hsc rna rep strain c57bl/6 bone marrow hematopoietic stem cells h2b gfp expression none vs ko hsc h2b gfp high rna rep strain c57bl/6 hira bone marrow hematopoietic stem cells expression |
| GSE116242_0_v_1_olig2_mouse | wt strain c57bl/6 age p14 /variation wild type mouse brain vs prmt5 olig2cre ko strain c57bl/6 age p14 /variation mouse brain |
| GSE147664_0_v_1_arid1b_mouse | mrna seq control liver (arid1a f/f arid1b alb cre ) [wt /variation arid1a vs mrna seq arid1a/1b double ko liver (arid1a f/f arid1b alb cre+) [dko /variation arid1a cre+ |
| GSE57875_1_v_0_hnrnpl_mouse | hnrnpl wild type embryo strain c57bl/6 age embryonic day 14.5 whole fetal liver cells vs hnrnpl ko embryo strain c57bl/6 age embryonic day 14.5 knock whole fetal liver cells |
| GSE121824,GSE121826_0_v_6_scaf8_human | wt1 mrna seq crispr status wt cell line hek293 flp rex scaf4 ko/gfp plus dox vs mrna seq crispr status scaf4 scaf8 double ko cell line hek293 flp rex scaf4scaf8 minus dox |
| GSE121824,GSE121826_0_v_8_scaf8_human | wt1 mrna seq crispr status wt cell line hek293 flp rex scaf4 ko/gfp plus dox vs mrna seq crispr status scaf4 single ko cell line hek293 flp rex scaf4scaf8 plus dox |
| GSE121824,GSE121826_0_v_3_scaf8_human | wt1 mrna seq crispr status wt cell line hek293 flp rex scaf4 ko/gfp plus dox vs scaf8ko1 mrna seq crispr status scaf8 single ko cell line hek293 flp rex ko/gfp minus dox |
| GSE121824,GSE121826_0_v_7_scaf8_human | wt1 mrna seq crispr status wt cell line hek293 flp rex scaf4 ko/gfp plus dox vs mrna seq crispr status scaf8 single ko cell line hek293 flp rex scaf4scaf8 scaf4 plus dox |
| GSE121824,GSE121826_0_v_2_scaf8_human | wt1 mrna seq crispr status wt cell line hek293 flp rex scaf4 ko/gfp plus dox vs mrna seq crispr status scaf4 scaf8 double ko cell line hek293 flp rex scaf4scaf8 minus dox |
| GSE154350_1_v_0_ascl2_human | control sample extravillous trophoblast shrna human stem cells vs knockdown sample extravillous trophoblast shrna ascl2 human stem cells |
| GSE226544_1_v_0_hnrnpa2b1_human | huh7 cells sgnc cell line liver cancer wt culture vs huh7 cells sghnrnpa2b1 cell line liver cancer ko culture |
| GSE240809_0_v_1_hnrnpa2b1_human | u251 nc cell line glioma control vs u251sha2b1 cell line u251 glioma hnrnpa2b1 knockdown |
| GSE253799_0_v_1_matn3_mouse | sham cerebral cortex wt surgery vs ir matn3 peri infarct area ischemic cerebral cortex knockout tmcao (ischemia 60 min reperfusion 1 dayï¼x89 |
| GSE217694_4_v_0_pold1_mouse | wild type none hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol incubation sex male vs apold1 ko 16h angoigenic hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol medium incubation sex male |
| GSE217694_3_v_0_pold1_mouse | wild type 16h angoigenic hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol medium incubation sex male vs apold1 ko 16h angoigenic hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol medium incubation sex male |
| GSE217694_3_v_2_pold1_mouse | wild type 16h angoigenic hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol medium incubation sex male vs apold1 ko none hind leg muscle replicate biol rep cell line facs sorted smooth ecs endothelial cells protocol incubation sex male |
| GSE200897_1_v_0_pold1_human | 5637 cells sinc bladder cell line cancer wt sirna transfection vs 5637 cells sipold1 bladder cell line cancer pold1 knockdown sirna transfection |
| GSE117212,GSE117214_0_v_1_zbtb1_human | u2os zbtb10 ko cell line /vaiation wildtype wt vs hek zbtb10 ko cell line hek293 /vaiation knockout clone |
| GSE117212,GSE117214_2_v_1_zbtb1_human | hek zbtb10 ko cell line hek293 /vaiation wildtype wt vs hek zbtb10 ko cell line hek293 /vaiation knockout clone |
| GSE153189_1_v_0_stat1_mouse | mt4788 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt4788 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE153189_2_v_3_stat1_mouse | mt864 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt864 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE147959,GSE147960_5_v_3_stat1_mouse | ibmdm sh.stat1 stat1 wt ifnî³ rna seq [dataset 9] immortalized bone marrow derived macrophages (ibmdm) /variation shrna wildtype overexpression vs ibmdm sh.ns gfp ifnî³ rna seq [dataset 9] immortalized bone marrow derived macrophages (ibmdm) /variation non specific shrna overexpression |
| GSE153189_1_v_3_stat1_mouse | mt4788 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt864 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE203655_0_v_1_stat1_mouse | microglia control 12dpi replicate brain cx3cr1creert2/+ rosa26zsgreen/zsgreen sex male infection . gondii time 12 days post vs microglia stat1 ko 12dpi replicate brain stat1fl/fl cx3cr1creert2/+ rosa26zsgreen/zsgreen sex male infection . gondii time 12 days post |
| GSE153189_2_v_0_stat1_mouse | mt864 repeat tumor cell line derived mmtv/mt mammary stat1 wt 1ng/ml ifng vs mt4788 stat1ko repeat tumor cell line derived mmtv/mt mammary stat1 ko 1ng/ml ifng |
| GSE137954_4_v_2_smyd3_mouse | cell line c2c12 differentiation timepoint sictrl rna extraction protocol nucleospin kit vs cell line c2c12 differentiation timepoint smyd3 overexpression (prev cl5) rna extraction protocol trizol |
| GSE186223,GSE186224_6_v_3_hmces_mouse | wt mouse embryonic stem cell (mesc) strain c57bl/6 wild type vs hmces mouse embryonic stem cell (mesc) strain c57bl/6 ko |
| GSE150721_0_v_1_hmces_mouse | 19 l 958 13bp wt lt stain c57bl/6 age 2 months /variation wild type bone marrow facs sorted hscs vs 19 l 958 13bp ko lt stain c57bl/6 age 2 months /variation hmces knockout bone marrow facs sorted hscs |
| GSE186223,GSE186224_6_v_2_hmces_mouse | wt mouse embryonic stem cell (mesc) strain c57bl/6 wild type vs hmces mouse embryonic stem cell (mesc) strain c57bl/6 ko |
| GSE189599,GSE196004_0_v_1_bend2_mouse | d12 rna wt lz strain c57bl/6 developmental stage bend2 spermatocytes vs d12 rna ko lz strain c57bl/6 developmental stage bend2 spermatocytes |
| GSE208722_0_v_1_mkrn3_human | hypothalamic neurons mkrn3 wt derived hipscs vs hypothalamic neurons mkrn3 ko derived hipscs |
| GSE150634_1_v_0_cd28_mouse | cd8+ 12h strain c57bl/6 wt splenic cells stimulated anti cd3/cd28 12h. vs cd8+ 12h strain c57bl/6 lrch1 ko splenic cells stimulated anti cd3/cd28 12h. |
| GSE162967_5_v_6_fgf21_mouse | wt lp strain background c57bl6/j /variation wild type sex male age 22 months dietary protein level low (5%) kidney vs fgf21 ko lp strain background c57bl6/j /variation sex male age 22 months dietary protein level low (5%) kidney |
| GSE162967_0_v_6_fgf21_mouse | fgf21 ko np strain background c57bl6/j /variation sex male age 22 months dietary protein level normal (20%) kidney vs fgf21 ko lp strain background c57bl6/j /variation sex male age 22 months dietary protein level low (5%) kidney |
| GSE68155_1_v_0_gpr3_mouse | dc naiv wt bone marrow derived dendritic cells strain c57bl/6 age 8 16 weeks wildtype vs dc lps ko bone marrow derived dendritic cells strain c57bl/6 age 8 16 weeks gpr34 / |
| GSE212893_2_v_3_gpr3_mouse | hippocampus wild type wt strain c57bl/6j age 10 weeks old sex female vs hippocampus ag ko astrocyte specific gpr30 strain c57bl/6j age 10 weeks old sex female |
| GSE212893_2_v_1_gpr3_mouse | hippocampus wild type wt strain c57bl/6j age 10 weeks old sex female vs hippocampus ng ko neuron specific gpr30 strain c57bl/6j age 10 weeks old sex female |
| GSE68155_3_v_2_gpr3_mouse | dc lps wt bone marrow derived dendritic cells strain c57bl/6 age 8 16 weeks wildtype vs dc naiv ko bone marrow derived dendritic cells strain c57bl/6 age 8 16 weeks gpr34 / |
| GSE128232,GSE128233_1_v_0_phf2_human | cell line mda mb 231 /variation control sicontrol vs cell line mda mb 231 /variation phf20l1 knockdown siphf20l1 |
| GSE237053_1_v_0_comt_human | u87 vc brain tumor cell line glioblastoma adherent epithelial cells lenti crispr vector control vs u87 ko brain tumor cell line glioblastoma adherent epithelial cells comt knockout |
| GSE158182_5_v_0_pnpla3_human | c wt hepatocyte like cells cell line fsps13b differentiation hlc control vs oa pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE158182_3_v_0_pnpla3_human | 30 wt hepatocyte like cells cell line fsps13b #30 differentiation hlc vs oa pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE158182_5_v_7_pnpla3_human | c wt hepatocyte like cells cell line fsps13b differentiation hlc control vs pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE158182_3_v_7_pnpla3_human | 30 wt hepatocyte like cells cell line fsps13b #30 differentiation hlc vs pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE158182_4_v_7_pnpla3_human | oa wt hepatocyte like cells cell line fsps13b differentiation hlc vs pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE158182_4_v_0_pnpla3_human | oa wt hepatocyte like cells cell line fsps13b differentiation hlc vs oa pnpla3 ko hepatocyte like cells cell line fsps13b differentiation hlc |
| GSE198165,GSE198166_9_v_2_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs mefs zfp266 ko mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced |
| GSE198165,GSE198166_7_v_11_zfp266_mouse | mefs control wild type mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_6_v_10_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_8_v_10_zfp266_mouse | d3 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_5_v_10_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_0_v_2_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs mefs zfp266 ko mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced |
| GSE198165,GSE198166_7_v_1_zfp266_mouse | mefs control wild type mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_9_v_4_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_6_v_11_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_9_v_1_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_7_v_3_zfp266_mouse | mefs control wild type mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced vs d5 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_9_v_10_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_0_v_10_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_5_v_3_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs d5 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_6_v_3_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs d5 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_0_v_3_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d5 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_6_v_4_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_5_v_4_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_5_v_2_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs mefs zfp266 ko mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced |
| GSE198165,GSE198166_7_v_4_zfp266_mouse | mefs control wild type mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_5_v_1_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_9_v_3_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d5 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_6_v_2_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs mefs zfp266 ko mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced |
| GSE198165,GSE198166_5_v_11_zfp266_mouse | ips control wild type induced pluripotent stem cells strain 129 ipsc vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_0_v_4_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_0_v_11_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_8_v_1_zfp266_mouse | d3 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_8_v_2_zfp266_mouse | d3 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs mefs zfp266 ko mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced |
| GSE198165,GSE198166_0_v_1_zfp266_mouse | d7 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_8_v_4_zfp266_mouse | d3 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs esc zfp266 ko embryonic stem cells mesc |
| GSE198165,GSE198166_7_v_10_zfp266_mouse | mefs control wild type mouse embryonic fibroblasts cell origin p2 derived e12.5 embryos strain 129 sgrna transduced vs d7 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_6_v_1_zfp266_mouse | esc control wild type embryonic stem cells mesc parental line (clone j) zfp266 ko clones vs ips zfp266 ko induced pluripotent stem cells strain 129 ipsc |
| GSE198165,GSE198166_8_v_11_zfp266_mouse | d3 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE198165,GSE198166_9_v_11_zfp266_mouse | d5 reprogramminng control wild type reprogramming cells time strain 129 sgrna transduced vs d3 reprogramminng zfp266 ko reprogramming cells time strain 129 sgrna transduced |
| GSE210951_1_v_0_islr_mouse | satellite cells control day4 skeletal muscle cell line stem growth culture vs satellite cells islr knockout day4 skeletal muscle cell line stem ko growth culture |
| GSE123836_1_v_0_myf6_mouse | injury rnaseq hind limb skeletal muscle wt protocol rna vs injury myf6ko rnaseq hind limb skeletal muscle myf6 ko protocol rna |
| GSE123836_2_v_0_myf6_mouse | wt rnaseq hind limb skeletal muscle protocol without injury rna vs injury myf6ko rnaseq hind limb skeletal muscle myf6 ko protocol rna |
| GSE133505_5_v_4_myf6_mouse | myf6 wt satellite cell biological rep technical age 10 months old wild type cells gender female vs myf6 ko satellite cell biological rep technical age 10 months old knockout cells gender female |
| GSE123836_2_v_3_myf6_mouse | wt rnaseq hind limb skeletal muscle protocol without injury rna vs myf6ko rnaseq hind limb skeletal muscle myf6 ko protocol without injury rna |
| GSE165647_5_v_7_cry2_mouse | sample empty vector control high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts vs sample cry2 d325h high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts |
| GSE89018_1_v_14_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 20 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE89018_6_v_14_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 12 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE165647_0_v_1_cry2_mouse | sample empty vector control low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts vs sample cry2 d325h low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_0_v_7_cry2_mouse | sample empty vector control low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts vs sample cry2 d325h high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts |
| GSE165647_5_v_1_cry2_mouse | sample empty vector control high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts vs sample cry2 d325h low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE89018_12_v_2_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE89018_1_v_2_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 20 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE165647_6_v_3_cry2_mouse | sample cry2 low density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 150 cells/well mouse embryonic fibroblasts vs sample cry2 s510l low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_0_v_3_cry2_mouse | sample empty vector control low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts vs sample cry2 s510l low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE89018_11_v_2_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 16 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE165647_6_v_1_cry2_mouse | sample cry2 low density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 150 cells/well mouse embryonic fibroblasts vs sample cry2 d325h low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_6_v_7_cry2_mouse | sample cry2 low density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 150 cells/well mouse embryonic fibroblasts vs sample cry2 d325h high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts |
| GSE165647_5_v_4_cry2_mouse | sample empty vector control high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts vs sample cry2 f428d low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE89018_12_v_8_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone 12 |
| GSE89018_1_v_8_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 20 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone 12 |
| GSE89018_11_v_14_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 16 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE165647_2_v_7_cry2_mouse | sample cry2 high density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 500 cells/well mouse embryonic fibroblasts vs sample cry2 d325h high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts |
| GSE165647_5_v_3_cry2_mouse | sample empty vector control high density âx80x93 biological replicate mefs /variation stable overexpression c myc 500 cells/well mouse embryonic fibroblasts vs sample cry2 s510l low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_2_v_4_cry2_mouse | sample cry2 high density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 500 cells/well mouse embryonic fibroblasts vs sample cry2 f428d low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_6_v_4_cry2_mouse | sample cry2 low density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 150 cells/well mouse embryonic fibroblasts vs sample cry2 f428d low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE165647_2_v_3_cry2_mouse | sample cry2 high density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 500 cells/well mouse embryonic fibroblasts vs sample cry2 s510l low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE89018_10_v_8_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 0 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone 12 |
| GSE89018_6_v_2_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 12 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE89018_6_v_8_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 12 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone 12 |
| GSE89018_12_v_14_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE89018_11_v_8_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 16 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone 12 |
| GSE165647_2_v_1_cry2_mouse | sample cry2 high density âx80x93 biological replicate mefs /variation stable overexpression c myc wt 500 cells/well mouse embryonic fibroblasts vs sample cry2 d325h low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE89018_10_v_2_cry2_mouse | r143 wildtype mouse embryonic fibroblast hours dexamethasone 0 vs r143 cry2 knockout mouse embryonic fibroblast hours dexamethasone |
| GSE165647_0_v_4_cry2_mouse | sample empty vector control low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts vs sample cry2 f428d low density âx80x93 biological replicate mefs /variation stable overexpression c myc 150 cells/well mouse embryonic fibroblasts |
| GSE79663_2_v_0_tcf4_mouse | strain b6 129sf2/j dorsal telencephalon developmental stage newborn (p0) wildtype vs strain b6 129sf2/j dorsal telencephalon developmental stage newborn (p0) tcf4 knockout |
| GSE128333_4_v_5_tcf4_human | day 14 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived glutamatergic neurons time vs day 14 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived glutamatergic neurons time |
| GSE128333_2_v_5_tcf4_human | day 3 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived neural progenitor cells time vs day 14 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived glutamatergic neurons time |
| GSE128333_2_v_1_tcf4_human | day 3 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived neural progenitor cells time vs day 14 knockdown sample cell line [d14 1] /variation tcf4 ipsc derived glutamatergic neurons time |
| GSE128333_3_v_0_tcf4_human | day 14 control sample cell line cd09 [d14 09 1] /variation ipsc derived glutamatergic neurons time vs day 3 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived neural progenitor cells time |
| GSE128333_2_v_0_tcf4_human | day 3 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived neural progenitor cells time vs day 3 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived neural progenitor cells time |
| GSE128333_4_v_0_tcf4_human | day 14 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived glutamatergic neurons time vs day 3 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived neural progenitor cells time |
| GSE128333_4_v_1_tcf4_human | day 14 control sample schizophrenia individual [ctrl 1] disease state /variation ipsc derived glutamatergic neurons time vs day 14 knockdown sample cell line [d14 1] /variation tcf4 ipsc derived glutamatergic neurons time |
| GSE120463_1_v_0_tcf4_mouse | tcf4 wt sample type neuronal material strain c57bl/6 /variation cortical dissected e14.5 vs tcf4 ko sample type neuronal material strain c57bl/6 /variation cortical dissected e14.5 |
| GSE128333_3_v_5_tcf4_human | day 14 control sample cell line cd09 [d14 09 1] /variation ipsc derived glutamatergic neurons time vs day 14 knockdown sample schizophrenia individual [itf2 1] disease state /variation tcf4 ipsc derived glutamatergic neurons time |
| GSE228125_0_v_3_ptafr_mouse | wt hyperoxia lung wild type vs ptafr ko normoxia lung |
| GSE228125_2_v_1_ptafr_mouse | wt normoxia lung wild type vs ptafr ko hyperoxia lung |
| GSE232944_1_v_0_ctnnb1_human | ht 29 cells shnt1 colorectal cell line colon adenocarcinoma apc mutant ctr vs ht 29 cells ctnnb1 colorectal cell line colon adenocarcinoma apc mutant overexpression |
| GSE112714_2_v_1_ctnnb1_human | hwt / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation wild type vs hoe dox / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation inducible ctnnb1 overexpression without |
| GSE112714_2_v_3_ctnnb1_human | hwt / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation wild type vs hoeplusdox / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation inducible ctnnb1 overexpression dox |
| GSE112714_2_v_0_ctnnb1_human | hwt / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation wild type vs hko / hesc derived mge like progenitor cells cell line h9 stage day 25 differentiation ctnnb1 knockout |
| GSE228181_3_v_1_idh1_mouse | crispr atrx ko clone mscv ev control rep cell line ct2a glioma strain c57bl/6 idh1 wt vs crispr atrx ko clone mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE189859,GSE189861_4_v_2_idh1_human | cic ko2 (idh1 wt) rna seq rep immortalized astrocyte cells ko idh1 wt vs cic (idh1 r132h) rna seq rep immortalized astrocyte cells ko idh1 r132h |
| GSE228181_4_v_1_idh1_mouse | crispr atrx ko clone b mscv ev control rep cell line ct2a glioma strain c57bl/6 idh1 wt vs crispr atrx ko clone mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE189859,GSE189861_0_v_2_idh1_human | cic ko1 (idh1 wt) rna seq rep immortalized astrocyte cells ko idh1 wt vs cic (idh1 r132h) rna seq rep immortalized astrocyte cells ko idh1 r132h |
| GSE228181_4_v_5_idh1_mouse | crispr atrx ko clone b mscv ev control rep cell line ct2a glioma strain c57bl/6 idh1 wt vs crispr atrx ko clone b mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE189859,GSE189861_3_v_2_idh1_human | cic wt (idh1 r132h) rna seq rep immortalized astrocyte cells idh1 r132h vs cic (idh1 r132h) rna seq rep immortalized astrocyte cells ko idh1 r132h |
| GSE189859,GSE189861_1_v_2_idh1_human | cic wt (idh1 wt) rna seq rep immortalized astrocyte cells idh1 vs cic (idh1 r132h) rna seq rep immortalized astrocyte cells ko idh1 r132h |
| GSE228181_0_v_1_idh1_mouse | crispr control mscv ev rep cell line ct2a glioma strain c57bl/6 atrx wt idh1 vs crispr atrx ko clone mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE228181_2_v_1_idh1_mouse | crispr control mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 atrx wt vs crispr atrx ko clone mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE228181_3_v_5_idh1_mouse | crispr atrx ko clone mscv ev control rep cell line ct2a glioma strain c57bl/6 idh1 wt vs crispr atrx ko clone b mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE228181_2_v_5_idh1_mouse | crispr control mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 atrx wt vs crispr atrx ko clone b mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE228181_0_v_5_idh1_mouse | crispr control mscv ev rep cell line ct2a glioma strain c57bl/6 atrx wt idh1 vs crispr atrx ko clone b mscv idh1 r132h rep cell line ct2a glioma strain c57bl/6 |
| GSE158834_0_v_4_palm_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_4_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_8_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_4_palm_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_4_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_6_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_4_palm_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_3_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_12_v_9_palm_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_6_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_8_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_5_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_12_v_13_palm_human | wt bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_13_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_8_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_9_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_13_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_6_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 3h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_9_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_5_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE158834_11_v_4_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_4_palm_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_13_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_11_v_3_palm_human | wt pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_9_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_9_palm_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_13_palm_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_0_v_9_palm_human | wt full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 wildtype vs ko pa 24h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_2_v_13_palm_human | wt bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_7_v_13_palm_human | wt bsa 24h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 wildtype vs ko pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 knockout |
| GSE158834_10_v_3_palm_human | wt pa 9h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko bsa 9h cell embryonic kidney line hek293t 1% medium serum free hek293 adipor2 knockout |
| GSE158834_1_v_5_palm_human | wt pa 3h cell embryonic kidney line hek293t 1% bsa + 200âµm palmitic acid medium serum free hek293 adipor2 wildtype vs ko full cell embryonic kidney line hek293t medium (10% fbs) hek293 adipor2 knockout |
| GSE167224,GSE168147_4_v_5_hnrnpk_human | hct116 cells ctrl nc 1 cell line negative control 2 empty replicate vs hct116 cells crlm1 hnrnpk 1 cell line overexpression 2 replicate |
| GSE167224,GSE168147_1_v_5_hnrnpk_human | hct116 cells antisense nc 1 cell line negative control 2 replicate vs hct116 cells crlm1 hnrnpk 1 cell line overexpression 2 replicate |
| GSE167224,GSE168147_3_v_5_hnrnpk_human | hct116 cells antisense hnrnpk 1 cell line overexpression 2 control replicate vs hct116 cells crlm1 hnrnpk 1 cell line overexpression 2 replicate |
| GSE211262,GSE211263_3_v_1_pbrm1_human | hap pbrm1ko untreated cell line hap1 myeloid leukemia cells pbrm1 ko vs hap pbrm1ko ifng cell line hap1 myeloid leukemia cells pbrm1 ko treated |
| GSE211262,GSE211263_2_v_1_pbrm1_human | hap wild type ifng cell line hap1 myeloid leukemia cells pbrm1 wt treated vs hap pbrm1ko ifng cell line hap1 myeloid leukemia cells pbrm1 ko treated |
| GSE211261,GSE211263_0_v_1_pbrm1_mouse | aml tet2tet3 bone marrow myeloid leukemia cells pbrm1 wt vs aml tet2tet3pbrm1 bone marrow myeloid leukemia cells pbrm1 ko |
| GSE152734,GSE152735_1_v_0_pbrm1_human | 786o ntc cell line 786 (atcc crl1932) non targeting control cancer vs 786o ko source 786 (atcc crl1932) pbrm1 cancer cell line |
| GSE152734,GSE152735_2_v_0_pbrm1_human | hk2 source hk2(atcc crl 2190) normal kidney epithelial cell line vs 786o ko source 786 (atcc crl1932) pbrm1 cancer cell line |
| GSE211262,GSE211263_0_v_1_pbrm1_human | hap wild type untreated cell line hap1 myeloid leukemia cells pbrm1 wt vs hap pbrm1ko ifng cell line hap1 myeloid leukemia cells pbrm1 ko treated |
| GSE114690_2_v_3_tnfsf14_mouse | 3t3 l1 nc undiff adipose precusors stage undifferentiated /variation control cell line vs 3t3 l1 light diff adipose precusors stage differentiation beige adipocytes /variation (tnfsf14) overexpression cell line |
| GSE114690_1_v_0_tnfsf14_mouse | 3t3 l1 nc diff adipose precusors stage differentiation beige adipocytes /variation control cell line vs 3t3 l1 light undiff adipose precusors stage undifferentiated /variation (tnfsf14) overexpression cell line |
| GSE114690_1_v_3_tnfsf14_mouse | 3t3 l1 nc diff adipose precusors stage differentiation beige adipocytes /variation control cell line vs 3t3 l1 light diff adipose precusors stage differentiation beige adipocytes /variation (tnfsf14) overexpression cell line |
| GSE114690_2_v_0_tnfsf14_mouse | 3t3 l1 nc undiff adipose precusors stage undifferentiated /variation control cell line vs 3t3 l1 light undiff adipose precusors stage undifferentiated /variation (tnfsf14) overexpression cell line |
| GSE124410_2_v_0_stk40_mouse | bone marrow wt t0 untreated derived macrophages sample id primary time group rna vs bone marrow ko t16 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_3_v_4_stk40_mouse | bone marrow wt t32 lps derived macrophages sample id primary time group rna vs bone marrow ko t32 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_2_v_4_stk40_mouse | bone marrow wt t0 untreated derived macrophages sample id primary time group rna vs bone marrow ko t32 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_6_v_0_stk40_mouse | bone marrow ko t0 untreated derived macrophages sample id primary stk40 time group rna vs bone marrow ko t16 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_3_v_0_stk40_mouse | bone marrow wt t32 lps derived macrophages sample id primary time group rna vs bone marrow ko t16 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_1_v_4_stk40_mouse | bone marrow wt lps derived macrophages sample id primary time group rna vs bone marrow ko t32 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_2_v_5_stk40_mouse | bone marrow wt t0 untreated derived macrophages sample id primary time group rna vs bone marrow ko t6 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_3_v_5_stk40_mouse | bone marrow wt t32 lps derived macrophages sample id primary time group rna vs bone marrow ko t6 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_6_v_4_stk40_mouse | bone marrow ko t0 untreated derived macrophages sample id primary stk40 time group rna vs bone marrow ko t32 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_1_v_0_stk40_mouse | bone marrow wt lps derived macrophages sample id primary time group rna vs bone marrow ko t16 lps derived macrophages sample id primary stk40 time group rna |
| GSE124410_6_v_5_stk40_mouse | bone marrow ko t0 untreated derived macrophages sample id primary stk40 time group rna vs bone marrow ko t6 lps derived macrophages sample id primary stk40 time group rna |
| GSE214442_0_v_1_pak4_mouse | pak4 flox/flox fasted rep strain c57bl/6 liver age 8 weeks wt vs alb cre pak4 flox/flox fasted rep strain c57bl/6 liver age 8 weeks hepatocyte specific ko |
| GSE199081_0_v_1_insr_mouse | nc sirna 1 cell line hl control vs circ insr sirna 1 cell line hl circular rna knockdown |
| GSE188869,GSE188871_2_v_3_kat7_mouse | dmso treated replicate background mouse strain c57bl/6 wildtype thymic epithelial cells fetal organ cultures vs kat7 knockout replicate background mouse strain c57bl/6 tamoxifen thymic epithelial cells fetal organ cultures |
| GSE188870,GSE188871_4_v_5_kat7_mouse | mouse pool mtechi wildtype background strain c57bl/6 anatomical location medullary mhcii level high thymic epithelial cells vs mouse pool mteclo knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level low thymic epithelial cells |
| GSE188870,GSE188871_1_v_2_kat7_mouse | mouse pool ctec wildtype background strain c57bl/6 anatomical location cortical mhcii level na thymic epithelial cells vs mouse pool mtechi knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level high thymic epithelial cells |
| GSE188870,GSE188871_1_v_5_kat7_mouse | mouse pool ctec wildtype background strain c57bl/6 anatomical location cortical mhcii level na thymic epithelial cells vs mouse pool mteclo knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level low thymic epithelial cells |
| GSE188870,GSE188871_1_v_3_kat7_mouse | mouse pool ctec wildtype background strain c57bl/6 anatomical location cortical mhcii level na thymic epithelial cells vs mouse pool ctec knockout background strain c57bl/6 kat7 anatomical location cortical mhcii level na thymic epithelial cells |
| GSE133516_5_v_1_kat7_human | rna molm13 ctrl d3 cell line wildtype days knockout day3 human vs rna molm13 kat7ko d3 cell line days knockout day3 human |
| GSE133516_0_v_3_kat7_human | rna molm13 ctrl d5 cell line wildtype days knockout day5 human vs rna ociaml3 kat7ko cell line days knockout human |
| GSE133516_0_v_1_kat7_human | rna molm13 ctrl d5 cell line wildtype days knockout day5 human vs rna molm13 kat7ko d3 cell line days knockout day3 human |
| GSE133516_5_v_6_kat7_human | rna molm13 ctrl d3 cell line wildtype days knockout day3 human vs rna molm13 kat7ko d5 cell line days knockout day5 human |
| GSE188870,GSE188871_0_v_3_kat7_mouse | mouse pool mteclo wildtype background strain c57bl/6 anatomical location medullary mhcii level low thymic epithelial cells vs mouse pool ctec knockout background strain c57bl/6 kat7 anatomical location cortical mhcii level na thymic epithelial cells |
| GSE188869,GSE188871_1_v_3_kat7_mouse | wm 3825 treated replicate background mouse strain c57bl/6 wildtype 3835 thymic epithelial cells fetal organ cultures vs kat7 knockout replicate background mouse strain c57bl/6 tamoxifen thymic epithelial cells fetal organ cultures |
| GSE188870,GSE188871_0_v_5_kat7_mouse | mouse pool mteclo wildtype background strain c57bl/6 anatomical location medullary mhcii level low thymic epithelial cells vs mouse pool mteclo knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level low thymic epithelial cells |
| GSE188869,GSE188871_0_v_3_kat7_mouse | control replicate background mouse strain c57bl/6 tamoxifen thymic epithelial cells fetal organ cultures vs kat7 knockout replicate background mouse strain c57bl/6 tamoxifen thymic epithelial cells fetal organ cultures |
| GSE133516_0_v_6_kat7_human | rna molm13 ctrl d5 cell line wildtype days knockout day5 human vs rna molm13 kat7ko d5 cell line days knockout day5 human |
| GSE133516_5_v_3_kat7_human | rna molm13 ctrl d3 cell line wildtype days knockout day3 human vs rna ociaml3 kat7ko cell line days knockout human |
| GSE188870,GSE188871_4_v_2_kat7_mouse | mouse pool mtechi wildtype background strain c57bl/6 anatomical location medullary mhcii level high thymic epithelial cells vs mouse pool mtechi knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level high thymic epithelial cells |
| GSE133516_5_v_2_kat7_human | rna molm13 ctrl d3 cell line wildtype days knockout day3 human vs rna molm13 kat7aid cell line human |
| GSE133516_5_v_7_kat7_human | rna molm13 ctrl d3 cell line wildtype days knockout day3 human vs rna molm13 kat7aid cell line human |
| GSE133516_0_v_7_kat7_human | rna molm13 ctrl d5 cell line wildtype days knockout day5 human vs rna molm13 kat7aid cell line human |
| GSE188870,GSE188871_4_v_3_kat7_mouse | mouse pool mtechi wildtype background strain c57bl/6 anatomical location medullary mhcii level high thymic epithelial cells vs mouse pool ctec knockout background strain c57bl/6 kat7 anatomical location cortical mhcii level na thymic epithelial cells |
| GSE188870,GSE188871_0_v_2_kat7_mouse | mouse pool mteclo wildtype background strain c57bl/6 anatomical location medullary mhcii level low thymic epithelial cells vs mouse pool mtechi knockout background strain c57bl/6 kat7 anatomical location medullary mhcii level high thymic epithelial cells |
| GSE133516_0_v_2_kat7_human | rna molm13 ctrl d5 cell line wildtype days knockout day5 human vs rna molm13 kat7aid cell line human |
| GSE217541,GSE217543_3_v_2_tet1_human | hesc bulkrnaseq cell line ucla1 control vs hesc bulkrnaseq cell line ucla1 tet1 catalytic domain knockout |
| GSE178227_1_v_2_tet1_mouse | liver control rep strain c57bl/6 doxycycline wild type vs liver decitabine treated tet1 ko yap tg rep strain c57bl/6 doxycycline+decitabine / |
| GSE176389_0_v_1_tet1_mouse | rna seq tet1 embryonic stem cells strain v6.5 male mixed 129/c57bl/6 wild type mouse escs vs rna seq tet1 ko (replicate embryonic stem cells strain v6.5 male mixed 129/c57bl/6 knockout mouse escs |
| GSE217541,GSE217543_3_v_1_tet1_human | hesc bulkrnaseq cell line ucla1 control vs imelc bulkrnaseq cell line ucla1 tet1 catalytic domain knockout |
| GSE109545_0_v_1_tet1_mouse | tet1 wt rna seq cell line ts rs26 mouse trophoblast stem cells vs tet1 ko rna seq cell line ts rs26 mouse trophoblast stem cells / |
| GSE217541,GSE217543_0_v_1_tet1_human | imelc bulkrnaseq cell line ucla1 control vs imelc bulkrnaseq cell line ucla1 tet1 catalytic domain knockout |
| GSE217541,GSE217543_0_v_2_tet1_human | imelc bulkrnaseq cell line ucla1 control vs hesc bulkrnaseq cell line ucla1 tet1 catalytic domain knockout |
| GSE214828,GSE214845_0_v_1_tet1_mouse | wt7 (timecourse) mesc b6129s6f1 tet1<tm1koh> cell line wt vs ko1 day mesc b6129s6f1 tet1<tm1koh> cell line tet1 ko |
| GSE178227_1_v_0_tet1_mouse | liver control rep strain c57bl/6 doxycycline wild type vs liver tet1 ko yap tg rep strain c57bl/6 doxycycline / |
| GSE116580_0_v_1_smug1_human | hap1 smug1 wt cell line source near haploid derived male chronic myelogenous leukemia (cml) kbm 7 passage 14 vs hap1 smug1 ko cell line source near haploid derived male chronic myelogenous leukemia (cml) kbm 7 passage 14 |
| GSE233183,GSE233187_3_v_6_larp1_human | hela 11ht cells canonical mrna larp1 wt biol rep cell line cervical cancer vs hela 11ht cells canonical mrna larp1 ko .c.1 biol rep cell line cervical cancer |
| GSE233183,GSE233187_2_v_6_larp1_human | hela 11ht cells 5âx80²top mrna larp1 wt biol rep cell line cervical cancer vs hela 11ht cells canonical mrna larp1 ko .c.1 biol rep cell line cervical cancer |
| GSE233183,GSE233187_2_v_9_larp1_human | hela 11ht cells 5âx80²top mrna larp1 wt biol rep cell line cervical cancer vs hela 11ht cells 5âx80²top mrna larp1 ko .c.4 biol rep cell line cervical cancer |
| GSE233183,GSE233187_3_v_9_larp1_human | hela 11ht cells canonical mrna larp1 wt biol rep cell line cervical cancer vs hela 11ht cells 5âx80²top mrna larp1 ko .c.4 biol rep cell line cervical cancer |
| GSE230656_0_v_1_gsdmd_mouse | wt lung day post sars cov 2 vs gsdmd ko lung day post sars cov 2 |
| GSE144750_1_v_0_six1_mouse | control hc800 a8 1 nt pancreas strain mixed 129/b6 hnf4a status negative six1 six4 positive vs knockout hc800 a8 1 pancreas strain mixed 129/b6 hnf4a status negative six1 six4 |
| GSE193334_1_v_0_six1_mouse | wt strain c57bl/6 developmental stage e10.5 mouse embryo otic vesicle vs six1 ko strain c57bl/6 developmental stage e10.5 mouse embryo otic vesicle |
| GSE113385_0_v_1_six1_mouse | v ras fibroblast tumors control tumor vs six1 ras fibroblast tumors overexpression tumor |
| GSE144750_1_v_2_six1_mouse | control hc800 a8 1 nt pancreas strain mixed 129/b6 hnf4a status negative six1 six4 positive vs knockout hc800 a8 1 rep2 pancreas strain mixed 129/b6 hnf4a status negative six1 six4 |
| GSE207135_2_v_0_sod2_human | mcf7 overexpressing wt sod2 repetition cell line breast cancer cells overexpression vs mcf7 overexpressing nls sod2 repetition cell line breast cancer cells overexpression |
| GSE207135_1_v_0_sod2_human | mcf7 control repetition cell line breast cancer cells wt vs mcf7 overexpressing nls sod2 repetition cell line breast cancer cells overexpression |
| GSE163214_1_v_0_jazf1_human | rna seq hela kyoto cells treated control sirna pool replicate cell line cervix carcinoma vs rna seq hela kyoto cells treated jazf1 sirna pool replicate two cell line cervix carcinoma knockdown |
| GSE164494_1_v_2_rab22a_mouse | strain c57bl/6 abdominal aorta rab22 wt angiotensin ii group vs strain c57bl/6 abdominal aorta rab22a ko saline group |
| GSE164494_0_v_2_rab22a_mouse | strain c57bl/6 abdominal aorta rab22 wt saline group vs strain c57bl/6 abdominal aorta rab22a ko saline group |
| GSE134700_0_v_4_ythdf2_human | wt rnaseq time cell line hela antibody none wild type vs ko rnaseq time cell line hela antibody none ythdf2 |
| GSE217071_3_v_2_ythdf2_mouse | yc5 oe ctr 24h cell line gc1 spermatogonia cells ythdf2 ko time 24 h vs yc5 24h cell line gc1 spermatogonia cells ythdf2 ko time 24 h |
| GSE142019,GSE142021_10_v_3_ythdf2_mouse | young wt mouse rep b [young hsc id strain background c57bl/6 /variation wild type age haematopoietic stem cells (hscs) 100 hscs vs aged ko mouse rep [aged hsc id strain background c57bl/6 /variation ythdf2 age (1 year old) haematopoietic stem cells (hscs) 100 hscs |
| GSE104867_0_v_1_ythdf2_mouse | wt input seq nspcs strain c57bl/6 age e14.5 passage p1 wild type rip antibody none derived neural stem/progenitor cells vs ko input seq nspcs strain c57bl/6 age e14.5 passage p1 ythdf2 / rip antibody none derived neural stem/progenitor cells |
| GSE217071_3_v_0_ythdf2_mouse | yc5 oe ctr 24h cell line gc1 spermatogonia cells ythdf2 ko time 24 h vs yc5 oe setdb1 24h cell line gc1 spermatogonia cells ythdf2 kooe time 24 h |
| GSE107956,GSE107957_0_v_1_ythdf2_human | human ucb cd34+ wild type hspcs vs human ucb cd34+ ythdf2 kd hspcs knockdown |
| GSE217071_1_v_2_ythdf2_mouse | gc1 24h cell line spermatogonia cells wt time 24 h vs yc5 24h cell line gc1 spermatogonia cells ythdf2 ko time 24 h |
| GSE142019,GSE142021_1_v_3_ythdf2_mouse | young wt mouse rep [young hsc id strain background c57bl/6 /variation wild type age haematopoietic stem cells (hscs) 100 hscs vs aged ko mouse rep [aged hsc id strain background c57bl/6 /variation ythdf2 age (1 year old) haematopoietic stem cells (hscs) 100 hscs |
| GSE180185_4_v_5_setbp1_human | hesc derived neural progenitors differentiation days 21 wt progenitor cells vs hesc derived neural progenitors differentiation days 21 setbp1 ko progenitor cells |
| GSE180185_9_v_8_setbp1_human | hesc derived neural progenitors differentiation days 15 wt progenitor cells vs hesc derived neural progenitors differentiation days 15 setbp1 ko progenitor cells |
| GSE180185_4_v_10_setbp1_human | hesc derived neural progenitors differentiation days 21 wt progenitor cells vs hesc derived neurons differentiation days 34 setbp1 ko |
| GSE180185_7_v_1_setbp1_human | hesc derived neurons differentiation days 34 wt vs hesc derived neural progenitors differentiation days setbp1 ko progenitor cells |
| GSE180185_9_v_5_setbp1_human | hesc derived neural progenitors differentiation days 15 wt progenitor cells vs hesc derived neural progenitors differentiation days 21 setbp1 ko progenitor cells |
| GSE180185_7_v_5_setbp1_human | hesc derived neurons differentiation days 34 wt vs hesc derived neural progenitors differentiation days 21 setbp1 ko progenitor cells |
| GSE180185_9_v_1_setbp1_human | hesc derived neural progenitors differentiation days 15 wt progenitor cells vs hesc derived neural progenitors differentiation days setbp1 ko progenitor cells |
| GSE180185_4_v_1_setbp1_human | hesc derived neural progenitors differentiation days 21 wt progenitor cells vs hesc derived neural progenitors differentiation days setbp1 ko progenitor cells |
| GSE180185_9_v_10_setbp1_human | hesc derived neural progenitors differentiation days 15 wt progenitor cells vs hesc derived neurons differentiation days 34 setbp1 ko |
| GSE180185_4_v_8_setbp1_human | hesc derived neural progenitors differentiation days 21 wt progenitor cells vs hesc derived neural progenitors differentiation days 15 setbp1 ko progenitor cells |
| GSE180185_7_v_10_setbp1_human | hesc derived neurons differentiation days 34 wt vs hesc derived neurons differentiation days 34 setbp1 ko |
| GSE180185_7_v_8_setbp1_human | hesc derived neurons differentiation days 34 wt vs hesc derived neural progenitors differentiation days 15 setbp1 ko progenitor cells |
| GSE248045,GSE248046_0_v_2_runx1_mouse | d1 wt cell line c2c12 differentiation media vs d0 ko cell line c2c12 runx1ko growth media |
| GSE248045,GSE248046_0_v_5_runx1_mouse | d1 wt cell line c2c12 differentiation media vs d6 ko cell line c2c12 runx1ko differentiation media |
| GSE230263,GSE230265_6_v_1_runx1_human | kelly cells sh4 dmso replicate cell line human neuroblastoma vs kelly pdx cells runx1t1 ko replicate tumour cell line human neuroblastoma doxycycline food |
| GSE248045,GSE248046_6_v_2_runx1_mouse | d3 wt cell line c2c12 differentiation media vs d0 ko cell line c2c12 runx1ko growth media |
| GSE230263,GSE230265_0_v_1_runx1_human | kelly cells f1hutg shrna dmso replicate cell line human neuroblastoma (empty vector) vs kelly pdx cells runx1t1 ko replicate tumour cell line human neuroblastoma doxycycline food |
| GSE230263,GSE230265_5_v_1_runx1_human | kelly pdx cells control replicate tumour cell line human neuroblastoma wt food vs kelly pdx cells runx1t1 ko replicate tumour cell line human neuroblastoma doxycycline food |
| GSE248045,GSE248046_6_v_1_runx1_mouse | d3 wt cell line c2c12 differentiation media vs ko cell line c2c12 runx1ko differentiation media |
| GSE245778_1_v_0_runx1_human | es2 cells aso c cell line epithelial ovarian cancer control vs es2 cells aso it1 cell line epithelial ovarian cancer runx1 knockdown |
| GSE248045,GSE248046_0_v_1_runx1_mouse | d1 wt cell line c2c12 differentiation media vs ko cell line c2c12 runx1ko differentiation media |
| GSE144481,GSE144483_0_v_3_runx1_mouse | pmn control veh strain c57bl/6 facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) vs pmn runx1ko lps strain c57bl/6 runx1 ko facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) |
| GSE112174_5_v_7_runx1_mouse | mp.runx1 wt u2af1 poly (ic) (250 âµg/moue .p every day three doses) mx1 cre/wt internal id lineage scai ckit+ cells bone marrow vs mp.runx1 ko u2af1 poly (ic) (250 âµg/moue .p every day three doses) runx1f/f mx1 cre/wt internal id lineage scai ckit+ cells bone marrow |
| GSE144481,GSE144483_2_v_3_runx1_mouse | pmn control lps strain c57bl/6 facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) vs pmn runx1ko lps strain c57bl/6 runx1 ko facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) |
| GSE211241_1_v_0_runx1_mouse | runx1 control ov ovary 4.5m sf1 cre+/+ runx1+/f vs runx1 ko ov ovary 4.5m sf1 cre+/tg runx1f/ |
| GSE248045,GSE248046_4_v_2_runx1_mouse | d6 wt cell line c2c12 differentiation media vs d0 ko cell line c2c12 runx1ko growth media |
| GSE158100,GSE158101_1_v_0_runx1_mouse | wt control /variation c kit+ bone marrow cells vs runx1 ko /variation c kit+ bone marrow cells |
| GSE248045,GSE248046_4_v_1_runx1_mouse | d6 wt cell line c2c12 differentiation media vs ko cell line c2c12 runx1ko differentiation media |
| GSE144481,GSE144483_0_v_1_runx1_mouse | pmn control veh strain c57bl/6 facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) vs pmn runx1ko veh strain c57bl/6 runx1 ko facs cd11b+ siglec f f4/80 ly6g+ bone marrow neutrophils (pmn) |
| GSE230263,GSE230265_3_v_1_runx1_human | kelly cells shamb dmso replicate cell line human neuroblastoma vs kelly pdx cells runx1t1 ko replicate tumour cell line human neuroblastoma doxycycline food |
| GSE68958_0_v_2_runx1_mouse | wt strain/background c57bl/6 adult bone marrow age 12 16 weeks premege wild type pre megakaryocyte/erythroid progenitor vs ko strain/background c57bl/6 adult bone marrow age 12 16 weeks premege runx1c knockout pre megakaryocyte/erythroid progenitor |
| GSE248045,GSE248046_6_v_5_runx1_mouse | d3 wt cell line c2c12 differentiation media vs d6 ko cell line c2c12 runx1ko differentiation media |
| GSE217776,GSE217829_2_v_6_sgf29_human | u937 cells non targeting control sgf29 rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction vs u937 cells sgf29 knockout rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction |
| GSE217776,GSE217829_1_v_6_sgf29_human | molm13 cells non targeting control rep cell line monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction vs u937 cells sgf29 knockout rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction |
| GSE217776,GSE217829_2_v_0_sgf29_human | u937 cells non targeting control sgf29 rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction vs u937 cells mll knockout rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction |
| GSE217776,GSE217829_4_v_6_sgf29_human | u937 cells non targeting control rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction vs u937 cells sgf29 knockout rep cell line u 937 monocytes disease acute myeloid leukemia crispr sgrna lentiviral transduction |
| GSE224742_0_v_1_slc1a5_human | t98g cells shcontrol null cell line control vs t98g cells shslc1a5 null cell line slc1a5 knockdown |
| GSE85565_1_v_0_tcf21_human | bk human coronary artery smooth muscle cells (hcasmc) /variation control biological replicate vs bk human coronary artery smooth muscle cells (hcasmc) /variation tcf21 overexpression biological replicate |
| GSE44461_1_v_0_tcf21_human | non silencing control sirna technical replicate vitro cultured primary coronary artery smooth muscle cells transfection vs tcf21 knockdown sirna technical replicate vitro cultured primary coronary artery smooth muscle cells transfection |
| GSE238116_1_v_0_egr1_human | mhcc97h cells parental biol rep cell line hepatocellular carcinoma wt vs plc/prf5 cells egr1 overexpression biol rep cell line hepatocellular carcinoma |
| GSE238116_1_v_2_egr1_human | mhcc97h cells parental biol rep cell line hepatocellular carcinoma wt vs mhcc97h cells egr1 knockout biol rep cell line hepatocellular carcinoma |
| GSE238116_3_v_2_egr1_human | plc/prf5 cells control biol rep cell line hepatocellular carcinoma wt vs mhcc97h cells egr1 knockout biol rep cell line hepatocellular carcinoma |
| GSE238116_3_v_0_egr1_human | plc/prf5 cells control biol rep cell line hepatocellular carcinoma wt vs plc/prf5 cells egr1 overexpression biol rep cell line hepatocellular carcinoma |
| GSE166294_0_v_1_etv5_mouse | macrophage raw264.7 sh nc strain c57bl/6 cell line established abelson murine leukemia virus induced tumor age post natal day 21 control vs macrophage raw264.7 sh etv5 strain c57bl/6 cell line established abelson murine leukemia virus induced tumor age post natal day 21 knockdown |
| GSE121009,GSE121014_0_v_1_prdm16_mouse | control duodenal crypts vs prdm16 ko duodenal crypts 3 days |
| GSE142684_0_v_1_prdm16_mouse | e17 wildtype strain c57bl/6 developmental stage embryonic day 17.5 ventricular zone cortical vs e13 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 13.5 ventricular zone cortical |
| GSE142684_3_v_1_prdm16_mouse | e15 wildtype strain c57bl/6 developmental stage embryonic day 15.5 ventricular zone cortical vs e13 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 13.5 ventricular zone cortical |
| GSE112860_0_v_1_prdm16_mouse | sorted hscs prdm16wt adultbm replicate /variation wild type group 2 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+fprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either f group moribund mice |
| GSE142684_3_v_6_prdm16_mouse | e15 wildtype strain c57bl/6 developmental stage embryonic day 15.5 ventricular zone cortical vs e17 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 17.5 ventricular zone cortical |
| GSE112860_0_v_4_prdm16_mouse | sorted hscs prdm16wt adultbm replicate /variation wild type group 2 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+sprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either group moribund mice |
| GSE111660_4_v_5_prdm16_mouse | wt pax6+ cells replicate embryonic cerebral cortex radial glia prdm16 flox/flox developmental stage e15.5 vs ko pax6+ cells replicate embryonic cerebral cortex radial glia emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE142684_0_v_7_prdm16_mouse | e17 wildtype strain c57bl/6 developmental stage embryonic day 17.5 ventricular zone cortical vs e15 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 15.5 ventricular zone cortical |
| GSE196699_2_v_3_prdm16_mouse | wt+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna vehicle adipocytes vs prdm16 ko+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna 3' 5' cyclic amp adipocytes |
| GSE142684_4_v_7_prdm16_mouse | e13 wildtype strain c57bl/6 developmental stage embryonic day 13.5 ventricular zone cortical vs e15 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 15.5 ventricular zone cortical |
| GSE196699_7_v_3_prdm16_mouse | wt+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna 3' 5' cyclic amp adipocytes |
| GSE196699_2_v_5_prdm16_mouse | wt+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna vehicle adipocytes vs prdm16 ko+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna vehicle adipocytes |
| GSE196699_0_v_1_prdm16_mouse | wt+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation appbp2 shrna vehicle adipocytes vs prdm16 ko+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna 3' 5' cyclic amp adipocytes |
| GSE112860_3_v_2_prdm16_mouse | ex vivo af9 cells wt prdm16+ev replicate 1 leukemic mll /variation wild type group moribund mice vs sorted hscs prdm16ko fetal liver replicate /variation prdm16 ko group 3 isolated (lin ckit+sca1+cd48 ) |
| GSE112860_3_v_1_prdm16_mouse | ex vivo af9 cells wt prdm16+ev replicate 1 leukemic mll /variation wild type group moribund mice vs ex vivo af9 cells ko prdm16+fprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either f group moribund mice |
| GSE112860_5_v_1_prdm16_mouse | sorted hscs prdm16wt fetal liver replicate /variation wild type group 3 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+fprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either f group moribund mice |
| GSE112860_0_v_8_prdm16_mouse | sorted hscs prdm16wt adultbm replicate /variation wild type group 2 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+ev replicate 1 leukemic mll /variation prdm16 group moribund mice |
| GSE142684_2_v_5_prdm16_mouse | e11 wildtype strain c57bl/6 developmental stage embryonic day 11.5 ventricular zone cortical vs e11 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 11.5 ventricular zone cortical |
| GSE159728,GSE159730_0_v_1_prdm16_mouse | wt mge replicate mouse line nkx2.1 cre prdm16+/+ ai14 developmental stage e14 medial ganglionic eminence embryonic brains vs ko mge replicate mouse line nkx2.1 cre prdm16fl/fl ai14 developmental stage e14 medial ganglionic eminence embryonic brains |
| GSE112860_5_v_4_prdm16_mouse | sorted hscs prdm16wt fetal liver replicate /variation wild type group 3 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+sprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either group moribund mice |
| GSE112860_5_v_7_prdm16_mouse | sorted hscs prdm16wt fetal liver replicate /variation wild type group 3 isolated (lin ckit+sca1+cd48 ) vs sorted hscs 47bpko fprdm16ko sprdm16only fetal liver replicate /variation prdm16 ko murine (expressing ) group 4 isolated (lin ckit+sca1+cd48 |
| GSE112860_3_v_7_prdm16_mouse | ex vivo af9 cells wt prdm16+ev replicate 1 leukemic mll /variation wild type group moribund mice vs sorted hscs 47bpko fprdm16ko sprdm16only fetal liver replicate /variation prdm16 ko murine (expressing ) group 4 isolated (lin ckit+sca1+cd48 |
| GSE112860_3_v_6_prdm16_mouse | ex vivo af9 cells wt prdm16+ev replicate 1 leukemic mll /variation wild type group moribund mice vs sorted hscs prdm16ko adultbm replicate /variation prdm16 ko group 2 isolated (lin ckit+sca1+cd48 ) |
| GSE142684_2_v_1_prdm16_mouse | e11 wildtype strain c57bl/6 developmental stage embryonic day 11.5 ventricular zone cortical vs e13 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 13.5 ventricular zone cortical |
| GSE196699_7_v_6_prdm16_mouse | wt+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna vehicle adipocytes |
| GSE112860_5_v_8_prdm16_mouse | sorted hscs prdm16wt fetal liver replicate /variation wild type group 3 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+ev replicate 1 leukemic mll /variation prdm16 group moribund mice |
| GSE142684_3_v_5_prdm16_mouse | e15 wildtype strain c57bl/6 developmental stage embryonic day 15.5 ventricular zone cortical vs e11 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 11.5 ventricular zone cortical |
| GSE196699_7_v_1_prdm16_mouse | wt+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna 3' 5' cyclic amp adipocytes |
| GSE196699_2_v_6_prdm16_mouse | wt+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna vehicle adipocytes vs prdm16 ko+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna vehicle adipocytes |
| GSE111660_2_v_3_prdm16_mouse | wt tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell prdm16 flox/flox developmental stage e15.5 vs ko tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE196699_2_v_1_prdm16_mouse | wt+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna vehicle adipocytes vs prdm16 ko+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna 3' 5' cyclic amp adipocytes |
| GSE112860_0_v_7_prdm16_mouse | sorted hscs prdm16wt adultbm replicate /variation wild type group 2 isolated (lin ckit+sca1+cd48 ) vs sorted hscs 47bpko fprdm16ko sprdm16only fetal liver replicate /variation prdm16 ko murine (expressing ) group 4 isolated (lin ckit+sca1+cd48 |
| GSE142684_2_v_7_prdm16_mouse | e11 wildtype strain c57bl/6 developmental stage embryonic day 11.5 ventricular zone cortical vs e15 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 15.5 ventricular zone cortical |
| GSE111660_4_v_6_prdm16_mouse | wt pax6+ cells replicate embryonic cerebral cortex radial glia prdm16 flox/flox developmental stage e15.5 vs ko pax6 tbr2 cells replicate embryonic cerebral cortex cortical neurons emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE142684_0_v_6_prdm16_mouse | e17 wildtype strain c57bl/6 developmental stage embryonic day 17.5 ventricular zone cortical vs e17 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 17.5 ventricular zone cortical |
| GSE142684_4_v_1_prdm16_mouse | e13 wildtype strain c57bl/6 developmental stage embryonic day 13.5 ventricular zone cortical vs e13 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 13.5 ventricular zone cortical |
| GSE142684_2_v_6_prdm16_mouse | e11 wildtype strain c57bl/6 developmental stage embryonic day 11.5 ventricular zone cortical vs e17 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 17.5 ventricular zone cortical |
| GSE111660_4_v_3_prdm16_mouse | wt pax6+ cells replicate embryonic cerebral cortex radial glia prdm16 flox/flox developmental stage e15.5 vs ko tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE112860_5_v_6_prdm16_mouse | sorted hscs prdm16wt fetal liver replicate /variation wild type group 3 isolated (lin ckit+sca1+cd48 ) vs sorted hscs prdm16ko adultbm replicate /variation prdm16 ko group 2 isolated (lin ckit+sca1+cd48 ) |
| GSE142684_4_v_6_prdm16_mouse | e13 wildtype strain c57bl/6 developmental stage embryonic day 13.5 ventricular zone cortical vs e17 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 17.5 ventricular zone cortical |
| GSE111660_1_v_3_prdm16_mouse | wt pax6 tbr2 cells replicate embryonic cerebral cortex cortical neurons prdm16 flox/flox developmental stage e15.5 vs ko tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE121014,GSE137888_0_v_1_prdm16_mouse | villi control /variation prdm16loxp/loxp vs villi prdm16 ko /variation rosa26creert2 prdm16loxp/loxp 3 days |
| GSE142684_0_v_5_prdm16_mouse | e17 wildtype strain c57bl/6 developmental stage embryonic day 17.5 ventricular zone cortical vs e11 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 11.5 ventricular zone cortical |
| GSE112860_9_v_6_prdm16_mouse | sorted hscs 47bpwt fprdm16wt fetal liver replicate /variation wild type group 4 isolated (lin ckit+sca1+cd48 ) vs sorted hscs prdm16ko adultbm replicate /variation prdm16 ko group 2 isolated (lin ckit+sca1+cd48 ) |
| GSE111660_1_v_5_prdm16_mouse | wt pax6 tbr2 cells replicate embryonic cerebral cortex cortical neurons prdm16 flox/flox developmental stage e15.5 vs ko pax6+ cells replicate embryonic cerebral cortex radial glia emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE196699_4_v_3_prdm16_mouse | wt+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation appbp2 shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna 3' 5' cyclic amp adipocytes |
| GSE196699_7_v_5_prdm16_mouse | wt+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation scramble shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shscr+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna vehicle adipocytes |
| GSE142684_3_v_7_prdm16_mouse | e15 wildtype strain c57bl/6 developmental stage embryonic day 15.5 ventricular zone cortical vs e15 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 15.5 ventricular zone cortical |
| GSE111660_2_v_5_prdm16_mouse | wt tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell prdm16 flox/flox developmental stage e15.5 vs ko pax6+ cells replicate embryonic cerebral cortex radial glia emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE112860_9_v_8_prdm16_mouse | sorted hscs 47bpwt fprdm16wt fetal liver replicate /variation wild type group 4 isolated (lin ckit+sca1+cd48 ) vs ex vivo af9 cells ko prdm16+ev replicate 1 leukemic mll /variation prdm16 group moribund mice |
| GSE142684_4_v_5_prdm16_mouse | e13 wildtype strain c57bl/6 developmental stage embryonic day 13.5 ventricular zone cortical vs e11 prdm16cko strain c57bl/6 prdm16 conditional knockout developmental stage embryonic day 11.5 ventricular zone cortical |
| GSE111660_2_v_6_prdm16_mouse | wt tbr2+ cells replicate embryonic cerebral cortex intermediate progenitor cell prdm16 flox/flox developmental stage e15.5 vs ko pax6 tbr2 cells replicate embryonic cerebral cortex cortical neurons emx1ires cre prdm16flox/flox developmental stage e15.5 |
| GSE196699_4_v_6_prdm16_mouse | wt+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation appbp2 shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna vehicle adipocytes |
| GSE196699_0_v_6_prdm16_mouse | wt+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation appbp2 shrna vehicle adipocytes vs prdm16 ko+shappbp2+vehicle inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation appbp2 shrna vehicle adipocytes |
| GSE112860_3_v_4_prdm16_mouse | ex vivo af9 cells wt prdm16+ev replicate 1 leukemic mll /variation wild type group moribund mice vs ex vivo af9 cells ko prdm16+sprdm16 replicate 1 leukemic mll /variation prdm16 overexpressing either group moribund mice |
| GSE112860_9_v_2_prdm16_mouse | sorted hscs 47bpwt fprdm16wt fetal liver replicate /variation wild type group 4 isolated (lin ckit+sca1+cd48 ) vs sorted hscs prdm16ko fetal liver replicate /variation prdm16 ko group 3 isolated (lin ckit+sca1+cd48 ) |
| GSE112860_0_v_2_prdm16_mouse | sorted hscs prdm16wt adultbm replicate /variation wild type group 2 isolated (lin ckit+sca1+cd48 ) vs sorted hscs prdm16ko fetal liver replicate /variation prdm16 ko group 3 isolated (lin ckit+sca1+cd48 ) |
| GSE196699_4_v_1_prdm16_mouse | wt+shappbp2+camp inguinal white adipoctyes mrna rep. strain c57bl/6 wild type perturbation appbp2 shrna 3' 5' cyclic amp adipocytes vs prdm16 ko+shscr+camp inguinal white adipoctyes mrna rep. strain c57bl/6 knockout perturbation scramble shrna 3' 5' cyclic amp adipocytes |
| GSE158815_1_v_3_trib1_mouse | wt sample 1 strain c57bl/6 wild type age 20 21 weeks old sex male aav cre 4 cohort liver vs trib1 ko sample strain c57bl/6 flox/flox age 20 21 weeks old sex male aav cre 4 cohort liver |
| GSE158815_5_v_0_trib1_mouse | wt sample strain c57bl/6 wild type age 20 21 weeks old sex male aav cre 4 cohort 2 liver vs trib1 cebpa ko (dko) sample strain c57bl/6 flox/flox age 20 21 weeks old sex male aav cre 4 cohort liver |
| GSE158815_1_v_0_trib1_mouse | wt sample 1 strain c57bl/6 wild type age 20 21 weeks old sex male aav cre 4 cohort liver vs trib1 cebpa ko (dko) sample strain c57bl/6 flox/flox age 20 21 weeks old sex male aav cre 4 cohort liver |
| GSE158815_5_v_3_trib1_mouse | wt sample strain c57bl/6 wild type age 20 21 weeks old sex male aav cre 4 cohort 2 liver vs trib1 ko sample strain c57bl/6 flox/flox age 20 21 weeks old sex male aav cre 4 cohort liver |
| GSE157684,GSE173391_0_v_1_rgcc_human | sjtubio xh9 (wt) rnaseq gene aberrations n/ days culture 45 cerebral organoid human induced pluripotent stem cells vs sjtubio x23 (rgcc ko) rnaseq gene aberrations rgcc knockout days culture 45 cerebral organoid human induced pluripotent stem cells |
| GSE173307,GSE173391_0_v_1_rgcc_human | h9 (wt) rnaseq gene aberrations n/ days culture 12 2d nscs human induced pluripotent stem cells vs ko (rgcc ko) rnaseq gene aberrations rgcc knockout days culture 12 2d nscs human induced pluripotent stem cells |
| GSE179868,GSE180330_1_v_2_ddx21_human | huvec control sample untreated abbreviatedname vs huvec ddx21 sirna 01 sample construct knockdown (1) abbreviatedname |
| GSE179868,GSE180330_1_v_0_ddx21_human | huvec control sample untreated abbreviatedname vs huvec ddx21 sirna 02 sample construct knockdown (2) abbreviatedname |
| GSE234155_7_v_1_nfix_human | cb rnaseq blood erythroblast wt vs nfix rnaseq blood erythroblast knockdown |
| GSE177041_2_v_1_fabp3_mouse | wt tac strain c57bl/6 heart vs ko sham fabp3 null strain c57bl/6 heart |
| GSE177041_0_v_1_fabp3_mouse | wt sham strain c57bl/6 heart vs ko sham fabp3 null strain c57bl/6 heart |
| GSE223378_1_v_0_tead3_human | nc cell line u251 glioma normal control cells vs tead3 kd cell line u251 glioma knockdown cells |
| GSE160304,GSE163392_0_v_3_zswim8_human | mrna mef control grna rep cell line/type immortalized mouse embryonic fibroblasts (mef) /variation transduced cas9 non targeting vs mrna k562i zswim8 knockdown grna cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced (crispri) |
| GSE160304,GSE163392_4_v_3_zswim8_human | mrna bjab ev control grna cell line/type /variation transduced cas9 non targeting vs mrna k562i zswim8 knockdown grna cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced (crispri) |
| GSE160304,GSE163392_1_v_3_zswim8_human | mrna k562i control knockdown cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced grna non targeting vs mrna k562i zswim8 knockdown grna cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced (crispri) |
| GSE160304,GSE163392_7_v_3_zswim8_human | mrna hela control grna cell line/type /variation transduced cas9 non targeting vs mrna k562i zswim8 knockdown grna cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced (crispri) |
| GSE160304,GSE163392_2_v_3_zswim8_human | mrna a549 control grna cell line/type /variation transduced cas9 non targeting vs mrna k562i zswim8 knockdown grna cell line/type k562 /variation expressing inducible krab dcas9 (k562i) transduced (crispri) |
| GSE195559_8_v_4_notch1_human | wt cm d30 cell line cardiomyocyte day 30 wild type induced pluripotent stem vs notch1 ko ec d30 cell line endothelial day 30 / induced pluripotent stem |
| GSE195559_0_v_7_notch1_human | wt ec d30 cell line endothelial day 30 wild type induced pluripotent stem vs notch1 ko cm d13 cell line cardiomyocyte day 13 / induced pluripotent stem |
| GSE195559_0_v_1_notch1_human | wt ec d30 cell line endothelial day 30 wild type induced pluripotent stem vs notch1 ko cm d20 cell line cardiomyocyte day 20 / induced pluripotent stem |
| GSE195559_2_v_9_notch1_human | wt cm d20 cell line cardiomyocyte day 20 wild type induced pluripotent stem vs notch1 ko cm d30 cell line cardiomyocyte day 30 / induced pluripotent stem |
| GSE195559_6_v_5_notch1_human | wt cm d13 cell line cardiomyocyte day 13 wild type induced pluripotent stem vs notch1 ko cm drug d20 cell line cardiomyocyte day 20 / chir99021 induced pluripotent stem |
| GSE195559_6_v_9_notch1_human | wt cm d13 cell line cardiomyocyte day 13 wild type induced pluripotent stem vs notch1 ko cm d30 cell line cardiomyocyte day 30 / induced pluripotent stem |
| GSE195559_3_v_1_notch1_human | wt cm drug d20 cell line cardiomyocyte day 20 wild type chir99021 induced pluripotent stem vs notch1 ko cm d20 cell line cardiomyocyte day 20 / induced pluripotent stem |
| GSE195559_3_v_4_notch1_human | wt cm drug d20 cell line cardiomyocyte day 20 wild type chir99021 induced pluripotent stem vs notch1 ko ec d30 cell line endothelial day 30 / induced pluripotent stem |
| GSE195559_2_v_5_notch1_human | wt cm d20 cell line cardiomyocyte day 20 wild type induced pluripotent stem vs notch1 ko cm drug d20 cell line cardiomyocyte day 20 / chir99021 induced pluripotent stem |
| GSE195559_2_v_7_notch1_human | wt cm d20 cell line cardiomyocyte day 20 wild type induced pluripotent stem vs notch1 ko cm d13 cell line cardiomyocyte day 13 / induced pluripotent stem |
| GSE195559_8_v_5_notch1_human | wt cm d30 cell line cardiomyocyte day 30 wild type induced pluripotent stem vs notch1 ko cm drug d20 cell line cardiomyocyte day 20 / chir99021 induced pluripotent stem |
| GSE195559_0_v_5_notch1_human | wt ec d30 cell line endothelial day 30 wild type induced pluripotent stem vs notch1 ko cm drug d20 cell line cardiomyocyte day 20 / chir99021 induced pluripotent stem |
| GSE195559_8_v_9_notch1_human | wt cm d30 cell line cardiomyocyte day 30 wild type induced pluripotent stem vs notch1 ko cm d30 cell line cardiomyocyte day 30 / induced pluripotent stem |
| GSE195559_3_v_5_notch1_human | wt cm drug d20 cell line cardiomyocyte day 20 wild type chir99021 induced pluripotent stem vs notch1 ko cm drug d20 cell line cardiomyocyte day 20 / chir99021 induced pluripotent stem |
| GSE195559_6_v_1_notch1_human | wt cm d13 cell line cardiomyocyte day 13 wild type induced pluripotent stem vs notch1 ko cm d20 cell line cardiomyocyte day 20 / induced pluripotent stem |
| GSE195559_6_v_4_notch1_human | wt cm d13 cell line cardiomyocyte day 13 wild type induced pluripotent stem vs notch1 ko ec d30 cell line endothelial day 30 / induced pluripotent stem |
| GSE195559_2_v_4_notch1_human | wt cm d20 cell line cardiomyocyte day 20 wild type induced pluripotent stem vs notch1 ko ec d30 cell line endothelial day 30 / induced pluripotent stem |
| GSE195559_8_v_7_notch1_human | wt cm d30 cell line cardiomyocyte day 30 wild type induced pluripotent stem vs notch1 ko cm d13 cell line cardiomyocyte day 13 / induced pluripotent stem |
| GSE195559_0_v_9_notch1_human | wt ec d30 cell line endothelial day 30 wild type induced pluripotent stem vs notch1 ko cm d30 cell line cardiomyocyte day 30 / induced pluripotent stem |
| GSE195559_8_v_1_notch1_human | wt cm d30 cell line cardiomyocyte day 30 wild type induced pluripotent stem vs notch1 ko cm d20 cell line cardiomyocyte day 20 / induced pluripotent stem |
| GSE195559_6_v_7_notch1_human | wt cm d13 cell line cardiomyocyte day 13 wild type induced pluripotent stem vs notch1 ko cm d13 cell line cardiomyocyte day 13 / induced pluripotent stem |
| GSE195559_3_v_7_notch1_human | wt cm drug d20 cell line cardiomyocyte day 20 wild type chir99021 induced pluripotent stem vs notch1 ko cm d13 cell line cardiomyocyte day 13 / induced pluripotent stem |
| GSE195559_3_v_9_notch1_human | wt cm drug d20 cell line cardiomyocyte day 20 wild type chir99021 induced pluripotent stem vs notch1 ko cm d30 cell line cardiomyocyte day 30 / induced pluripotent stem |
| GSE195559_0_v_4_notch1_human | wt ec d30 cell line endothelial day 30 wild type induced pluripotent stem vs notch1 ko ec d30 cell line endothelial day 30 / induced pluripotent stem |
| GSE80537_7_v_2_adhfe1_human | cell line mcf12a mammary epithelial cells untreated vs cell line mcf12a mammary epithelial cells adhfe1 overexpression |
| GSE80537_0_v_2_adhfe1_human | cell line mcf12a mammary epithelial cells 1mm control compound vs cell line mcf12a mammary epithelial cells adhfe1 overexpression |
| GSE80537_3_v_2_adhfe1_human | cell line mcf7 breast cancer cells untreated vs cell line mcf12a mammary epithelial cells adhfe1 overexpression |
| GSE80537_5_v_2_adhfe1_human | cell line mcf12a mammary epithelial cells control empty vector expression vs cell line mcf12a mammary epithelial cells adhfe1 overexpression |
| GSE221004_1_v_2_prdm6_mouse | prdm6 wt ao ascending aorta prdm6wt/f vs prdm6 ko ao ascending aorta wnt1cre prdm6f/f |
| GSE221004_3_v_2_prdm6_mouse | prdm6 wt da ductus arteriosus vs prdm6 ko ao ascending aorta wnt1cre prdm6f/f |
| GSE221004_3_v_0_prdm6_mouse | prdm6 wt da ductus arteriosus vs prdm6 ko da ductus arteriosus wnt1cre prdm6f/f |
| GSE221004_1_v_0_prdm6_mouse | prdm6 wt ao ascending aorta prdm6wt/f vs prdm6 ko da ductus arteriosus wnt1cre prdm6f/f |
| GSE195588,GSE195590_1_v_0_prdm6_mouse | ductus arteriosus strain c57bl/6 age e17.5 wild type wt vs ductus arteriosus strain c57bl/6 age e17.5 prdm6f/f sm22 cre ko |
| GSE125219,GSE125221_3_v_0_arid1a_human | hap1 rna seq arid1a control library cell line replicate knockout knockdown drug vs hap1 rna seq arid1a dchaf1a library cell line replicate knockout degradation chaf1a drug dtag |
| GSE180468_3_v_0_arid1a_human | arid1a wt cells tunicamycin replicate tm rmg1 cell line vs arid1a ko cells tunicamycin replicate tm rmg1 cell line |
| GSE106661,GSE106665_2_v_3_arid1a_human | arid1a wt fbs endometrial epithelial cells complete growth media (15% fbs) vs arid1a ko starved endometrial epithelial cells serum (0% fbs 24h) |
| GSE125219,GSE125221_4_v_8_arid1a_human | hap1 rna seq wt dchaf1a library cell line replicate knockout degradation chaf1a drug dtag vs hap1 rna seq arid1a shchaf1a library cell line replicate knockout knockdown chaf1a drug |
| GSE246911,GSE246913_4_v_0_arid1a_mouse | cg1 ctrl 40lb stim hematopoietic cell line b cells ex vivo activated cre + il4 vs arid1a ko hematopoietic cell line b cells naive cd19 none |
| GSE160442,GSE160444_4_v_0_arid1a_human | noninduce arid1a ko clone2 normal culture hpne vs kras arid1a ko doxycycline (6âµg/ml 5 days) hpne |
| GSE125219,GSE125221_4_v_0_arid1a_human | hap1 rna seq wt dchaf1a library cell line replicate knockout degradation chaf1a drug dtag vs hap1 rna seq arid1a dchaf1a library cell line replicate knockout degradation chaf1a drug dtag |
| GSE124694_0_v_1_arid1a_mouse | rnaseq wt strain c57/b6 129 mix liver age postnatal day 90 /variation arid1a fl/fl frozen vs rnaseq ko strain c57/b6 129 mix liver age postnatal day 90 /variation arid1a fl/fl alb cre frozen |
| GSE106661,GSE106665_0_v_3_arid1a_human | arid1a wt starved endometrial epithelial cells serum (0% fbs 24h) vs arid1a ko starved endometrial epithelial cells serum (0% fbs 24h) |
| GSE125219,GSE125221_5_v_2_arid1a_human | hap1 rna seq wt shchaf1a library cell line replicate knockout knockdown chaf1a drug vs hap1 rna seq arid1a testosterone library cell line replicate knockout drug |
| GSE121198,GSE129779_0_v_2_arid1a_human | rna cell line 12z endometriotic epithelial cells condition control vs rna cell line 12z endometriotic epithelial cells condition siarid1a knockdown |
| GSE121198,GSE129782_1_v_0_arid1a_human | rna cell line 12z endometriotic epithelial cells condition non targeting sirna control vs rna cell line 12z endometriotic epithelial cells condition siarid1a knockdown |
| GSE160442,GSE160444_3_v_0_arid1a_human | kras wt wild type doxycycline (6âµg/ml 5 days) hpne vs kras arid1a ko doxycycline (6âµg/ml 5 days) hpne |
| GSE246911,GSE246913_4_v_1_arid1a_mouse | cg1 ctrl 40lb stim hematopoietic cell line b cells ex vivo activated cre + il4 vs cg1 ko 40lb stim hematopoietic cell line b cells ex vivo activated arid1a + il4 |
| GSE121198,GSE129779_3_v_2_arid1a_human | rna cell line 12z endometriotic epithelial cells condition pik3ca*h1047r control vs rna cell line 12z endometriotic epithelial cells condition siarid1a knockdown |
| GSE152050,GSE152052_1_v_0_arid1a_mouse | ab17gfp rna strain c57bl/6 cells infected adenoviral empty vector ad gfp control. arid1afl/fl wt ab17 immortalized primary hepatocytes . vs ab17cre rna strain c57bl/6 cells infected adenoviral vector expressing cre recombinase (ad cre) knock arid1a. arid1a / ko ab17 immortalized primary hepatocytes arid1afl/fl . |
| GSE160442,GSE160444_1_v_0_arid1a_human | noninduce arid1a ko clone11 normal culture hpne vs kras arid1a ko doxycycline (6âµg/ml 5 days) hpne |
| GSE125219,GSE125221_5_v_8_arid1a_human | hap1 rna seq wt shchaf1a library cell line replicate knockout knockdown chaf1a drug vs hap1 rna seq arid1a shchaf1a library cell line replicate knockout knockdown chaf1a drug |
| GSE131673_0_v_1_arid1a_mouse | rna seq arid control strain/background c57bl/6 (cd45.2) /variation wt thymic dn3 cell progenitor thymus vs rna seq arid cre dn3 strain/background c57bl/6 (cd45.2) /variation arid1a ko thymic cell progenitor thymus |
| GSE121198,GSE129779_0_v_1_arid1a_human | rna cell line 12z endometriotic epithelial cells condition control vs rna cell line 12z endometriotic epithelial cells condition siarid1a/pik3ca*h1047r siarid1a knockdown |
| GSE227634,GSE228381_0_v_7_arid1a_mouse | d5 wt p14 cd8+ time day 5 infection lcmv armstrong cells vs d8 ko eec arid1a p14 cd8+ time day 8 infection lcmv armstrong cells |
| GSE227634,GSE228381_0_v_5_arid1a_mouse | d5 wt p14 cd8+ time day 5 infection lcmv armstrong cells vs d3 ko arid1a p14 cd8+ time day 3 infection lcmv armstrong cells |
| GSE197686,GSE197688_2_v_0_arid1a_mouse | ctrl prostate epithelium ptenpc / strain c57bl/6 age 3 month old vs ko prostate epithelium ptenpc / arid1apc strain c57bl/6 age 3 month old |
| GSE180468_2_v_0_arid1a_human | arid1a ko cells control condition replicate ctr rmg1 cell line vs arid1a ko cells tunicamycin replicate tm rmg1 cell line |
| GSE111501,GSE111502_0_v_1_arid1a_mouse | wt ddc rna seq strain background c57bl/6 129sv /variation wild type liver age postnatal 10 weeks vs arid1a ko ddc rna seq strain background c57bl/6 129sv /variation hepatocyte specific liver age postnatal 10 weeks |
| GSE125219,GSE125221_3_v_8_arid1a_human | hap1 rna seq arid1a control library cell line replicate knockout knockdown drug vs hap1 rna seq arid1a shchaf1a library cell line replicate knockout knockdown chaf1a drug |
| GSE125219,GSE125221_3_v_2_arid1a_human | hap1 rna seq arid1a control library cell line replicate knockout knockdown drug vs hap1 rna seq arid1a testosterone library cell line replicate knockout drug |
| GSE125219,GSE125221_4_v_2_arid1a_human | hap1 rna seq wt dchaf1a library cell line replicate knockout degradation chaf1a drug dtag vs hap1 rna seq arid1a testosterone library cell line replicate knockout drug |
| GSE147283_1_v_3_arid1a_human | shnc cell line ishikawa cells endometrial cancer control vs shard cell line ishikawa cells endometrial cancer arid1a knockdown sharid1a |
| GSE121198,GSE129779_3_v_1_arid1a_human | rna cell line 12z endometriotic epithelial cells condition pik3ca*h1047r control vs rna cell line 12z endometriotic epithelial cells condition siarid1a/pik3ca*h1047r siarid1a knockdown |
| GSE125219,GSE125221_5_v_0_arid1a_human | hap1 rna seq wt shchaf1a library cell line replicate knockout knockdown chaf1a drug vs hap1 rna seq arid1a dchaf1a library cell line replicate knockout degradation chaf1a drug dtag |
| GSE180468_1_v_0_arid1a_human | arid1a wt cells control condition replicate ctr rmg1 cell line vs arid1a ko cells tunicamycin replicate tm rmg1 cell line |
| GSE227634,GSE228381_0_v_1_arid1a_mouse | d5 wt p14 cd8+ time day 5 infection lcmv armstrong cells vs d8 ko arid1a p14 cd8+ time day 8 infection lcmv armstrong cells |
| GSE193826_1_v_0_adora1_mouse | wt strain c57bl/6 hippocampus age 3 month old wild type vs ako strain c57bl/6 hippocampus age 3 month old adora1 knockout |
| GSE181865_0_v_1_zbtb46_mouse | sample (wild type) sorted ilc3s wt strain c57bl/6 vs sample (zbtb46 ko) sorted ilc3s zbtb46 ko strain c57bl/6 |
| GSE201270,GSE201272_0_v_1_mybl2_human | a549 control fdi6 cell line lung adenocarcinoma wt vs a549 siboth cell line lung adenocarcinoma mybl2 & foxm1 knockdown (simybl2 sifoxm1) |
| GSE201270,GSE201272_5_v_3_mybl2_human | a549 sicontrol cell line lung adenocarcinoma wt vs a549 simybl2 cell line lung adenocarcinoma mybl2 knockdown |
| GSE201270,GSE201272_5_v_1_mybl2_human | a549 sicontrol cell line lung adenocarcinoma wt vs a549 siboth cell line lung adenocarcinoma mybl2 & foxm1 knockdown (simybl2 sifoxm1) |
| GSE201270,GSE201272_0_v_3_mybl2_human | a549 control fdi6 cell line lung adenocarcinoma wt vs a549 simybl2 cell line lung adenocarcinoma mybl2 knockdown |
| GSE96991,GSE97117_4_v_2_il11_mouse | fib bl strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated none ( ) basal vs ms strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated mouse recombinant tgf beta 1 (rnd systems) |
| GSE96991,GSE97117_5_v_0_il11_mouse | fib il11 strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated mouse recombinant (genscript) vs ms fib bl strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated none ( ) basal |
| GSE193685_2_v_3_il11_mouse | placenta wt pegil11 strain c57bl/6 age embryonic day 13 wild type peg il11 vs placenta asc ko peg strain c57bl/6 age embryonic day 13 / |
| GSE96991,GSE97117_5_v_1_il11_mouse | fib il11 strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated mouse recombinant (genscript) vs ms fib il11 strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated mouse recombinant (genscript) |
| GSE96991,GSE97117_5_v_2_il11_mouse | fib il11 strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated mouse recombinant (genscript) vs ms strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated mouse recombinant tgf beta 1 (rnd systems) |
| GSE193685_2_v_0_il11_mouse | placenta wt pegil11 strain c57bl/6 age embryonic day 13 wild type peg il11 vs placenta asc ko pegil11 strain c57bl/6 age embryonic day 13 / peg il11 |
| GSE96991,GSE97117_3_v_1_il11_mouse | fib tgfb strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated mouse recombinant tgf beta 1 (rnd systems) vs ms fib il11 strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated mouse recombinant (genscript) |
| GSE96991,GSE97117_3_v_0_il11_mouse | fib tgfb strain background c57bl/6j /variation wild type cardiac fibroblasts time cultured 24 hours treated mouse recombinant tgf beta 1 (rnd systems) vs ms fib bl strain background c57bl/6j /variation ko il11ra / cardiac fibroblasts time cultured 24 hours treated none ( ) basal |
| GSE193685_4_v_0_il11_mouse | placenta wt peg strain c57bl/6 age embryonic day 13 wild type vs placenta asc ko pegil11 strain c57bl/6 age embryonic day 13 / peg il11 |
| GSE60837_0_v_3_bcl9_mouse | aom dss bcl9/9l wt tumor model /variation bcl9 loxp/loxp bcl9l colorectal vs apc kras bcl9/9l ko tumor 32 model /variation 1638n/wt vil krasg12v/+ bcl9 loxp/loxp bcl9l cre colorectal |
| GSE60837_2_v_4_bcl9_mouse | bcl9/9l ko healthy colon epithelium tumor model epithelial cells /variation bcl9 loxp/loxp bcl9l vil cre edta dissociated vs aom dss bcl9/9l ko tumor model /variation bcl9 loxp/loxp bcl9l vil cre colorectal |
| GSE60837_2_v_3_bcl9_mouse | bcl9/9l ko healthy colon epithelium tumor model epithelial cells /variation bcl9 loxp/loxp bcl9l vil cre edta dissociated vs apc kras bcl9/9l ko tumor 32 model /variation 1638n/wt vil krasg12v/+ bcl9 loxp/loxp bcl9l cre colorectal |
| GSE60837_6_v_3_bcl9_mouse | apc kras bcl9/9l wt tumor model /variation 1638n/wt vil krasg12v/+ bcl9 loxp/loxp bcl9l colorectal vs apc kras bcl9/9l ko tumor 32 model /variation 1638n/wt vil krasg12v/+ bcl9 loxp/loxp bcl9l cre colorectal |
| GSE143790_0_v_1_bcl9_human | dcis.com control replicate cell line plko.1 non silencing dcis breast cancer vs dcis.com bcl9 kd replicate cell line plko.1 knockdown dcis breast cancer |
| GSE60837_0_v_4_bcl9_mouse | aom dss bcl9/9l wt tumor model /variation bcl9 loxp/loxp bcl9l colorectal vs aom dss bcl9/9l ko tumor model /variation bcl9 loxp/loxp bcl9l vil cre colorectal |
| GSE60837_6_v_4_bcl9_mouse | apc kras bcl9/9l wt tumor model /variation 1638n/wt vil krasg12v/+ bcl9 loxp/loxp bcl9l colorectal vs aom dss bcl9/9l ko tumor model /variation bcl9 loxp/loxp bcl9l vil cre colorectal |
| GSE153137,GSE153140_2_v_0_mettl5_mouse | mescs m5 ko d0 embryonic stem cells strain c57bl/6n mettl5 / untreated vs mescs eb d6 embryonic stem cells strain c57bl/6n cultured lif ( ) medium poly 2 hydroxyethyl methacrylate pre coated dishes 6 days |
| GSE153137,GSE153140_2_v_1_mettl5_mouse | mescs m5 ko d0 embryonic stem cells strain c57bl/6n mettl5 / untreated vs mescs m5 ko n2b27 d6 embryonic stem cells strain c57bl/6n mettl5 / cultured medium 6 days |
| GSE203329_2_v_3_mettl5_human | hcc lm3 wt liver cancer cell line cells human untreated vs huh 7 ko liver cancer cell line mettl5 sgrna infection cells human |
| GSE144346_0_v_1_mettl5_mouse | k wt rep strain j1 mesc embryonic stem cells vs k mettl5 ko rep strain j1 mesc / embryonic stem cells |
| GSE203329_0_v_1_mettl5_human | huh 7 wt liver cancer cell line cells human vs hcc lm3 ko liver cancer cell line mettl5 sgrna infection cells human |
| GSE174418,GSE174421_2_v_3_mettl5_mouse | wt brain (mouse mouse vs ko liver (mouse mettl5 mouse |
| GSE203329_2_v_1_mettl5_human | hcc lm3 wt liver cancer cell line cells human untreated vs hcc lm3 ko liver cancer cell line mettl5 sgrna infection cells human |
| GSE174418,GSE174421_0_v_1_mettl5_mouse | wt liver (mouse mouse vs ko brain (mouse mettl5 mouse |
| GSE203329_0_v_3_mettl5_human | huh 7 wt liver cancer cell line cells human vs huh 7 ko liver cancer cell line mettl5 sgrna infection cells human |
| GSE156708_1_v_0_fbxo11_human | ms lenti] mdsl cells condition parent mds l expressing cas9 effectively control mdslcas9 vs ms mdsl cells condition fbxo11 knockout overexpression isoform cdna |
| GSE189772,GSE189773_3_v_5_fbxo11_human | control noifn rep cell line oci aml3 crispr ko safe ifn gamma replicate aml vs fbxo11ko noifn rep cell line oci aml3 crispr ko fbxo11 ifn gamma replicate aml |
| GSE189772,GSE189773_3_v_2_fbxo11_human | control noifn rep cell line oci aml3 crispr ko safe ifn gamma replicate aml vs fbxo11ko ifn rep cell line oci aml3 crispr ko fbxo11 gamma replicate aml |
| GSE189772,GSE189773_0_v_2_fbxo11_human | control ifn rep cell line oci aml3 crispr ko safe gamma replicate aml vs fbxo11ko ifn rep cell line oci aml3 crispr ko fbxo11 gamma replicate aml |
| GSE156708_1_v_2_fbxo11_human | ms lenti] mdsl cells condition parent mds l expressing cas9 effectively control mdslcas9 vs ms 910] mdsl cells condition mds l cas9 fbxo11 sgrna effectively knockout mdslcas9fbxo11ko |
| GSE189772,GSE189773_0_v_5_fbxo11_human | control ifn rep cell line oci aml3 crispr ko safe gamma replicate aml vs fbxo11ko noifn rep cell line oci aml3 crispr ko fbxo11 ifn gamma replicate aml |
| GSE144347_1_v_0_crnkl1_human | non targeting control grna jurkat clone e61 (atcc) expressing hiv dual gt reporter construct 3 crispr lentiviral overexpression none j dual#3 nt1 vs crnkl1 targeting grna jurkat clone e61 (atcc) expressing hiv dual gt reporter construct 3 crispr lentiviral overexpression none j dual#3 |
| GSE229344_2_v_0_cyb5r3_human | nci h1299 cells adenoviral empty vector lung cell line non small cancer wt ev time 24 hours vs nci h1299 cells adenoviral cyb5r3 lung cell line non small cancer overexpression time 24 hours |
| GSE229344_1_v_0_cyb5r3_human | nci h1299 cells pbs lung cell line non small cancer wt time 24 hours vs nci h1299 cells adenoviral cyb5r3 lung cell line non small cancer overexpression time 24 hours |
| GSE248935_1_v_0_cd14_human | shnc lung cancer cell line pc9 brm3 wt routine culture vs shcd146 lung cancer cell line pc9 brm3 cd146 knockdown routine culture |
| GSE210870_0_v_2_snai1_human | wt cell line mda mb 231 triple negative breast cancer cells vs cs19 cell line mda mb 231 triple negative breast cancer cells snai1 ko |
| GSE210870_0_v_1_snai1_human | wt cell line mda mb 231 triple negative breast cancer cells vs cs16 cell line mda mb 231 triple negative breast cancer cells snai1 ko |
| GSE222103_0_v_1_ybx1_mouse | differentiated c3h10t1/2 cells sinc cell line c3h 10t1/2 mesenchymal stem wt adipogenic differentiation vs differentiated c3h10t1/2 cells siybx1 cell line c3h 10t1/2 mesenchymal stem ybx1 knockdown adipogenic differentiation |
| GSE226355,GSE226357_1_v_4_ybx1_human | okf6 rep [rna seq] cell line normal oral cells wild type time 3 days vs scc25 ybx1ko doxpos rep [rna seq] cell line head neck cancer cells ybx1 knockout doxcycline (1 ug/ml) time 3 days |
| GSE226355,GSE226357_2_v_0_ybx1_human | scc25 ybx1ko doxneg rep [rna seq] cell line head neck cancer cells wild type time 3 days vs scc15 ybx1ko doxpos rep [rna seq] cell line head neck cancer cells ybx1 knockout doxcycline (1 ug/ml) time 3 days |
| GSE226355,GSE226357_1_v_0_ybx1_human | okf6 rep [rna seq] cell line normal oral cells wild type time 3 days vs scc15 ybx1ko doxpos rep [rna seq] cell line head neck cancer cells ybx1 knockout doxcycline (1 ug/ml) time 3 days |
| GSE226355,GSE226357_3_v_4_ybx1_human | scc15 ybx1ko doxneg rep [rna seq] cell line head neck cancer cells wild type time 3 days vs scc25 ybx1ko doxpos rep [rna seq] cell line head neck cancer cells ybx1 knockout doxcycline (1 ug/ml) time 3 days |
| GSE98360,GSE98362_1_v_0_uhrf2_mouse | wt strain/background c57bl/6 /variation wild type brain vs ko strain/background c57bl/6 /variation uhrf2 brain |
| GSE185163_5_v_1_clic4_mouse | pt wt 14 days strain fvb/n host wildtype orthograft time 6dt1 derived primary tumor vs pt ko 14 days strain fvb/n host clic4 knockout orthograft time 6dt1 derived primary tumor |
| GSE185163_5_v_2_clic4_mouse | pt wt 14 days strain fvb/n host wildtype orthograft time 6dt1 derived primary tumor vs lung ko 14 days strain fvb/n host clic4 knockout orthograft time pre metastatic |
| GSE173997_3_v_0_clic4_mouse | wt h2o2 strain background fvb/n1 cell line 6dt1 mammary cancer /variation wildtype cells treated 1um vs ko h2o2 strain background fvb/n1 cell line 6dt1 mammary cancer /variation clic4 knockout treated 1um |
| GSE173997_1_v_0_clic4_mouse | wt nt strain background fvb/n1 cell line 6dt1 mammary cancer /variation wildtype cells untreated vs ko h2o2 strain background fvb/n1 cell line 6dt1 mammary cancer /variation clic4 knockout treated 1um |
| GSE185163_3_v_1_clic4_mouse | lung wt 14 days strain fvb/n host wildtype orthograft time pre metastatic vs pt ko 14 days strain fvb/n host clic4 knockout orthograft time 6dt1 derived primary tumor |
| GSE123825_2_v_3_glud1_mouse | baseline ko muscle associated macrophages normal glud1 vs ctx ko muscle associated macrophages injected glud1 |
| GSE123825_0_v_3_glud1_mouse | baseline wt muscle associated macrophages normal vs ctx ko muscle associated macrophages injected glud1 |
| GSE216413_1_v_0_gata3_human | bt549 cells ctl mammary epithelial cell line breast cancer control vector overexpression vs bt549 cells gata mammary epithelial cell line breast cancer gata3 overexpression |
| GSE85995_1_v_0_gata3_human | 48h sirna induced mrna knockdown scrambled control first trimester trophoblast cells vs 48h sirna induced mrna knockdown gata3 first trimester trophoblast cells |
| GSE180813,GSE180815_1_v_0_mettl3_mouse | ctrl control retina age postnatal day 7 vs cko mettl3 knockout retina age postnatal day 7 |
| GSE197564,GSE198513_2_v_0_mettl3_mouse | wt primary hepatocyte actd vs ko primary hepatocyte mettl3 hepatic specific deletion cko actd |
| GSE225141,GSE225143_2_v_1_mettl3_mouse | rna seq wt lps 1 cell line c57bl/6 neutrophil time day vs rna seq m3cko lps 1 cell line c57bl/6 neutrophil mettl3 knockout time day |
| GSE100528_1_v_0_mettl3_mouse | strain c57bl/6 dba2 brain /variation wt developmental stage postnatal vs strain c57bl/6 dba2 brain /variation knockout mettl3 developmental stage postnatal |
| GSE225141,GSE225143_2_v_3_mettl3_mouse | rna seq wt lps 1 cell line c57bl/6 neutrophil time day vs rna seq m3cko 1 cell line c57bl/6 neutrophil mettl3 knockout saline time day |
| GSE225141,GSE225143_0_v_1_mettl3_mouse | rna seq wt 1 cell line c57bl/6 neutrophil saline time day vs rna seq m3cko lps 1 cell line c57bl/6 neutrophil mettl3 knockout time day |
| GSE242521,GSE242522_0_v_1_mettl3_human | h9 cells ctrl cell line hesc derived npc vs h9 cells ko mettl3 cell line hesc derived npc |
| GSE211425_1_v_0_mettl3_human | a549 vector cell line nsclc wt vs a549 shmettl3 cell line nsclc mettl3 knockdown |
| GSE129648,GSE129650_2_v_1_mettl3_mouse | stain background c57bl/6j /variation wild type splenic tfh cells vs stain background c57bl/6j /variation mettl3 ko splenic tfh cells |
| GSE239373_0_v_1_mettl3_mouse | rnaseq wild type mef replicate embryonic fibroblast mettl3 vehicle control vs rnaseq mettl3 knockout mef replicate embryonic fibroblast 4 hydroxytamoxifen 500 nm 8 days |
| GSE197564,GSE198512_0_v_1_mettl3_mouse | control liver wt mouse total rna vs mettl3 cko liver hepatic specific deletion mouse total rna |
| GSE182382_1_v_0_mettl3_human | rna seq dko 1 cell phenotype control kras mutant colorectal cancer line vs rna seq mettl3 cell phenotype knockdown kras mutant colorectal cancer line |
| GSE202017,GSE202018_1_v_0_mettl3_human | rna seq arpe 19 cells sh control cell line retinal pigment epithelium scramble lps stimulated 24h vs rna seq arpe 19 cells sh mettl3 cell line retinal pigment epithelium knockdown lps stimulated 24h |
| GSE221742,GSE221743_1_v_0_sipa1_human | bt549 cell line breast cancer cells wt vs bt549 dbd cell line breast cancer cells sipa1 knockdown rescued expression deleted dbr region (si ddbr) |
| GSE221742,GSE221743_1_v_2_sipa1_human | bt549 cell line breast cancer cells wt vs bt549 si cell line breast cancer cells sipa1 knockdown |
| GSE204811,GSE204813_1_v_3_trim29_human | rwpe 1 knockdown rep [rwpe1 cell line normal basal epithelium vs pc3 trim29 overexpression [pc3 oe cell line prostate cancer |
| GSE143847_2_v_0_inhba_mouse | gfpneg wt e15.5 inhba x oct4 gfp age embryonic strain c57/bl6/129svj testis vs gfpneg ko e15.5 inhba x oct4 gfp age embryonic strain c57/bl6/129svj testis |
| GSE143847_2_v_3_inhba_mouse | gfpneg wt e15.5 inhba x oct4 gfp age embryonic strain c57/bl6/129svj testis vs gfpneg ko e13.5 inhba x oct4 gfp age embryonic strain c57/bl6/129svj testis |
| GSE201520_8_v_3_inhba_mouse | gfppos e15.5 wt age embryonic day 15.5 testis germ cell inhba x oct gfp ko strain c57/bl6/129svj vs gfppos e13.5 ko age embryonic day 13.5 testis germ cell inhba x oct gfp strain c57/bl6/129svj |
| GSE168798_0_v_1_isg15_human | ko human ipsc derived cells /variation isg15 untreated macrophages vs human ipsc derived cells /variation ifna stimulated macrophages |
| GSE186483_6_v_4_lrrk2_mouse | ko ctr strain c57bl/6 primary microglia age post natal day 21 lrrk2 / control postnatal mouse brain vs ko lps strain c57bl/6 primary microglia age post natal day 21 lrrk2 / postnatal mouse brain |
| GSE186483_2_v_0_lrrk2_mouse | wt lps strain c57bl/6 primary microglia age post natal day 21 wild type postnatal mouse brain vs ko syn strain c57bl/6 primary microglia age post natal day 21 lrrk2 / alpha synuclein fibrils postnatal mouse brain |
| GSE186483_6_v_0_lrrk2_mouse | ko ctr strain c57bl/6 primary microglia age post natal day 21 lrrk2 / control postnatal mouse brain vs ko syn strain c57bl/6 primary microglia age post natal day 21 lrrk2 / alpha synuclein fibrils postnatal mouse brain |
| GSE186483_1_v_0_lrrk2_mouse | wt ctr strain c57bl/6 primary microglia age post natal day 21 wild type control postnatal mouse brain vs ko syn strain c57bl/6 primary microglia age post natal day 21 lrrk2 / alpha synuclein fibrils postnatal mouse brain |
| GSE186483_2_v_4_lrrk2_mouse | wt lps strain c57bl/6 primary microglia age post natal day 21 wild type postnatal mouse brain vs ko lps strain c57bl/6 primary microglia age post natal day 21 lrrk2 / postnatal mouse brain |
| GSE186483_1_v_4_lrrk2_mouse | wt ctr strain c57bl/6 primary microglia age post natal day 21 wild type control postnatal mouse brain vs ko lps strain c57bl/6 primary microglia age post natal day 21 lrrk2 / postnatal mouse brain |
| GSE223540_0_v_3_anxa2_mouse | shctrl ogdr bv2 microglia cell line anxa2 knockdown oxygen glucose deprivation reoxygenation (ogd/r) ogd4h r12h vs shanxa2 ogdr bv2 microglia cell line anxa2 knockdown oxygen glucose deprivation reoxygenation (ogd/r) ogd4h r12h |
| GSE223540_2_v_3_anxa2_mouse | shctrl ctrl bv2 microglia cell line wt control non treat vs shanxa2 ogdr bv2 microglia cell line anxa2 knockdown oxygen glucose deprivation reoxygenation (ogd/r) ogd4h r12h |
| GSE223540_1_v_3_anxa2_mouse | shanxa2 ctrl bv2 microglia cell line wt control non treat vs shanxa2 ogdr bv2 microglia cell line anxa2 knockdown oxygen glucose deprivation reoxygenation (ogd/r) ogd4h r12h |
| GSE215132_1_v_0_ptpn2_mouse | wt rgc retina ganglion cell pbs injection optiv nerve injury vs cko ifnî³ rgc retina ganglion cell injection ptpn2 ko optiv nerve injury |
| GSE215132_2_v_0_ptpn2_mouse | ifnî³ rgc retina ganglion cell injection wt optiv nerve injury vs cko ifnî³ rgc retina ganglion cell injection ptpn2 ko optiv nerve injury |
| GSE215132_2_v_3_ptpn2_mouse | ifnî³ rgc retina ganglion cell injection wt optiv nerve injury vs cko rgc retina ganglion cell pbs injection ptpn2 ko optiv nerve injury |
| GSE215132_1_v_3_ptpn2_mouse | wt rgc retina ganglion cell pbs injection optiv nerve injury vs cko rgc retina ganglion cell pbs injection ptpn2 ko optiv nerve injury |
| GSE63048_11_v_5_morc1_mouse | p10.5 dnmt3l wt replicate rna seq /variation library type truseq v2 whole testis vs morc1 ko replicate rna seq /variation library type ovation human ffpe w/murine rrna depletion sorted germ cells |
| GSE63048_11_v_6_morc1_mouse | p10.5 dnmt3l wt replicate rna seq /variation library type truseq v2 whole testis vs p14.5 morc1 ko replicate rna seq /variation library type truseq v2 whole testis |
| GSE63048_11_v_12_morc1_mouse | p10.5 dnmt3l wt replicate rna seq /variation library type truseq v2 whole testis vs morc1 ko replicate rna seq /variation library type ovation human ffpe w/murine rrna depletion sorted germ cells |
| GSE63048_11_v_8_morc1_mouse | p10.5 dnmt3l wt replicate rna seq /variation library type truseq v2 whole testis vs p10.5 morc1 ko replicate (testis) rna seq /variation library type truseq v2 whole testis |
| GSE173394_1_v_0_nfatc2_human | shx2 cell line thp 1 mll af9 human aml disease state acute myeloid leukaemia type non targeting control shrna vs cell line thp 1 mll af9 human aml disease state acute myeloid leukaemia type nfatc2 knockdown construct |
| GSE140074_1_v_0_kif20a_human | cell line ht 1080 fibrosarcoma /variation control vs cell line ht 1080 fibrosarcoma /variation kif20a knockdown |
| GSE180147_0_v_1_itga5_human | liu lsc 1 wt cell line wild type vs liu lsc 1 itga5 ko cell line / |
| GSE226091,GSE226092_0_v_4_sall1_mouse | rna seq microglia smad4 wt brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) wildtype vs rna seq microglia sall1 enhancer heterozygous ko brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) |
| GSE226091,GSE226092_3_v_4_sall1_mouse | rna seq microglia sall1 enhancer wt brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) wild type vs rna seq microglia sall1 enhancer heterozygous ko brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) |
| GSE226091,GSE226092_3_v_2_sall1_mouse | rna seq microglia sall1 enhancer wt brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) wild type vs rna seq microglia smad4 conditional ko brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) deletion |
| GSE226091,GSE226092_3_v_1_sall1_mouse | rna seq microglia sall1 enhancer wt brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) wild type vs rna seq microglia sall1 enhancer ko brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) knockout |
| GSE226091,GSE226092_0_v_1_sall1_mouse | rna seq microglia smad4 wt brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) wildtype vs rna seq microglia sall1 enhancer ko brain strain c57/bl6 whole cell (cd45+ cd11b+ cx3cr1+) knockout |
| GSE113106_3_v_5_dnm2_mouse | p5 strain background c57bl/6 age /variation control sciatic nerve wt vs dnm2 mut strain background c57bl/6 age 4 weeks post tamoxifen /variation knockout additional protocol animals injected 2 month sciatic nerve |
| GSE113106_2_v_1_dnm2_mouse | p1 strain background c57bl/6 age /variation control sciatic nerve wt vs p5 strain background c57bl/6 age /variation dnm2 knockout sciatic nerve dnm2ko |
| GSE113106_0_v_4_dnm2_mouse | dnm2 ctr strain background c57bl/6 age 4 weeks post tamoxifen /variation control additional protocol animals injected 2 month sciatic nerve vs p1 strain background c57bl/6 age /variation dnm2 knockout sciatic nerve dnm2ko |
| GSE113106_2_v_4_dnm2_mouse | p1 strain background c57bl/6 age /variation control sciatic nerve wt vs p1 strain background c57bl/6 age /variation dnm2 knockout sciatic nerve dnm2ko |
| GSE113106_3_v_4_dnm2_mouse | p5 strain background c57bl/6 age /variation control sciatic nerve wt vs p1 strain background c57bl/6 age /variation dnm2 knockout sciatic nerve dnm2ko |
| GSE113106_0_v_5_dnm2_mouse | dnm2 ctr strain background c57bl/6 age 4 weeks post tamoxifen /variation control additional protocol animals injected 2 month sciatic nerve vs dnm2 mut strain background c57bl/6 age 4 weeks post tamoxifen /variation knockout additional protocol animals injected 2 month sciatic nerve |
| GSE113106_2_v_5_dnm2_mouse | p1 strain background c57bl/6 age /variation control sciatic nerve wt vs dnm2 mut strain background c57bl/6 age 4 weeks post tamoxifen /variation knockout additional protocol animals injected 2 month sciatic nerve |
| GSE235017_1_v_0_uba52_human | sinc cell line huh7 negative control vs siuba52 cell line huh7 uba52 knockdown |
| GSE246195,GSE246305_4_v_3_sin3a_mouse | postnatal day 0 tbx4rtta tetocre sin3a f/+ control biol repostnatal bulk lung developmental stage p0 vs postnatal day 3 tbx4rtta tetocre sin3a f/f cko biol repostnatal bulk lung developmental stage p3 conditional knockout |
| GSE246195,GSE246305_1_v_0_sin3a_mouse | embryonic day 16 tbx4rtta tetocre sin3a f/+ control biol rep bulk lung developmental stage e16 vs postnatal day 0 tbx4rtta tetocre sin3a f/f cko biol repostnatal bulk lung developmental stage p0 conditional knockout |
| GSE246184,GSE246195_0_v_1_sin3a_mouse | embryonic day 16 tbx4rtta tetocre sin3a f/+ control biol rep bulk lung developmental stage sorted mesenchymal cells vs e16 tbx4rtta tetocre sin3a f/f cko biol rep bulk lung developmental stage embryonic day 16 sorted mesenchymal cells conditional knockout |
| GSE246195,GSE246305_1_v_3_sin3a_mouse | embryonic day 16 tbx4rtta tetocre sin3a f/+ control biol rep bulk lung developmental stage e16 vs postnatal day 3 tbx4rtta tetocre sin3a f/f cko biol repostnatal bulk lung developmental stage p3 conditional knockout |
| GSE246195,GSE246305_2_v_0_sin3a_mouse | postnatal day 3 tbx4rtta tetocre sin3a f/f control biol repostnatal bulk lung developmental stage p3 vs postnatal day 0 tbx4rtta tetocre sin3a f/f cko biol repostnatal bulk lung developmental stage p0 conditional knockout |
| GSE246195,GSE246305_2_v_5_sin3a_mouse | postnatal day 3 tbx4rtta tetocre sin3a f/f control biol repostnatal bulk lung developmental stage p3 vs embryonic day 16 tbx4rtta tetocre sin3a f/f cko biol rep bulk lung developmental stage e16 conditional knockout |
| GSE123861_1_v_0_sin3a_human | control replicate cell line hek293t cells vs sin3a rnai knockdown replicate cell line hek293t cells |
| GSE246195,GSE246305_4_v_5_sin3a_mouse | postnatal day 0 tbx4rtta tetocre sin3a f/+ control biol repostnatal bulk lung developmental stage p0 vs embryonic day 16 tbx4rtta tetocre sin3a f/f cko biol rep bulk lung developmental stage e16 conditional knockout |
| GSE149123,GSE149128_1_v_0_cdk7_mouse | ko saline perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old wild type vs ko cl perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old cdk7 ako |
| GSE149124,GSE149128_3_v_1_cdk7_mouse | rt wt interscapular brown adipose strain c57bl/6 room temperature age 12 weeks old wild type vs cold ko interscapular brown adipose strain c57bl/6 exposure 6 hrs food age 12 weeks old cdk7 bko |
| GSE149124,GSE149128_2_v_0_cdk7_mouse | cold wt interscapular brown adipose strain c57bl/6 exposure 6 hrs food age 12 weeks old wild type vs rt ko interscapular brown adipose strain c57bl/6 room temperature age 12 weeks old cdk7 bko |
| GSE149123,GSE149128_2_v_0_cdk7_mouse | wt cl perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old cdk7 ako vs ko cl perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old cdk7 ako |
| GSE149124,GSE149128_3_v_0_cdk7_mouse | rt wt interscapular brown adipose strain c57bl/6 room temperature age 12 weeks old wild type vs rt ko interscapular brown adipose strain c57bl/6 room temperature age 12 weeks old cdk7 bko |
| GSE149124,GSE149128_2_v_1_cdk7_mouse | cold wt interscapular brown adipose strain c57bl/6 exposure 6 hrs food age 12 weeks old wild type vs cold ko interscapular brown adipose strain c57bl/6 exposure 6 hrs food age 12 weeks old cdk7 bko |
| GSE149123,GSE149128_3_v_0_cdk7_mouse | wt saline perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old wild type vs ko cl perigonadal wat strain c57bl/6 injection 7 days age 9 weeks old cdk7 ako |
| GSE151494_1_v_4_nrp1_mouse | tumor wt d21 background strain c57bl/6 pmel cells time vs dln ko background strain c57bl/6 draining lymph node pmel cells nrp1 time |
| GSE151494_8_v_3_nrp1_mouse | ndln wt background strain c57bl/6 non draining lymph node pmel cells time vs tumor ko d21 background strain c57bl/6 pmel cells nrp1 time |
| GSE151494_1_v_3_nrp1_mouse | tumor wt d21 background strain c57bl/6 pmel cells time vs tumor ko d21 background strain c57bl/6 pmel cells nrp1 time |
| GSE151494_10_v_3_nrp1_mouse | dln wt background strain c57bl/6 draining lymph node pmel cells time vs tumor ko d21 background strain c57bl/6 pmel cells nrp1 time |
| GSE151494_1_v_9_nrp1_mouse | tumor wt d21 background strain c57bl/6 pmel cells time vs ndln ko background strain c57bl/6 non draining lymph node pmel cells nrp1 time |
| GSE196012_1_v_0_brap_mouse | liver wildtype strain c57bl/6 age 18 weeks old wild type left lobe vs liver brap knockout strain c57bl/6 age 18 weeks old left lobe |
| GSE101748_0_v_1_apela_mouse | strain c57bl6/cd 1 mix whole embryo developmental stage e7.5 wild type vs strain c57bl6/cd 1 mix whole embryo developmental stage e7.5 apela ko neo |
| GSE101748_0_v_3_apela_mouse | strain c57bl6/cd 1 mix whole embryo developmental stage e7.5 wild type vs strain c57bl6/cd 1 mix whole embryo developmental stage e7.5 apela ko neo |
| GSE213632_1_v_6_acod1_mouse | ewat wt nd strain c57bl/6n normal chow diet time 16 weeks sex male vs ewat ko hfd strain c57bl/6n acod1 / high fat diet time 16 weeks sex male |
| GSE213632_0_v_6_acod1_mouse | iwat wt hfd strain c57bl/6n high fat diet time 16 weeks sex male vs ewat ko hfd strain c57bl/6n acod1 / high fat diet time 16 weeks sex male |
| GSE213632_1_v_5_acod1_mouse | ewat wt nd strain c57bl/6n normal chow diet time 16 weeks sex male vs iwat ko hfd strain c57bl/6n acod1 / high fat diet time weeks sex male |
| GSE213632_4_v_5_acod1_mouse | ewat wt hfd strain c57bl/6n high fat diet time 16 weeks sex male vs iwat ko hfd strain c57bl/6n acod1 / high fat diet time weeks sex male |
| GSE213632_3_v_5_acod1_mouse | iwat wt nd strain c57bl/6n normal chow diet time 16 weeks sex male vs iwat ko hfd strain c57bl/6n acod1 / high fat diet time weeks sex male |
| GSE213632_3_v_6_acod1_mouse | iwat wt nd strain c57bl/6n normal chow diet time 16 weeks sex male vs ewat ko hfd strain c57bl/6n acod1 / high fat diet time 16 weeks sex male |
| GSE213632_4_v_6_acod1_mouse | ewat wt hfd strain c57bl/6n high fat diet time 16 weeks sex male vs ewat ko hfd strain c57bl/6n acod1 / high fat diet time 16 weeks sex male |
| GSE132313_1_v_0_fosl2_mouse | control sorted cd4+cd62lhighcd44low stimulation 24 hours anti cd3 cd28 /variation wt naive cd4+ cells vs fosl2 ko sorted cd4+cd62lhighcd44low stimulation 24 hours anti cd3 cd28 /variation fosl2fl/fl cd4 cre+ naive cd4+ cells |
| GSE193027_1_v_0_krt19_mouse | tumor stage 2 weeks inoculation cancer 1242 kpc cell mouse strain c57bl/6 condition control subcutaneous pda vs tumor stage 2 weeks inoculation cancer 1242 kpc cell mouse strain c57bl/6 condition krt19 knockout subcutaneous pda |
| GSE193900,GSE193905_1_v_0_pura_human | rnaseq hela ctrl poly + pura concentration endogenous cell culture vs rnaseq hela pura sirna poly + concentration knockdown cell culture |
| GSE134923_1_v_0_ncor1_mouse | group (lv lc mice strain background c57bl/6 age 2 months old /variation littermate control (lc) heart subype left ventricular mice) vs group b (lv cmnko mice strain background c57bl/6 age 2 months old /variation cardiomyocyte specific ncor1 knockout (cmnko) heart subype left ventricular mice) |
| GSE185635_0_v_1_ncor1_mouse | wt strain c57bl/6 vascular smooth muscle cells wild type vs ko strain c57bl/6 vascular smooth muscle cells ncor1 / |
| GSE236072,GSE236075_2_v_0_ccr6_mouse | ccr6wt mtec3 thymic epithelial cells ccr6 wt age 5 weeks old protocol bulk mars seq (3' end rna seq) vs igmko mtec3 thymic epithelial cells igm ko age 5 weeks old protocol bulk mars seq (3' end rna seq) |
| GSE236072,GSE236075_2_v_1_ccr6_mouse | ccr6wt mtec3 thymic epithelial cells ccr6 wt age 5 weeks old protocol bulk mars seq (3' end rna seq) vs ccr6ko mtec3 thymic epithelial cells ccr6 ko age 5 weeks old protocol bulk mars seq (3' end rna seq) |
| GSE126621,GSE126920_1_v_0_dppa4_mouse | rna seq wt mesc serum cells mouse embryonic stem vs rna seq dppa4 ko plus dppa4dsap mesc serum depleted crispr/cas9 technology transfected truncated mouse embryonic stem cells |
| GSE126621,GSE126920_1_v_3_dppa4_mouse | rna seq wt mesc serum cells mouse embryonic stem vs rna seq dppa4 ko mesc serum depleted crispr/cas9 technology mouse embryonic stem cells |
| GSE126621,GSE126920_1_v_4_dppa4_mouse | rna seq wt mesc serum cells mouse embryonic stem vs rna seq dppa4 ko plus mesc serum depleted crispr/cas9 technology transfected full length mouse embryonic stem cells |
| GSE126762_1_v_0_klf15_mouse | ctl /variation albumin cre liver vs li ko /variation liver specific klf15 knockout |
| GSE252857_1_v_3_klf15_mouse | heartklf15 wt + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle vs heartklf15 ko + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle |
| GSE252857_2_v_0_klf15_mouse | heartklf15 wt + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone vs heartklf15 ko + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone |
| GSE252857_2_v_3_klf15_mouse | heartklf15 wt + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone vs heartklf15 ko + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle |
| GSE252857_1_v_0_klf15_mouse | heartklf15 wt + veh myocardium age 4 months old sex male cardiomyocyte klf15 vehicle vs heartklf15 ko + pred myocardium age 4 months old sex male cardiomyocyte klf15 prednisone |
| GSE253041_1_v_0_ramp1_mouse | rna seq skin cd4+ ccr6+ th17 cells following .epi tcells wt staphylococcus epidermidis vs rna seq skin keratinocytes 14 days following .epi ramp1 ko mice staphylococcus epidermidis |
| GSE253041_3_v_0_ramp1_mouse | rna seq skin keratinocytes 14 days following .epi ramp1 wt mice staphylococcus epidermidis vs rna seq skin keratinocytes 14 days following .epi ramp1 ko mice staphylococcus epidermidis |
| GSE188774_1_v_0_hkdc1_human | empty vector ev control hepg2 cells vs hkdc1 knockout ko hepg2 cells |
| GSE138633_2_v_0_bag3_human | bag3 wt human ipsc derived cardiomyocytes vs bag3 ko human ipsc derived cardiomyocytes |
| GSE205070_1_v_9_mertk_mouse | bmdm c57bl/6 biol rep bmdms strain c57bl/6j immune wildtype macrophage differentiation vs bmdm mertkov3 biol rep bmdms strain c57bl/6j immune mertk knockout version 3 macrophage differentiation |
| GSE205070_2_v_5_mertk_mouse | rpe c57bl/6 p25 biol rep strain c57bl/6j epithelial wildtype none direct ex vivo use vs bmdm mertkov1 biol rep 1 bmdms strain c57bl/6j immune mertk knockout version macrophage differentiation |
| GSE205070_1_v_7_mertk_mouse | bmdm c57bl/6 biol rep bmdms strain c57bl/6j immune wildtype macrophage differentiation vs bmdm mertkov2 biol rep bmdms strain c57bl/6j immune mertk knockout version 2 macrophage differentiation |
| GSE205070_2_v_9_mertk_mouse | rpe c57bl/6 p25 biol rep strain c57bl/6j epithelial wildtype none direct ex vivo use vs bmdm mertkov3 biol rep bmdms strain c57bl/6j immune mertk knockout version 3 macrophage differentiation |
| GSE205070_1_v_5_mertk_mouse | bmdm c57bl/6 biol rep bmdms strain c57bl/6j immune wildtype macrophage differentiation vs bmdm mertkov1 biol rep 1 bmdms strain c57bl/6j immune mertk knockout version macrophage differentiation |
| GSE205070_2_v_4_mertk_mouse | rpe c57bl/6 p25 biol rep strain c57bl/6j epithelial wildtype none direct ex vivo use vs rpe mertkov1 p25 biol rep 1 strain c57bl/6j epithelial mertk knockout version none direct ex vivo use |
| GSE205070_1_v_4_mertk_mouse | bmdm c57bl/6 biol rep bmdms strain c57bl/6j immune wildtype macrophage differentiation vs rpe mertkov1 p25 biol rep 1 strain c57bl/6j epithelial mertk knockout version none direct ex vivo use |
| GSE205070_2_v_7_mertk_mouse | rpe c57bl/6 p25 biol rep strain c57bl/6j epithelial wildtype none direct ex vivo use vs bmdm mertkov2 biol rep bmdms strain c57bl/6j immune mertk knockout version 2 macrophage differentiation |
| GSE205070_1_v_6_mertk_mouse | bmdm c57bl/6 biol rep bmdms strain c57bl/6j immune wildtype macrophage differentiation vs rpe mertkov2 p25 biol rep strain c57bl/6j epithelial mertk knockout version 2 none direct ex vivo use |
| GSE159473_0_v_1_eif5a2_human | ctrl (eif5a2 control) eif5a2 overexpression sh sy5y cell (control plasmid) neuroblastoma cells vs eif5a2 overexpression sh sy5y cell neuroblastoma cells |
| GSE213228_1_v_5_irak2_human | triple negative breast cancer primary cell line bcsc1 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc3 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_1_v_0_irak2_human | triple negative breast cancer primary cell line bcsc1 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc1 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_1_v_3_irak2_human | triple negative breast cancer primary cell line bcsc1 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer cell line mda mb 468 infected irak2 knockdown vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible |
| GSE213228_4_v_3_irak2_human | triple negative breast cancer primary cell line bcsc3 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer cell line mda mb 468 infected irak2 knockdown vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible |
| GSE213228_2_v_0_irak2_human | triple negative breast cancer cell line mda mb 468 infected control vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc1 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_4_v_5_irak2_human | triple negative breast cancer primary cell line bcsc3 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc3 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_2_v_5_irak2_human | triple negative breast cancer cell line mda mb 468 infected control vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc3 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_4_v_0_irak2_human | triple negative breast cancer primary cell line bcsc3 infected control vector biological replicate isolated tumor stem lentivirally transduced inducible vs triple negative breast cancer primary cell line bcsc1 infected irak2 knockdown vector biological replicate isolated tumor stem lentivirally transduced inducible |
| GSE213228_2_v_3_irak2_human | triple negative breast cancer cell line mda mb 468 infected control vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible vs triple negative breast cancer cell line mda mb 468 infected irak2 knockdown vector biological replicate derived metastatic site pleural effusion lentivirally transduced inducible |
| GSE116354,GSE117379_3_v_5_cox2_mouse | lungxx wtxlps strain c57bl/6 lung wild type lps c56/bl6 6hr vs spleen koxlps strain c57bl/6 lincrna cox2 knockout lps 6hr |
| GSE116354,GSE117379_2_v_4_cox2_mouse | spleen strain c57bl/6 wild type c56/bl6 vs lungxx koxlps strain c57bl/6 lung lincrna cox2 knockout lps 6hr |
| GSE116354,GSE117379_3_v_4_cox2_mouse | lungxx wtxlps strain c57bl/6 lung wild type lps c56/bl6 6hr vs lungxx koxlps strain c57bl/6 lung lincrna cox2 knockout lps 6hr |
| GSE188659_1_v_0_tbk1_mouse | wt pregc strain c57bl/6 spleen mb1cre(wt/wt) tbk1(flox/flox) germinal center precursor b cells (pre gc) agent plasmodium yoelii day 9 wild type pre gc vs ko pregc strain c57bl/6 spleen mb1cre(cre/wt) tbk1(flox/flox) germinal center precursor b cells (pre gc) agent plasmodium yoelii day 9 tbk1 deficient pre gc |
| GSE236511_1_v_0_ngfr_mouse | fdcs wt lymph node follicualr dendritic cells vs fdcs ngfr ko lymph node follicualr dendritic cells |
| GSE114258_1_v_2_foxk1_mouse | control knockdown rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct scrambled shrna vs foxk1 knockdown rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct shrna |
| GSE114258_1_v_0_foxk1_mouse | control knockdown rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct scrambled shrna vs foxk1 overexpression rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct constituent |
| GSE114258_3_v_2_foxk1_mouse | control overexpression rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct empty vector vs foxk1 knockdown rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct shrna |
| GSE114258_3_v_0_foxk1_mouse | control overexpression rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct empty vector vs foxk1 overexpression rna seq cell line 3t3 l1 adipocytes strain swiss mouse expression construct constituent |
| GSE161184_0_v_1_tlr7_mouse | wt strain nod wild type sex male lacrimal gland vs tlr7ko strain nod tlr7 knockout sex male lacrimal gland |
| GSE221577_1_v_0_pik3r1_human | rneg1 ly cell line rpmi 8402 genotyope wt gsi 24hrs group nt replicate non targeting control + vs rko cb103 cell line rpmi 8402 genotyope pik3r1 knockout cb 103 24hrs group ko replicate + |
| GSE221577_3_v_5_pik3r1_human | rneg1 dmso cell line rpmi 8402 genotyope wt 24hrs group nt replicate non targeting control + vs rko ly cell line rpmi 8402 genotyope pik3r1 knockout gsi 24hrs group ko replicate + |
| GSE221577_4_v_0_pik3r1_human | rko dmso cell line rpmi 8402 genotyope pik3r1 knockout 24hrs group ko replicate + vs rko cb103 cell line rpmi 8402 genotyope pik3r1 knockout cb 103 24hrs group ko replicate + |
| GSE221577_3_v_0_pik3r1_human | rneg1 dmso cell line rpmi 8402 genotyope wt 24hrs group nt replicate non targeting control + vs rko cb103 cell line rpmi 8402 genotyope pik3r1 knockout cb 103 24hrs group ko replicate + |
| GSE221577_1_v_5_pik3r1_human | rneg1 ly cell line rpmi 8402 genotyope wt gsi 24hrs group nt replicate non targeting control + vs rko ly cell line rpmi 8402 genotyope pik3r1 knockout gsi 24hrs group ko replicate + |
| GSE221577_4_v_5_pik3r1_human | rko dmso cell line rpmi 8402 genotyope pik3r1 knockout 24hrs group ko replicate + vs rko ly cell line rpmi 8402 genotyope pik3r1 knockout gsi 24hrs group ko replicate + |
| GSE221577_2_v_0_pik3r1_human | rneg1 cb103 cell line rpmi 8402 genotyope wt cb 103 24hrs group nt replicate non targeting control + vs rko cb103 cell line rpmi 8402 genotyope pik3r1 knockout cb 103 24hrs group ko replicate + |
| GSE221577_2_v_5_pik3r1_human | rneg1 cb103 cell line rpmi 8402 genotyope wt cb 103 24hrs group nt replicate non targeting control + vs rko ly cell line rpmi 8402 genotyope pik3r1 knockout gsi 24hrs group ko replicate + |
| GSE242555_1_v_0_fn3k_human | hepg2 cells wt sample liver cell line vs hepg2 cells fn3k ko sample liver cell line |
| GSE166054_1_v_0_klf1_mouse | wt strain c57bl/6 fetus developmental stage 9.0 dpc mouse vs klf12 oe strain c57bl/6 fetus developmental stage 9.0 dpc overexpression mouse |
| GSE136591_0_v_1_akap11_mouse | wt cell line mc3t3 e1 vs akap11 ko / cell line mc3t3 e1 |
| GSE245134_0_v_1_atg5_mouse | control bonemarrow eosinophil vs atg5 knockout blood eosinophil |
| GSE245134_2_v_3_atg5_mouse | control blood eosinophil vs atg5 knockout bonemarrow eosinophil |
| GSE135244_0_v_1_trdmt1_human | hek293 control cell line vs hek293 trdmt1 gene knockdown cell line |
| GSE190950_1_v_0_nono_human | u251 cells sinc cell line glioblastoma disease state control vs u251 cells sinono cell line glioblastoma disease state nono knockdown |
| GSE191021_1_v_0_nono_human | gsc p3 cells sinc cell line glioblastoma disease state control vs gsc p3 cells sinono cell line glioblastoma disease state nono knockdown |
| GSE195743_3_v_2_lhx6_mouse | lhx6 ctrl strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic vs mtg8 ko strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic |
| GSE195743_1_v_4_lhx6_mouse | mtg8 ctrl strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic vs lhx6 ko strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic |
| GSE114553_0_v_1_lhx6_human | v con induced pluripotent stem cells cell line sample stage 50 days differentiation ipscs group control vs v lhx6 gof induced pluripotent stem cells cell line sample stage 50 days differentiation ipscs group overexpression |
| GSE195743_3_v_4_lhx6_mouse | lhx6 ctrl strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic vs lhx6 ko strain c57bl6/cba mge derived cortical cells age embyonic day 14.5 sorted fluorescent migrating embryonic |
| GSE191110_0_v_1_dnajc12_human | dnajc12 breast cancer cells cell line mda mb 231 transfected empty vector control vs dnajc12 breast cancer cells cell line mda mb 231 transfected dnajc12v overexpression |
| GSE262134_0_v_1_dnajc12_human | sh sy5y cells wt cell line neuroblastoma none vs sh sy5y cells dnajc12ko cell line neuroblastoma dnajc12 knockout none |
| GSE243879_1_v_0_elapor1_human | yuuki condition panc 10.05 ctrl cell lines outcome control pancreatic cancer line vs yuuki condition panc 10.05 elapor1 overexpression cell lines outcome transgene pancreatic cancer line |
| GSE103309_2_v_0_ube3a_human | rna ctl15m cell line sh(15m) chromosome duplication model dup15q syndrome sirna sictl /variation control knockdown vs rna kd15m cell line sh(15m) chromosome duplication model dup15q syndrome sirna siube3a /variation ube3a knockdown |
| GSE120595_0_v_4_arid2_mouse | vav control hsc rna seq strain c57bl/6 wild type age 8 weeks cre driver hematopoietic stem cell (hsc) indexes vs vav jarid2 ko hsc rna seq strain c57bl/6 age 8 weeks cre driver hematopoietic stem cell (hsc) indexes |
| GSE120595_5_v_1_arid2_mouse | vav control mpp rna seq strain c57bl/6 wild type age 8 weeks cre driver multipotent progenitor cells (mpps) indexes vs vav jarid2 ko mpp rna seq strain c57bl/6 age 8 weeks cre driver multipotent progenitor cells (mpps) indexes |
| GSE120595_5_v_4_arid2_mouse | vav control mpp rna seq strain c57bl/6 wild type age 8 weeks cre driver multipotent progenitor cells (mpps) indexes vs vav jarid2 ko hsc rna seq strain c57bl/6 age 8 weeks cre driver hematopoietic stem cell (hsc) indexes |
| GSE120595_0_v_1_arid2_mouse | vav control hsc rna seq strain c57bl/6 wild type age 8 weeks cre driver hematopoietic stem cell (hsc) indexes vs vav jarid2 ko mpp rna seq strain c57bl/6 age 8 weeks cre driver multipotent progenitor cells (mpps) indexes |
| GSE126463_0_v_2_arid2_human | control kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_5_v_2_arid2_human | pom 24h 1 disease multiple myeloma /variation wild type um pomalidomide 24 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_1_v_2_arid2_human | pom 72h 1 disease multiple myeloma /variation wild type um pomalidomide 72 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_6_v_2_arid2_human | pom 48h 1 disease multiple myeloma /variation wild type um pomalidomide 48 hours mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE126463_4_v_2_arid2_human | non treat disease multiple myeloma /variation wild type treated mm.1s human cell line peripheral blood vs arid2 kd disease multiple myeloma /variation knockdown non treated mm.1s human cell line peripheral blood |
| GSE186440,GSE186443_2_v_7_daxx_human | daxx wt cells etoposide treated replicate cell line u87 glioblastoma vs atrx ko cells etoposide treated replicate cell line u87 glioblastoma |
| GSE241701_4_v_0_daxx_mouse | wt serum cell line e14tg2a wildtype embryonic stem cells escs (serum+lif) vs daxxko diff cell line e14tg2a embryonic stem cells daxx knockout neuronal differentiation (retinoic acid lif) |
| GSE186440,GSE186443_2_v_5_daxx_human | daxx wt cells etoposide treated replicate cell line u87 glioblastoma vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE241701_4_v_3_daxx_mouse | wt serum cell line e14tg2a wildtype embryonic stem cells escs (serum+lif) vs daxxko cell line e14tg2a embryonic stem cells daxx knockout escs |
| GSE241701_2_v_3_daxx_mouse | wt diff cell line e14tg2a wildtype embryonic stem cells neuronal differentiation (retinoic acid lif) vs daxxko cell line e14tg2a embryonic stem cells daxx knockout escs |
| GSE186440,GSE186443_0_v_5_daxx_human | atrx wt cells etoposide treated replicate cell line u87 glioblastoma vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE186440,GSE186443_4_v_5_daxx_human | atrx wt cells untreated replicate cell line u87 glioblastoma control vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE186440,GSE186443_6_v_5_daxx_human | atrx ko cells untreated replicate cell line u87 glioblastoma control vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE241701_2_v_0_daxx_mouse | wt diff cell line e14tg2a wildtype embryonic stem cells neuronal differentiation (retinoic acid lif) vs daxxko diff cell line e14tg2a embryonic stem cells daxx knockout neuronal differentiation (retinoic acid lif) |
| GSE186440,GSE186443_1_v_5_daxx_human | daxx ko cells untreated replicate cell line u87 glioblastoma atrx control vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE186440,GSE186443_1_v_7_daxx_human | daxx ko cells untreated replicate cell line u87 glioblastoma atrx control vs atrx ko cells etoposide treated replicate cell line u87 glioblastoma |
| GSE186440,GSE186443_3_v_5_daxx_human | daxx wt cells untreated replicate cell line u87 glioblastoma control vs daxx ko cells etoposide treated replicate cell line u87 glioblastoma atrx |
| GSE241701_1_v_3_daxx_mouse | wt groundstate cell line e14tg2a wildtype embryonic stem cells ground state escs (2i +vitaminc) vs daxxko cell line e14tg2a embryonic stem cells daxx knockout escs |
| GSE186440,GSE186443_3_v_7_daxx_human | daxx wt cells untreated replicate cell line u87 glioblastoma control vs atrx ko cells etoposide treated replicate cell line u87 glioblastoma |
| GSE241701_1_v_0_daxx_mouse | wt groundstate cell line e14tg2a wildtype embryonic stem cells ground state escs (2i +vitaminc) vs daxxko diff cell line e14tg2a embryonic stem cells daxx knockout neuronal differentiation (retinoic acid lif) |
| GSE164135,GSE164137_0_v_1_fbxw7_mouse | wt mouse embryonic fibroblast vs mut mouse embryonic fibroblast fbxw7 ko |
| GSE57397,GSE57399_1_v_0_fbxw7_human | rna seq analysis hct116 wt cells heat shock replicate human colon cancer cell line vs rna seq analysis hct116 fbxw7 ko cells heat shock replicate human colon cancer cell line |
| GSE212312_2_v_3_fbxw7_human | normal tonsil cell subset igm+igd+cd19+ b cells wt vs cl5 cell line reh b acute lymphoblastic leukemia pan fbxw7 knockout + reconstitution |
| GSE212312_1_v_3_fbxw7_human | reh ctrl l005 cell line b acute lymphoblastic leukemia wt vs cl5 cell line reh b acute lymphoblastic leukemia pan fbxw7 knockout + reconstitution |
| GSE234334,GSE234336_1_v_0_zhx1_mouse | ctrl cell line 46c mesc derived cp control vs ko zhx1 cell line 46c mesc derived cp |
| GSE56235_1_v_0_prdm11_human | scramble shrna control replicate plasmid plko puro (addgene 1864) cell line u2932 vs knockdown prdm11 replicate plasmid trcn0000358536/nm 020229.2 844s21c1 cell line u2932 |
| GSE235550_2_v_0_hspa9_human | siha cells shcontrol day0 cervical cancer epithelial cell line wt source gender female vs siha cells kd hspa9 day0 cervical cancer epithelial cell line knockdown source gender female |
| GSE235550_1_v_0_hspa9_human | h8 cells shcontrol day0 cervical cancer epithelial cell line immortalized wt source gender female vs siha cells kd hspa9 day0 cervical cancer epithelial cell line knockdown source gender female |
| GSE189834,GSE189836_1_v_0_brd4_mouse | wt lin ckit+ bone marrow cells strain c57bl/6 brd4 vs ko lin ckit+ bone marrow cells strain c57bl/6 brd4 |
| GSE154684_0_v_4_kdm4a_human | retinal pigmented epithelial cell cycle phase control rpe vs retinal pigmented epithelial cell cycle phase kdm4a overexpression rpe |
| GSE129733,GSE129735_1_v_0_kdm4a_mouse | 2 cell embryo wt strain c57bl/6 preimplantation age 1.5 days post fertilization (+/p ) vs 2 cell embryo ko strain c57bl/6 preimplantation age 1.5 days post fertilization kdm4a knockout ( /p ) |
| GSE254770_3_v_1_sin3b_mouse | kpc1199 cells sgctrl +ifng pancreatic tumor cell line wt ifng 10ng/ml 24hr vs kpc1199 cells sin3bsg1 ifng pancreatic tumor cell line sin3b knockout |
| GSE121857_2_v_1_sin3b_human | d11 cell line t98g human glioblastoma multiforme group crispr wt clone / serum /variation wild type vs cell line t98g human glioblastoma multiforme group crispr ko clone / serum /variation sin3b |
| GSE254770_0_v_1_sin3b_mouse | kpc1199 cells sgctrl ifng pancreatic tumor cell line wt without vs kpc1199 cells sin3bsg1 ifng pancreatic tumor cell line sin3b knockout |
| GSE234637_2_v_0_ikzf1_human | sem wildtype control treated cell line bcp wt cytarabine vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE234637_1_v_0_ikzf1_human | sem wiltdype control untreated cell line bcp wt vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE234637_3_v_0_ikzf1_human | sem ikzf1 knockout untreated cell line bcp vs sem ikzf1 knockout treated cell line bcp cytarabine |
| GSE225762_1_v_0_pcmt1_human | mda mb 231 nc cell line cells (control plasmid) vs mda mb 231 sipcmt1 cell line cells pcmt1 knockdown |
| GSE62292,GSE62295_2_v_1_col4a3_mouse | wt strain 129x1/svj wild type kidney age 9 weeks vs col4a3 ko antimir 21 strain 129x1/svj / kidney age 9 weeks |
| GSE62292,GSE62295_2_v_0_col4a3_mouse | wt strain 129x1/svj wild type kidney age 9 weeks vs col4a3 ko pbs strain 129x1/svj / kidney age 9 weeks |
| GSE193354_0_v_1_saraf_mouse | wt rep strain background b6 /variation wild type embryonic fibroblasts vs saraf ko strain background b6 /variation embryonic fibroblasts |
| GSE192513,GSE192515_2_v_0_atg16l1_mouse | atg16l1 wildtype ifng treated clone rep colon disease state tumor atg16l1+/+ ifn gamma akps crc organoids vs atg16l1 knockout ifng treated clone rep colon disease state tumor / ifn gamma akps crc organoids |
| GSE192513,GSE192515_1_v_0_atg16l1_mouse | atg16l1 wildtype untreated clone rep colon disease state tumor atg16l1+/+ none akps crc organoids vs atg16l1 knockout ifng treated clone rep colon disease state tumor / ifn gamma akps crc organoids |
| GSE126326_0_v_1_kctd1_mouse | wildtype replicate whole kidney vs knockout replicate nephron specific kctd1 whole kidney |
| GSE85874_3_v_1_kdm5c_mouse | wt ne 1 brain hippocampal wild type read pair na h novelty exploration flowcell ac89k4anxx age 2 4 months old animals adult male mice vs ko hc brain hippocampal kdm5c / (ko) read pair na non treated flowcell ac89k4anxx age 2 4 months old animals adult male mice |
| GSE85874_4_v_1_kdm5c_mouse | wt hc brain hippocampal wild type read pair na non treated flowcell ac89k4anxx age 2 4 months old animals adult male mice vs ko hc brain hippocampal kdm5c / (ko) read pair na non treated flowcell ac89k4anxx age 2 4 months old animals adult male mice |
| GSE85874_3_v_5_kdm5c_mouse | wt ne 1 brain hippocampal wild type read pair na h novelty exploration flowcell ac89k4anxx age 2 4 months old animals adult male mice vs ko ne 1 brain hippocampal kdm5c / (ko) read pair na h novelty exploration flowcell ac89k4anxx age 2 4 months old animals adult male mice |
| GSE85874_4_v_5_kdm5c_mouse | wt hc brain hippocampal wild type read pair na non treated flowcell ac89k4anxx age 2 4 months old animals adult male mice vs ko ne 1 brain hippocampal kdm5c / (ko) read pair na h novelty exploration flowcell ac89k4anxx age 2 4 months old animals adult male mice |
| GSE125486_0_v_1_rprd1b_mouse | shscrambled nih3t3 cell line embryonic fibroblasts scrambled shrna control vs shrprd1b nih3t3 cell line embryonic fibroblasts rprd1b shrna knockdown |
| GSE41879_1_v_5_samhd1_mouse | wt macrophages (s1056 s1075) strain c57bl/6 age weeks sex female wild type peritoneal mouse vs ko macrophages (s1056 s1075) strain c57bl/6 age weeks sex male samhd1 peritoneal mouse |
| GSE41879_1_v_0_samhd1_mouse | wt macrophages (s1056 s1075) strain c57bl/6 age weeks sex female wild type peritoneal mouse vs ko macrophages (s1056 s1075) strain c57bl/6 age weeks sex female samhd1 peritoneal mouse |
| GSE41879_4_v_0_samhd1_mouse | wt macrophages (s1056 s1075) strain c57bl/6 age weeks sex male wild type peritoneal mouse vs ko macrophages (s1056 s1075) strain c57bl/6 age weeks sex female samhd1 peritoneal mouse |
| GSE37236_1_v_0_samhd1_mouse | wt macrophages strain c57bl/6 /variation age weeks sex male mouse peritoneal vs ko macrophages strain c57bl/6 /variation samhd1 age weeks sex male mouse peritoneal |
| GSE224678_1_v_0_samhd1_human | wt spheroid culture model samhd1 status wild type t47d cell line vs samhd1 ko spheroids clone culture model spheroid status knock t47d cell line |
| GSE211931_2_v_3_ncoa4_mouse | ht22 cells sicontrol+dfo biol rep cell line hippocampal neuron control low iron (dfo) vs ht22 cells sincoa4+dfo biol rep cell line hippocampal neuron ncoa4 knockdown low iron (dfo) |
| GSE212772_0_v_1_ncoa4_mouse | j774 cells sicontrol biol rep cell line macrophages control sirna vs j774 cells sincoa4 biol rep cell line macrophages ncoa4 knockdown sirna |
| GSE211931_1_v_3_ncoa4_mouse | ht22 cells sincoa4 biol rep cell line hippocampal neuron ncoa4 knockdown normal iron vs ht22 cells sincoa4+dfo biol rep cell line hippocampal neuron ncoa4 knockdown low iron (dfo) |
| GSE211931_0_v_3_ncoa4_mouse | ht22 cells sicontrol biol rep cell line hippocampal neuron control normal iron vs ht22 cells sincoa4+dfo biol rep cell line hippocampal neuron ncoa4 knockdown low iron (dfo) |
| GSE160343_1_v_0_zfp36l1_human | hcc sinc liver hepatocellular carcinoma /variation control vs hcc sil1 liver hepatocellular carcinoma /variation zfp36l1 knockdown |
| GSE201454_0_v_2_ftcd_mouse | lko liver specific ftcd knockout untreated 12 month old tissues time vs den12lko liver specific ftcd knockout den12 tumorous tissues den time month 12 |
| GSE201454_1_v_4_ftcd_mouse | den12wt wildtype den12 liver nontumourous tissues wt den time month 12 vs den12lko n liver specific ftcd knockout den12 nontumourous tissues den time month 12 |
| GSE201454_1_v_2_ftcd_mouse | den12wt wildtype den12 liver nontumourous tissues wt den time month 12 vs den12lko liver specific ftcd knockout den12 tumorous tissues den time month 12 |
| GSE149760_3_v_1_elof1_human | rnaseq wt mock cell line u2os uv c dose time applicable chip antibody rpe1 icas9 vs rnaseq elofko mock cell line u2os elof1 ko uv c dose time applicable chip antibody rpe1 icas9 |
| GSE149760_3_v_5_elof1_human | rnaseq wt mock cell line u2os uv c dose time applicable chip antibody rpe1 icas9 vs rnaseq elofko uv cell line u2os elof1 ko c dose 9j/m2 time 24 hours chip antibody applicable rpe1 icas9 |
| GSE149760_0_v_1_elof1_human | rnaseq wt uv cell line u2os c dose 9j/m2 time 24 hours chip antibody applicable rpe1 icas9 vs rnaseq elofko mock cell line u2os elof1 ko uv c dose time applicable chip antibody rpe1 icas9 |
| GSE149760_0_v_5_elof1_human | rnaseq wt uv cell line u2os c dose 9j/m2 time 24 hours chip antibody applicable rpe1 icas9 vs rnaseq elofko uv cell line u2os elof1 ko c dose 9j/m2 time 24 hours chip antibody applicable rpe1 icas9 |
| GSE234289_3_v_0_rfx6_human | s3 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage3 developmental posterior foregut vs s3 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage3 developmental posterior foregut |
| GSE234289_3_v_2_rfx6_human | s3 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage3 developmental posterior foregut vs s5 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage5 developmental endocrine precursors |
| GSE234289_5_v_0_rfx6_human | s7w2 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage7 (week 2) developmental sc islet vs s3 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage3 developmental posterior foregut |
| GSE234289_5_v_1_rfx6_human | s7w2 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage7 (week 2) developmental sc islet vs s7w2 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 /+ clone 3g protocol stage stage7 (week 2) developmental sc islet |
| GSE234289_4_v_2_rfx6_human | s5 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage5 developmental endocrine precursors vs s5 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage5 developmental endocrine precursors |
| GSE234289_4_v_0_rfx6_human | s5 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage5 developmental endocrine precursors vs s3 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage3 developmental posterior foregut |
| GSE234289_3_v_1_rfx6_human | s3 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage3 developmental posterior foregut vs s7w2 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 /+ clone 3g protocol stage stage7 (week 2) developmental sc islet |
| GSE234289_5_v_2_rfx6_human | s7w2 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage7 (week 2) developmental sc islet vs s5 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 / clone 1h protocol stage stage5 developmental endocrine precursors |
| GSE234289_4_v_1_rfx6_human | s5 wt cell line h1 esc derived pancreatic cells control alleles rfx6+/+ clone 10f protocol stage stage5 developmental endocrine precursors vs s7w2 ko cell line h1 esc derived pancreatic cells mutant alleles rfx6 /+ clone 3g protocol stage stage7 (week 2) developmental sc islet |
| GSE81193_1_v_5_irf3_mouse | egfp differentiated 3t3 l1 adipocytes passage 15 sample type control overexression irf3 vs shirf3 differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 |
| GSE81193_3_v_2_irf3_mouse | shluc+lps differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown treated lps vs shirf3+lps differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 treated lps |
| GSE81193_1_v_2_irf3_mouse | egfp differentiated 3t3 l1 adipocytes passage 15 sample type control overexression irf3 vs shirf3+lps differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 treated lps |
| GSE81193_3_v_5_irf3_mouse | shluc+lps differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown treated lps vs shirf3 differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 |
| GSE102132_0_v_1_irf3_human | bec vector control replicate blood endothelial cells (bec) /variation vs virf3 replicate endothelial cells /variation v5/virf3 overexpression |
| GSE102132_2_v_1_irf3_human | lec vector control replicate lymphatic endothelial cells (lec) /variation vs virf3 replicate endothelial cells /variation v5/virf3 overexpression |
| GSE213048_1_v_2_irf3_mouse | wt hfd adipocytes mrna rep. strain c57bl/6 adipocyte thermoneutrality vs irf3 ko hfd adipocytes mrna rep. strain c57bl/6 adipocyte irf3ko thermoneutrality |
| GSE155777_0_v_1_irf3_mouse | colon wt strain background c57bl/6 /variation vs colon ko strain background c57bl/6 /variation irf3 / |
| GSE81193_0_v_4_irf3_mouse | shluc differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown vs 2d differentiated 3t3 l1 adipocytes passage 15 sample type overexpression irf3 |
| GSE81193_0_v_2_irf3_mouse | shluc differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown vs shirf3+lps differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 treated lps |
| GSE81193_0_v_5_irf3_mouse | shluc differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown vs shirf3 differentiated 3t3 l1 adipocytes passage 15 sample type knockdown irf3 |
| GSE81193_3_v_4_irf3_mouse | shluc+lps differentiated 3t3 l1 adipocytes passage 15 sample type control irf3 knockdown treated lps vs 2d differentiated 3t3 l1 adipocytes passage 15 sample type overexpression irf3 |
| GSE169590_0_v_1_rptor_human | shgfp input esophageal epithelial normal esophagus vs shm1 rptor input esophageal epithelial knockdown overexpression esophagus |
| GSE169590_0_v_5_rptor_human | shgfp input esophageal epithelial normal esophagus vs shm1 rptor rnc esophageal epithelial polyribosome bound mrnas isolated total rna ultra centrifugation knockdown overexpression esophagus |
| GSE169590_6_v_5_rptor_human | shgfp rnc esophageal epithelial polyribosome bound mrnas isolated total rna ultra centrifugation normal esophagus vs shm1 rptor rnc esophageal epithelial polyribosome bound mrnas isolated total rna ultra centrifugation knockdown overexpression esophagus |
| GSE169590_6_v_1_rptor_human | shgfp rnc esophageal epithelial polyribosome bound mrnas isolated total rna ultra centrifugation normal esophagus vs shm1 rptor input esophageal epithelial knockdown overexpression esophagus |
| GSE174586_0_v_1_slc4a11_mouse | corneal endothelium wt strain c57bl/6 slc4a11+/+ age post natal week 12 vs corneal endothelium ko strain c57bl/6 slc4a11 / age post natal week 12 |
| GSE158595_0_v_1_e4f1_mouse | e14.5 brain wt /variation developmental stage vs e14.5 brain ko /variation e4f1 developmental stage |
| GSE158285_0_v_1_ddx5_mouse | wild type mice postnatal day 2 library lane age testes mouse whole vs ddx5 conditional knockout mice postnatal day 2 library lane 4 age testes mouse whole |
| GSE199092_1_v_0_ddx5_human | dmso treated ddx5 knockdown cell line hepad38 cells vs sorafenib treated ddx5 knockdown cell line hepad38 cells |
| GSE199092_3_v_0_ddx5_human | sorafenib treated ddx5 wildtype cell line hepad38 cells vs sorafenib treated ddx5 knockdown cell line hepad38 cells |
| GSE226983_1_v_0_ddx5_mouse | shrna nc cell line atdc5 mouse teratocarcinoma cells wildtype stimulation time 6h vs shrna ddx5(il 1î²+tnf î±) cell line atdc5 mouse teratocarcinoma cells ddx5 knockdown il 1beta+tnf alpha time 6h |
| GSE226983_2_v_0_ddx5_mouse | shrna nc(il 1î²+tnf î±) cell line atdc5 mouse teratocarcinoma cells wildtype il 1beta+tnf alpha time 6h vs shrna ddx5(il 1î²+tnf î±) cell line atdc5 mouse teratocarcinoma cells ddx5 knockdown il 1beta+tnf alpha time 6h |
| GSE199092_2_v_0_ddx5_human | dmso treated ddx5 wildtype cell line hepad38 cells vs sorafenib treated ddx5 knockdown cell line hepad38 cells |
| GSE152358_1_v_0_ddx5_human | ctr cell line rh30 gene fusion pax3 foxo1 positive knockdown control rhabdomyosarcoma alveolar vs siddx5 cell line rh30 gene fusion pax3 foxo1 positive knockdown rhabdomyosarcoma alveolar |
| GSE112962,GSE112963_2_v_1_ddx5_human | sicontrol cell line bt549 eralpha negtive breast cancer cells /variation control vs siddx5 cell line bt549 eralpha negtive breast cancer cells /variation ddx5 knockdown |
| GSE148066,GSE157787_9_v_1_n4bp1_mouse | bone marrow wt 2hr samid primary time 2 hours vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_0_v_4_n4bp1_mouse | bone marrow wt 4hr samid primary time 4 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_9_v_4_n4bp1_mouse | bone marrow wt 2hr samid primary time 2 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_5_v_7_n4bp1_mouse | bone marrow wt 16hr samid primary time 16 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE148066,GSE157787_11_v_10_n4bp1_mouse | bone marrow wt 1hr samid primary time 1 hours vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_11_v_6_n4bp1_mouse | bone marrow wt 1hr samid primary time 1 hours vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_2_v_1_n4bp1_mouse | bone marrow wt untreated samid primary time 0 vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_11_v_4_n4bp1_mouse | bone marrow wt 1hr samid primary time 1 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_8_v_10_n4bp1_mouse | bone marrow wt 8hr samid primary time 8 hours vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_9_v_7_n4bp1_mouse | bone marrow wt 2hr samid primary time 2 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE148066,GSE157787_8_v_7_n4bp1_mouse | bone marrow wt 8hr samid primary time 8 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE148066,GSE157787_5_v_4_n4bp1_mouse | bone marrow wt 16hr samid primary time 16 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_11_v_7_n4bp1_mouse | bone marrow wt 1hr samid primary time 1 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE165916_1_v_2_n4bp1_mouse | strain c57bl/6j peritoneal macrophages wild type treated vs strain c57bl/6j peritoneal macrophages n4bp1 ko treated |
| GSE148066,GSE157787_0_v_10_n4bp1_mouse | bone marrow wt 4hr samid primary time 4 hours vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_8_v_4_n4bp1_mouse | bone marrow wt 8hr samid primary time 8 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_0_v_1_n4bp1_mouse | bone marrow wt 4hr samid primary time 4 hours vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_2_v_4_n4bp1_mouse | bone marrow wt untreated samid primary time 0 vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_5_v_1_n4bp1_mouse | bone marrow wt 16hr samid primary time 16 hours vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_3_v_4_n4bp1_mouse | bone marrow ko untreated samid primary n4bp1 time 0 hours vs bone marrow ko 8hr samid primary n4bp1 time 8 hours |
| GSE148066,GSE157787_5_v_10_n4bp1_mouse | bone marrow wt 16hr samid primary time 16 hours vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_3_v_6_n4bp1_mouse | bone marrow ko untreated samid primary n4bp1 time 0 hours vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_2_v_6_n4bp1_mouse | bone marrow wt untreated samid primary time 0 vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_3_v_10_n4bp1_mouse | bone marrow ko untreated samid primary n4bp1 time 0 hours vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_0_v_7_n4bp1_mouse | bone marrow wt 4hr samid primary time 4 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE148066,GSE157787_9_v_6_n4bp1_mouse | bone marrow wt 2hr samid primary time 2 hours vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_8_v_6_n4bp1_mouse | bone marrow wt 8hr samid primary time 8 hours vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_5_v_6_n4bp1_mouse | bone marrow wt 16hr samid primary time 16 hours vs bone marrow ko 4hr samid primary n4bp1 time 4 hours |
| GSE148066,GSE157787_3_v_1_n4bp1_mouse | bone marrow ko untreated samid primary n4bp1 time 0 hours vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_2_v_7_n4bp1_mouse | bone marrow wt untreated samid primary time 0 vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE148066,GSE157787_8_v_1_n4bp1_mouse | bone marrow wt 8hr samid primary time 8 hours vs bone marrow ko 1hr samid primary n4bp1 time 1 hours |
| GSE148066,GSE157787_2_v_10_n4bp1_mouse | bone marrow wt untreated samid primary time 0 vs bone marrow ko 2hr samid primary n4bp1 time 2 hours |
| GSE148066,GSE157787_3_v_7_n4bp1_mouse | bone marrow ko untreated samid primary n4bp1 time 0 hours vs bone marrow ko 16hr samid primary n4bp1 time 16 hours |
| GSE196671_5_v_1_obox4_mouse | rnaseq esc wt plab culture cell pladienolide b background strain 129/ola vs rnaseq esc obox4 ko plab culture cell single pladienolide b background strain 129/ola |
| GSE196671_6_v_0_obox4_mouse | rnaseq 2c kd emrbyo embryo wt background strain b6d2f1 vs rnaseq blastomere dux ko obox4 embryo developmental stage 2c n/ background strain b6d2f1 |
| GSE196671_5_v_8_obox4_mouse | rnaseq esc wt plab culture cell pladienolide b background strain 129/ola vs rnaseq esc double ko plab culture cell obox4/dux pladienolide b background strain 129/ola |
| GSE196671_6_v_8_obox4_mouse | rnaseq 2c kd emrbyo embryo wt background strain b6d2f1 vs rnaseq esc double ko plab culture cell obox4/dux pladienolide b background strain 129/ola |
| GSE196671_6_v_1_obox4_mouse | rnaseq 2c kd emrbyo embryo wt background strain b6d2f1 vs rnaseq esc obox4 ko plab culture cell single pladienolide b background strain 129/ola |
| GSE196671_5_v_0_obox4_mouse | rnaseq esc wt plab culture cell pladienolide b background strain 129/ola vs rnaseq blastomere dux ko obox4 embryo developmental stage 2c n/ background strain b6d2f1 |
| GSE161295_2_v_5_cdk8_mouse | shrna cdk8.1830 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs shrna cdk8.1593 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE161295_0_v_5_cdk8_mouse | non targeting shrna renilla dmso replicate cell line e0771 knockdown agent âx80x93 triple negative breast cancer vs shrna cdk8.1593 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE231891_1_v_0_cdk8_human | 293 wt snx7886 3d cell line hek293 immortalized human embryonic kidney cells 200nm 72 hours time 3 days vs 293 dko bi1347 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 200nm 72 hours time 3 days |
| GSE161295_4_v_3_cdk8_mouse | shrna cdk8.1593 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs non targeting shrna renilla senexin b replicate cell line e0771 knockdown agent âx80x93 triple negative breast cancer |
| GSE71385_1_v_0_cdk8_mouse | yamc parental small intestine wildtype mouse intestinal cells (yamc) vs yamc cdk8 ko clone 1 small intestine / mouse intestinal cells (yamc) clone1 |
| GSE161295_4_v_1_cdk8_mouse | shrna cdk8.1593 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs shrna cdk8.1830 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE231891_1_v_4_cdk8_human | 293 wt snx7886 3d cell line hek293 immortalized human embryonic kidney cells 200nm 72 hours time 3 days vs 293 dko snx7886 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 200nm 72 hours time 3 days |
| GSE161295_0_v_1_cdk8_mouse | non targeting shrna renilla dmso replicate cell line e0771 knockdown agent âx80x93 triple negative breast cancer vs shrna cdk8.1830 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE231891_3_v_4_cdk8_human | 293 dko ctrl 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 0.1percent dmso (vehicle control) 72 hours time 3 days vs 293 dko snx7886 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 200nm 72 hours time 3 days |
| GSE161295_4_v_5_cdk8_mouse | shrna cdk8.1593 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs shrna cdk8.1593 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE71385_1_v_2_cdk8_mouse | yamc parental small intestine wildtype mouse intestinal cells (yamc) vs yamc cdk8 ko clone 19 small intestine / mouse intestinal cells (yamc) clone19 |
| GSE161295_2_v_3_cdk8_mouse | shrna cdk8.1830 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs non targeting shrna renilla senexin b replicate cell line e0771 knockdown agent âx80x93 triple negative breast cancer |
| GSE231891_5_v_0_cdk8_human | 293 wt bi1347 3d cell line hek293 immortalized human embryonic kidney cells 200nm 72 hours time 3 days vs 293 dko bi1347 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 200nm 72 hours time 3 days |
| GSE161295_2_v_1_cdk8_mouse | shrna cdk8.1830 dmso replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer vs shrna cdk8.1830 senexin b replicate cell line e0771 knockdown cdk8 agent âx80x93 triple negative breast cancer |
| GSE231891_5_v_4_cdk8_human | 293 wt bi1347 3d cell line hek293 immortalized human embryonic kidney cells 200nm 72 hours time 3 days vs 293 dko snx7886 3d cell line hek293 immortalized human embryonic kidney cells cdk8/cdk19 double knockout 200nm 72 hours time 3 days |
| GSE210580_0_v_7_rag2_mouse | opc control pair cerebral cortex rag2 sex male vs oligodendrocyte ko pair cerebral cortex rag2 / sex |
| GSE210580_5_v_6_rag2_mouse | microglia control pair cerebral cortex rag2 sex male vs opc ko pair cerebral cortex rag2 / sex male |
| GSE210580_0_v_11_rag2_mouse | opc control pair cerebral cortex rag2 sex male vs astrocyte ko pair cerebral cortex rag2 / sex female |
| GSE210580_3_v_12_rag2_mouse | oligodendrocyte control pair cerebral cortex rag2 sex vs microglia ko pair cerebral cortex rag2 / sex male |
| GSE210580_3_v_11_rag2_mouse | oligodendrocyte control pair cerebral cortex rag2 sex vs astrocyte ko pair cerebral cortex rag2 / sex female |
| GSE210580_3_v_1_rag2_mouse | oligodendrocyte control pair cerebral cortex rag2 sex vs microglia ko pair cerebral cortex rag2 / sex female |
| GSE210580_0_v_12_rag2_mouse | opc control pair cerebral cortex rag2 sex male vs microglia ko pair cerebral cortex rag2 / sex male |
| GSE210580_5_v_7_rag2_mouse | microglia control pair cerebral cortex rag2 sex male vs oligodendrocyte ko pair cerebral cortex rag2 / sex |
| GSE210580_5_v_2_rag2_mouse | microglia control pair cerebral cortex rag2 sex male vs astrocyte ko pair cerebral cortex rag2 / sex male |
| GSE210580_3_v_2_rag2_mouse | oligodendrocyte control pair cerebral cortex rag2 sex vs astrocyte ko pair cerebral cortex rag2 / sex male |
| GSE210580_4_v_6_rag2_mouse | astrocyte control pair cerebral cortex rag2 sex male vs opc ko pair cerebral cortex rag2 / sex male |
| GSE210580_4_v_7_rag2_mouse | astrocyte control pair cerebral cortex rag2 sex male vs oligodendrocyte ko pair cerebral cortex rag2 / sex |
| GSE210580_3_v_6_rag2_mouse | oligodendrocyte control pair cerebral cortex rag2 sex vs opc ko pair cerebral cortex rag2 / sex male |
| GSE210580_4_v_1_rag2_mouse | astrocyte control pair cerebral cortex rag2 sex male vs microglia ko pair cerebral cortex rag2 / sex female |
| GSE210580_4_v_12_rag2_mouse | astrocyte control pair cerebral cortex rag2 sex male vs microglia ko pair cerebral cortex rag2 / sex male |
| GSE210580_0_v_1_rag2_mouse | opc control pair cerebral cortex rag2 sex male vs microglia ko pair cerebral cortex rag2 / sex female |
| GSE210580_5_v_11_rag2_mouse | microglia control pair cerebral cortex rag2 sex male vs astrocyte ko pair cerebral cortex rag2 / sex female |
| GSE210580_0_v_2_rag2_mouse | opc control pair cerebral cortex rag2 sex male vs astrocyte ko pair cerebral cortex rag2 / sex male |
| GSE182185_0_v_1_pstk_human | hep3b hepatocellular carcinoma cell line wild type liver vs hep3b ko hepatocellular carcinoma cell line pstk / liver |
| GSE53538_1_v_0_cd2bp2_mouse | wt control genetic background c57bl/6 podocytes wildtype vs ko genetic background c57bl/6 podocytes cd2bp2 knockout |
| GSE182921_0_v_1_slit2_human | cell line pc 3m non targeted control prostate cancer vs cell line pc 3m slit2 ko prostate cancer |
| GSE199189_1_v_0_creld2_mouse | con cell line raw264.7 control rankl vs oe cell line raw264.7 creld2 overexpression rankl |
| GSE62974_1_v_0_epas1_human | human endothelial sirna control huvec umbilical vein/vascular endothelium vs human endothelial sirna epas1 knockdown huvec umbilical vein/vascular endothelium |
| GSE62974_1_v_0_epas1_mouse | human endothelial sirna control huvec umbilical vein/vascular endothelium vs human endothelial sirna epas1 knockdown huvec umbilical vein/vascular endothelium |
| GSE198380_0_v_1_phgdh_human | mda mb 231 ctrl cell line breast cancer overexpression control rsmf vs mda mb 231 phgdh oe cell line breast cancer overexpression rsmf |
| GSE198380_0_v_1_phgdh_mouse | mda mb 231 ctrl cell line breast cancer overexpression control rsmf vs mda mb 231 phgdh oe cell line breast cancer overexpression rsmf |
| GSE143499_0_v_1_gata6_human | de cell line hues8 /variation wildtype differentiated endoderm cells vs gata6 as1 kd cell line hues8 /variation knockdown differentiated endoderm cells |
| GSE154246_2_v_0_haspin_mouse | e14 stem cells developmental stage e3.5 strain 12910la wt vs oe2 haspin stem cells e14 developmental stage e3.5 strain 12910la overexpression |
| GSE154246_2_v_3_haspin_mouse | e14 stem cells developmental stage e3.5 strain 12910la wt vs oe1 haspin stem cells e14 developmental stage e3.5 strain 12910la overexpression |
| GSE188721_2_v_4_mesp1_human | mrna seq wt d6 cpc human cardiac progenitor cells (day 4 post differentiation escs) wild type 6 vs mrna seq mesp1 ko d6 cpc knockout human cardiac progenitor cells (day 4 post differentiation escs) / 6 |
| GSE188721_3_v_4_mesp1_human | mrna seq wt d4 cpc human cardiac progenitor cells (day 4 post differentiation escs) wild type vs mrna seq mesp1 ko d6 cpc knockout human cardiac progenitor cells (day 4 post differentiation escs) / 6 |
| GSE188721_2_v_1_mesp1_human | mrna seq wt d6 cpc human cardiac progenitor cells (day 4 post differentiation escs) wild type 6 vs mrna seq mesp1 ko d4 cpc knockout human cardiac progenitor cells (day 4 post differentiation escs) / |
| GSE188721_3_v_1_mesp1_human | mrna seq wt d4 cpc human cardiac progenitor cells (day 4 post differentiation escs) wild type vs mrna seq mesp1 ko d4 cpc knockout human cardiac progenitor cells (day 4 post differentiation escs) / |
| GSE244072_4_v_1_tfeb_mouse | ksp cre tsc2+tfeb dko vehicle treated replicate kidney mixed control vs cagg cre tfeb ko kidney replicate mixed none |
| GSE221356_1_v_0_tfeb_mouse | podocyte scramble kidney cell line immortalized mouse wt transfection scrambled sirna vs podocyte tfeb sirna kidney cell line immortalized mouse knockdown transfection |
| GSE244072_4_v_0_tfeb_mouse | ksp cre tsc2+tfeb dko vehicle treated replicate kidney mixed control vs ksp cre tsc2 ko kidney replicate mixed none |
| GSE244072_4_v_6_tfeb_mouse | ksp cre tsc2+tfeb dko vehicle treated replicate kidney mixed control vs cagg cre tsc2 ko kidney replicate mixed none |
| GSE244072_10_v_7_tfeb_mouse | ksp cre tsc2 ko kidney vehicle treated replicate mixed control vs ksp cre tsc2+tfeb dko replicate kidney mixed none |
| GSE244072_11_v_1_tfeb_mouse | ksp cre control kidney rapamycin treated replicate mixed wild type 1mg/kg/3 times per week vs cagg cre tfeb ko kidney replicate mixed none |
| GSE244072_10_v_9_tfeb_mouse | ksp cre tsc2 ko kidney vehicle treated replicate mixed control vs ksp cre tfeb ko kidney replicate mixed none |
| GSE244072_10_v_8_tfeb_mouse | ksp cre tsc2 ko kidney vehicle treated replicate mixed control vs cagg cre tsc2+tfeb dko kidney replicate mixed none |
| GSE244072_4_v_9_tfeb_mouse | ksp cre tsc2+tfeb dko vehicle treated replicate kidney mixed control vs ksp cre tfeb ko kidney replicate mixed none |
| GSE244072_2_v_1_tfeb_mouse | ksp cre control kidney vehicle treated replicate mixed wild type vs cagg cre tfeb ko kidney replicate mixed none |
| GSE244072_12_v_1_tfeb_mouse | ksp cre control kidney replicate mixed wild type none vs cagg cre tfeb ko kidney replicate mixed none |
| GSE244072_5_v_9_tfeb_mouse | cagg cre control kidney replicate mixed wild type none vs ksp cre tfeb ko kidney replicate mixed none |
| GSE244072_10_v_1_tfeb_mouse | ksp cre tsc2 ko kidney vehicle treated replicate mixed control vs cagg cre tfeb ko kidney replicate mixed none |
| GSE244072_10_v_3_tfeb_mouse | ksp cre tsc2 ko kidney vehicle treated replicate mixed control vs ksp cre tsc2+tfeb dko rapamycin treated replicate kidney mixed 1mg/kg/3 times per week |
| GSE207863_0_v_1_hdac5_human | bxpc 3 cell line shcontrol human pancreatic cancer cells wt time day vs bxpc 3 cell line shhdac5 human pancreatic cancer cells hdac5 knockdown time day |
| GSE127205_1_v_0_asf1a_mouse | kp lung tumor cells sample type vitro cultured cell line strain/background c57bl/6 /variation asf1a wt vs asf1a ko kp lung tumor cells sample type vitro cultured cell line strain/background c57bl/6 /variation |
| GSE237984_1_v_2_magi1_human | mcf7 empty vector replica er+ breast cancer cell line carcinoma magi1 wt lentivirus transduction vs mcf7 magi1 ko seqb replica er+ breast cancer cell line carcinoma lentivirus transduction targeting vector |
| GSE237984_1_v_0_magi1_human | mcf7 empty vector replica er+ breast cancer cell line carcinoma magi1 wt lentivirus transduction vs mcf7 magi1 ko seqa replica er+ breast cancer cell line carcinoma lentivirus transduction targeting vector |
| GSE118077_7_v_2_sprr5_human | d3 sicontrol organotypic human epidermis control sipool day differentiation 3 pooled primary keratinocytes vs d3 sisprr5 organotypic human epidermis sipool efficient knockdown sprr5 day differentiation 3 pooled primary keratinocytes |
| GSE118077_7_v_8_sprr5_human | d3 sicontrol organotypic human epidermis control sipool day differentiation 3 pooled primary keratinocytes vs d4 sisprr5 organotypic human epidermis sipool efficient knockdown sprr5 day differentiation 4 pooled primary keratinocytes |
| GSE118077_1_v_8_sprr5_human | d3 sictrl organotypic human epidermis control sipool day differentiation 3 pooled primary keratinocytes vs d4 sisprr5 organotypic human epidermis sipool efficient knockdown sprr5 day differentiation 4 pooled primary keratinocytes |
| GSE118077_4_v_2_sprr5_human | d4 sictrl organotypic human epidermis control sipool day differentiation 4 pooled primary keratinocytes vs d3 sisprr5 organotypic human epidermis sipool efficient knockdown sprr5 day differentiation 3 pooled primary keratinocytes |
| GSE118077_1_v_2_sprr5_human | d3 sictrl organotypic human epidermis control sipool day differentiation 3 pooled primary keratinocytes vs d3 sisprr5 organotypic human epidermis sipool efficient knockdown sprr5 day differentiation 3 pooled primary keratinocytes |
| GSE229914_1_v_3_keap1_human | arh 77 wt dmso rep cell line b vs arh 77 keap1 ko 0.4 î¼m cddo 2p im rep cell line b |
| GSE216352,GSE216354_1_v_0_keap1_human | thp 1 derived macrophages sgctrl 8h cell line macrophage wt lps ifn î³ stimulated 8 h vs thp 1 derived macrophages sgkeap1 cell line macrophage keap1 knockout lps ifn î³ |
| GSE239436,GSE239441_0_v_1_keap1_mouse | qko tumor control sample lung cell line n/ small cancer vs qko tumor keap1 knockout sample lung cell line n/ small cancer |
| GSE229914_2_v_3_keap1_human | arh 77 keap1 ko rep cell line b dmso vs arh 77 keap1 ko 0.4 î¼m cddo 2p im rep cell line b |
| GSE148658_1_v_0_six6_human | jurkat ctrl vector empty replicate cas9 cell line vs jurkat six6 ko vector replicate cas9 cell line |
| GSE174735_2_v_0_il22_mouse | (c57bl/6n) bladder upec 72hrs wt (hrs) 72 strain c57bl/6n vs ko bladder upec 24hrs il22r (hrs) 24 strain c57bl/6n |
| GSE174735_4_v_0_il22_mouse | (c57bl/6n) bladder pbs 24hrs wt (hrs) 24 strain c57bl/6n vs ko bladder upec 24hrs il22r (hrs) 24 strain c57bl/6n |
| GSE159423_1_v_0_il22_mouse | wt il22ra1fl/fl defa6 cre terminal ileum age 6 weeks murine small intestinal vs ko il22ra1fl/fl defa6 cre+ terminal ileum age 6 weeks murine small intestinal |
| GSE174735_1_v_0_il22_mouse | (c57bl/6n) bladder pbs 72hrs wt (hrs) 72 strain c57bl/6n vs ko bladder upec 24hrs il22r (hrs) 24 strain c57bl/6n |
| GSE174735_1_v_3_il22_mouse | (c57bl/6n) bladder pbs 72hrs wt (hrs) 72 strain c57bl/6n vs ko bladder upec 72hrs il22r (hrs) 72 strain c57bl/6n |
| GSE174735_4_v_3_il22_mouse | (c57bl/6n) bladder pbs 24hrs wt (hrs) 24 strain c57bl/6n vs ko bladder upec 72hrs il22r (hrs) 72 strain c57bl/6n |
| GSE110676_0_v_4_mef2b_mouse | gc bcells wt spleen /variation mef2b+/+ cg1cre/+ germinal center b cells vs gc bcells ko d83v spleen /variation mef2bd83vstop/fl cg1cre/+ germinal center b cells |
| GSE215086_4_v_7_batf_human | hypofunction 1 blood primary cells car wt co culture nci h226 luciferase e =0.1 7 days vs m28z bko 1 blood primary cells car batf knockout co culture nci h226 luciferase e =0.1 7 days |
| GSE215086_0_v_2_batf_mouse | ot 1 spleen primary cells wt three rounds tumor challenge vs ot 1 boe spleen primary cells batf overexpression three rounds tumor challenge |
| GSE215086_5_v_0_batf_human | unstimulated blood primary cells car wt culture 9 days resuscitating vs m28z boe multiround blood primary cells car batf overexpression three rounds tumor challenge |
| GSE215086_8_v_6_batf_human | m28z multiround blood primary cells car wt three rounds tumor challenge vs m28z bko multiround blood primary cells car batf knockout three rounds tumor challenge |
| GSE215086_4_v_6_batf_human | hypofunction 1 blood primary cells car wt co culture nci h226 luciferase e =0.1 7 days vs m28z bko multiround blood primary cells car batf knockout three rounds tumor challenge |
| GSE215086_5_v_7_batf_human | unstimulated blood primary cells car wt culture 9 days resuscitating vs m28z bko 1 blood primary cells car batf knockout co culture nci h226 luciferase e =0.1 7 days |
| GSE215086_8_v_7_batf_human | m28z multiround blood primary cells car wt three rounds tumor challenge vs m28z bko 1 blood primary cells car batf knockout co culture nci h226 luciferase e =0.1 7 days |
| GSE215086_0_v_1_batf_human | ot 1 spleen primary cells wt three rounds tumor challenge vs ot 1 bko spleen primary cells batf knockout three rounds tumor challenge |
| GSE215086_3_v_7_batf_human | activated 1 blood primary cells car wt co culture nci h226 luciferase e =2 24h vs m28z bko 1 blood primary cells car batf knockout co culture nci h226 luciferase e =0.1 7 days |
| GSE215086_3_v_6_batf_human | activated 1 blood primary cells car wt co culture nci h226 luciferase e =2 24h vs m28z bko multiround blood primary cells car batf knockout three rounds tumor challenge |
| GSE215086_0_v_1_batf_mouse | ot 1 spleen primary cells wt three rounds tumor challenge vs ot 1 bko spleen primary cells batf knockout three rounds tumor challenge |
| GSE215086_3_v_0_batf_human | activated 1 blood primary cells car wt co culture nci h226 luciferase e =2 24h vs m28z boe multiround blood primary cells car batf overexpression three rounds tumor challenge |
| GSE149854_1_v_0_batf_mouse | rna ilc2 wt strain batffl/flplzf cre infection influenza /pr8/34 lung lin cd90.2+st2+ /variation wild type vs rna ilc2 batf ko strain batffl/flplzf infection influenza /pr8/34 lung lin cd90.2+st2+ /variation |
| GSE215086_0_v_2_batf_human | ot 1 spleen primary cells wt three rounds tumor challenge vs ot 1 boe spleen primary cells batf overexpression three rounds tumor challenge |
| GSE215086_1_v_6_batf_human | fresh blood primary cells car wt none vs m28z bko multiround blood primary cells car batf knockout three rounds tumor challenge |
| GSE168076,GSE168080_1_v_0_batf_mouse | rna ilc3 wt strain background b6 /variation batffl/flplzf cre small intestine lin cd90.2+klrg1 vs rna ilc3 batf ko strain background b6 /variation batffl/flplzf cre+ small intestine lin cd90.2+klrg1 |
| GSE215086_5_v_6_batf_human | unstimulated blood primary cells car wt culture 9 days resuscitating vs m28z bko multiround blood primary cells car batf knockout three rounds tumor challenge |
| GSE215086_8_v_0_batf_human | m28z multiround blood primary cells car wt three rounds tumor challenge vs m28z boe multiround blood primary cells car batf overexpression three rounds tumor challenge |
| GSE215086_1_v_7_batf_human | fresh blood primary cells car wt none vs m28z bko 1 blood primary cells car batf knockout co culture nci h226 luciferase e =0.1 7 days |
| GSE231799_2_v_4_nfkbie_mouse | mock peritoneal blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie vitro blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE231799_2_v_1_nfkbie_mouse | mock peritoneal blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie peritoneal blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE231799_2_v_5_nfkbie_mouse | mock peritoneal blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie spleen blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE231799_3_v_5_nfkbie_mouse | mock spleen blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie spleen blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE231799_3_v_4_nfkbie_mouse | mock spleen blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie vitro blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE231799_3_v_1_nfkbie_mouse | mock spleen blood cell line tcl1 355 tko leukemia nfkbie wild type wt cells vs nfkbie peritoneal blood cell line tcl1 355 tko leukemia targeted exon 2 gene nucleofection mediated delivery ribonucleoprotein complex containing recombinant cas9 guide rna ko cells |
| GSE149870_0_v_1_pfn1_mouse | wt cath. differentiated cell line /variation control ko vs pfn1 cath. differentiated cell line /variation ko |
| GSE211744_7_v_1_gdf15_mouse | kl wt male oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko male roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_2_v_5_gdf15_mouse | kl wt female oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko female oxygen strain c57bl6 lung age pnd 21 mixed gdf15 knockdown hyperoxia sex |
| GSE211744_8_v_0_gdf15_mouse | kl wt female roomair strain c57bl6 lung age pnd 21 mixed room air sex vs kl ko male oxygen strain c57bl6 lung age pnd 21 mixed gdf15 knockdown hyperoxia sex |
| GSE211744_2_v_4_gdf15_mouse | kl wt female oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko female roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_8_v_5_gdf15_mouse | kl wt female roomair strain c57bl6 lung age pnd 21 mixed room air sex vs kl ko female oxygen strain c57bl6 lung age pnd 21 mixed gdf15 knockdown hyperoxia sex |
| GSE211744_8_v_1_gdf15_mouse | kl wt female roomair strain c57bl6 lung age pnd 21 mixed room air sex vs kl ko male roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_2_v_1_gdf15_mouse | kl wt female oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko male roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_7_v_4_gdf15_mouse | kl wt male oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko female roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_2_v_0_gdf15_mouse | kl wt female oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko male oxygen strain c57bl6 lung age pnd 21 mixed gdf15 knockdown hyperoxia sex |
| GSE211744_8_v_4_gdf15_mouse | kl wt female roomair strain c57bl6 lung age pnd 21 mixed room air sex vs kl ko female roomair strain c57bl6 lung age pnd 21 mixed gdf15 knockdown room air sex |
| GSE211744_7_v_0_gdf15_mouse | kl wt male oxygen strain c57bl6 lung age pnd 21 mixed hyperoxia sex vs kl ko male oxygen strain c57bl6 lung age pnd 21 mixed gdf15 knockdown hyperoxia sex |
| GSE80305_2_v_0_cop1_human | gist882 sicop1 cell line knockdown cop1 dmso human gist cells vs gist882 sicop1 cell line knockdown cop1 100nm pd0325901 human gist cells |
| GSE145445,GSE145454_0_v_1_cop1_mouse | brain wt sample id primary microglia vivo vs brain loxp sample id primary (cop1 ko microglia) microglia vivo |
| GSE141328_3_v_2_rock2_mouse | germinal center b cells wt mice rnaseq strain c57bl/6 rock2 flox/flox spleen age 10 weeks vs folicular b cells rock2 conditional ko mice rnaseq strain c57bl/6 rock2flox/flox cd23 cre spleen age 10 weeks |
| GSE141328_1_v_0_rock2_mouse | folicular b cells wt mice rnaseq strain c57bl/6 rock2 flox/flox spleen age 10 weeks vs germinal center b cells rock2 conditional ko mice rnaseq strain c57bl/6 rock2flox/flox cd23 cre spleen age 10 weeks |
| GSE253795_1_v_0_alkbh5_human | a375 cells shctrl input skin cell line melanoma wild type rip antibody none vs a375 cells shalkbh5 input skin cell line melanoma alkbh5 knockdown rip antibody none |
| GSE226415_0_v_1_alkbh5_mouse | heart input rip antibody wt myocardial infarction vs heart input rip antibody alkbh5 ko myocardial infarction |
| GSE203267_0_v_1_alkbh5_human | synovial tissues cell line rheumatoid fibroblast like synoviocytes wt scramble lentivirus vs synovial tissues cell line rheumatoid fibroblast like synoviocytes alkbh5 knockdown shrna lentivirus |
| GSE139992_1_v_3_mboat7_mouse | wt whole liver mboat7 wildtype diet high fat methionine low choline deficient duration 6wk vs ko whole liver mboat7 deleted hepatocytes diet high fat methionine low choline deficient duration 6wk |
| GSE139992_2_v_3_mboat7_mouse | wt whole liver mboat7 wildtype diet chow duration 10wk old vs ko whole liver mboat7 deleted hepatocytes diet high fat methionine low choline deficient duration 6wk |
| GSE138945,GSE138947_0_v_1_mboat7_mouse | control aso [rnh strain background c57bl6/j /variation mboat7 normal liver homogenate vs mboat7 aso [rnh strain background c57bl6/j /variation knockdown severe fatty liver homogenate |
| GSE139992_1_v_0_mboat7_mouse | wt whole liver mboat7 wildtype diet high fat methionine low choline deficient duration 6wk vs ko whole liver mboat7 deleted hepatocytes diet chow duration 10wk old |
| GSE115763_3_v_1_klf6_human | 786 m1a ntc18 rep cell line renal cancer non targeting crispri control cells vs 786 m1a klf6i rep cell line renal cancer crispri âx80x93 iklf6 klf6 knockdown cells |
| GSE131161_2_v_6_rarres1_mouse | wild type embryo [t00 strain background c57bl/6 gentotype/variation age embryonic day 19.5 lung pathology non tumor vs rarres1 ko 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor |
| GSE131161_1_v_4_rarres1_mouse | rarres1 ko 18 month male (normal) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko 18 month male (tumor) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology tumor |
| GSE131161_5_v_0_rarres1_mouse | wild type 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko embryo [t00 strain background c57bl/6 gentotype/variation age embryonic day 19.5 lung pathology non tumor |
| GSE131161_3_v_6_rarres1_mouse | wild type 18 month male [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor |
| GSE131161_5_v_6_rarres1_mouse | wild type 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor |
| GSE131161_3_v_0_rarres1_mouse | wild type 18 month male [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko embryo [t00 strain background c57bl/6 gentotype/variation age embryonic day 19.5 lung pathology non tumor |
| GSE131161_3_v_4_rarres1_mouse | wild type 18 month male [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko 18 month male (tumor) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology tumor |
| GSE131161_5_v_4_rarres1_mouse | wild type 10 month male [t10 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko 18 month male (tumor) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology tumor |
| GSE131161_1_v_0_rarres1_mouse | rarres1 ko 18 month male (normal) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology non tumor vs rarres1 ko embryo [t00 strain background c57bl/6 gentotype/variation age embryonic day 19.5 lung pathology non tumor |
| GSE131161_2_v_4_rarres1_mouse | wild type embryo [t00 strain background c57bl/6 gentotype/variation age embryonic day 19.5 lung pathology non tumor vs rarres1 ko 18 month male (tumor) [t18 strain background c57bl/6 gentotype/variation age months birth sex lung pathology tumor |
| GSE112763,GSE112767_4_v_1_dgcr8_mouse | wt high polysome embryonic stem cells /variation wild type fraction escs vs dgcr8ko high polysome embryonic stem cells /variation dgcr8 ko fraction escs |
| GSE112762,GSE112767_1_v_3_dgcr8_mouse | wt total rna embryonic stem cells wild type escs vs dgcr8ko total rna embryonic stem cells dgcr8 ko type escs ddx8ko |
| GSE112762,GSE112767_1_v_0_dgcr8_mouse | wt total rna embryonic stem cells wild type escs vs dgcr8ko 4su embryonic stem cells dgcr8 ko type escs ddx8ko |
| GSE112763,GSE112767_4_v_5_dgcr8_mouse | wt high polysome embryonic stem cells /variation wild type fraction escs vs dgcr8ko low polysome embryonic stem cells /variation dgcr8 ko fraction escs |
| GSE112763,GSE112767_2_v_3_dgcr8_mouse | wt mono polysome embryonic stem cells /variation wild type fraction monosome escs vs dgcr8ko mono polysome embryonic stem cells /variation dgcr8 ko fraction monosome escs |
| GSE112762,GSE112767_2_v_0_dgcr8_mouse | wt 4su embryonic stem cells wild type escs vs dgcr8ko 4su embryonic stem cells dgcr8 ko type escs ddx8ko |
| GSE73376_1_v_0_dgcr8_human | sinon cell line hela control knockdown barcode vs sidgcr8 cell line hela knockdown barcode |
| GSE112763,GSE112767_0_v_1_dgcr8_mouse | wt low polysome embryonic stem cells /variation wild type fraction escs vs dgcr8ko high polysome embryonic stem cells /variation dgcr8 ko fraction escs |
| GSE112763,GSE112767_4_v_3_dgcr8_mouse | wt high polysome embryonic stem cells /variation wild type fraction escs vs dgcr8ko mono polysome embryonic stem cells /variation dgcr8 ko fraction monosome escs |
| GSE112763,GSE112767_2_v_1_dgcr8_mouse | wt mono polysome embryonic stem cells /variation wild type fraction monosome escs vs dgcr8ko high polysome embryonic stem cells /variation dgcr8 ko fraction escs |
| GSE58498,GSE58501_2_v_3_dgcr8_mouse | wt cones replicate [rna seq] strain/background c57bl/6 /variation wild type (d4 cre/ai9 tdtomato) retina cone photoreceptors age postnatal day facs sorted mice vs c dgcr8 ko cones replicate [rna seq] strain/background c57bl/6 /variation (d4 cre/dgcr8 ko/ai9 tdtomato) retina cone photoreceptors age postnatal day facs sorted mice |
| GSE112762,GSE112767_2_v_3_dgcr8_mouse | wt 4su embryonic stem cells wild type escs vs dgcr8ko total rna embryonic stem cells dgcr8 ko type escs ddx8ko |
| GSE112763,GSE112767_2_v_5_dgcr8_mouse | wt mono polysome embryonic stem cells /variation wild type fraction monosome escs vs dgcr8ko low polysome embryonic stem cells /variation dgcr8 ko fraction escs |
| GSE112763,GSE112767_0_v_3_dgcr8_mouse | wt low polysome embryonic stem cells /variation wild type fraction escs vs dgcr8ko mono polysome embryonic stem cells /variation dgcr8 ko fraction monosome escs |
| GSE92434_1_v_0_ebf1_mouse | rna seq fl prob wt strain background c57bl6/j / variation wild type vs rna seq fl prob ebf ko strain background c57bl6/j / variation ebf1 knock |
| GSE136238_1_v_3_ebf1_mouse | bm ebf1 ko 4oht 72h withdrawal [ebf1 ctl strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression rna seq witdrawel vs bm ebf1 ko 4oht [ebf1 ctl+4oht strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression rna seq cultured |
| GSE127970_2_v_3_ebf1_mouse | pas cells ebf1+/+ prx1+/cre âx80x93 wt replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+ sca1+ vs car cells âx80x93 ebf1fl/fl prx1+/cre ko replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+sca1 |
| GSE127970_2_v_0_ebf1_mouse | pas cells ebf1+/+ prx1+/cre âx80x93 wt replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+ sca1+ vs pas cells âx80x93 ebf1fl/fl prx1+/cre ko replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+ sca1+ |
| GSE136238_1_v_2_ebf1_mouse | bm ebf1 ko 4oht 72h withdrawal [ebf1 ctl strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression rna seq witdrawel vs bm ebf1 ko er 4oht [ebf1 er+4oht strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression tamoxifen dependant rna seq cultured |
| GSE127970_1_v_3_ebf1_mouse | car cells ebf1+/+ prx1+/cre âx80x93 wt replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+sca1 vs car cells âx80x93 ebf1fl/fl prx1+/cre ko replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+sca1 |
| GSE188884,GSE189078_2_v_3_ebf1_mouse | mpp3 wt rep bone marrow strain c57bl/6 ebf1fl/fl tie2cre+/+ sex age weeks old vs mpp4 ebf1 ko rep bone marrow strain c57bl/6 ebf1fl/fl tie2cre +/cre sex age weeks old |
| GSE136238_1_v_0_ebf1_mouse | bm ebf1 ko 4oht 72h withdrawal [ebf1 ctl strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression rna seq witdrawel vs bm ebf1 ko er 4oht 72h withdrawal [ebf1 strain background f2 (c57bl6 ebf1kox129) bone marrow / b cell progenitor cells /variation retrovirally transduced pmig stable expression tamoxifen dependant rna seq witdrawel |
| GSE127970_1_v_0_ebf1_mouse | car cells ebf1+/+ prx1+/cre âx80x93 wt replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+sca1 vs pas cells âx80x93 ebf1fl/fl prx1+/cre ko replicate strain c57bl/6 bone marrow cd45 cd31 lin pdgfrî±+ sca1+ |
| GSE181513_2_v_1_usp7_human | 293a wildtype wt vs usp7 ko |
| GSE181513_0_v_1_usp7_human | wt vs usp7 ko |
| GSE197257_0_v_1_gpd2_mouse | 4t1 wt strain balb/c cell line breast cancer wildtype vs 4t1 gpd2 ko strain balb/c cell line breast cancer / |
| GSE227039_1_v_0_lamtor5_mouse | bone marrow bmdm wt csf induced vs bone marrow bmdm lamtor5 knockdown csf induced |
| GSE230354_0_v_1_rheb_mouse | rheb floxp/floxp ribo ha k/+ p25 cortex neuron control cortical lysate ip anti antibody bound dynabeads vs rheb floxp/floxp ribo ha k/+ syn cre p25 cortex neuron knockdown cortical lysate ip anti antibody bound dynabeads |
| GSE180200,GSE180201_15_v_1_qpctl_mouse | spleen (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks whole organ vs ln (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ |
| GSE180200,GSE180201_12_v_6_qpctl_mouse | ln (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ vs cd45 negative cells (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 14 days post sorted tmes |
| GSE180200,GSE180201_5_v_6_qpctl_mouse | bm (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ vs cd45 negative cells (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 14 days post sorted tmes |
| GSE180200,GSE180201_15_v_6_qpctl_mouse | spleen (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks whole organ vs cd45 negative cells (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 14 days post sorted tmes |
| GSE180200,GSE180201_2_v_9_qpctl_mouse | ln (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ vs bm (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ |
| GSE180200,GSE180201_3_v_0_qpctl_mouse | cd45 negative cells (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 14 days post sorted tmes vs spleen (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks whole organ |
| GSE180200,GSE180201_3_v_11_qpctl_mouse | cd45 negative cells (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 14 days post sorted tmes vs ln (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ |
| GSE180200,GSE180201_5_v_11_qpctl_mouse | bm (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ vs ln (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ |
| GSE180200,GSE180201_15_v_11_qpctl_mouse | spleen (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks whole organ vs ln (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ |
| GSE180200,GSE180201_3_v_6_qpctl_mouse | cd45 negative cells (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 14 days post sorted tmes vs cd45 negative cells (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 14 days post sorted tmes |
| GSE180200,GSE180201_2_v_0_qpctl_mouse | ln (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ vs spleen (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks whole organ |
| GSE180200,GSE180201_3_v_1_qpctl_mouse | cd45 negative cells (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 14 days post sorted tmes vs ln (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ |
| GSE180200,GSE180201_12_v_0_qpctl_mouse | ln (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ vs spleen (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks whole organ |
| GSE180200,GSE180201_3_v_9_qpctl_mouse | cd45 negative cells (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 14 days post sorted tmes vs bm (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ |
| GSE180200,GSE180201_2_v_6_qpctl_mouse | ln (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks lymph nodes whole organ vs cd45 negative cells (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 14 days post sorted tmes |
| GSE180200,GSE180201_5_v_0_qpctl_mouse | bm (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ vs spleen (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks whole organ |
| GSE180200,GSE180201_15_v_9_qpctl_mouse | spleen (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks whole organ vs bm (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ |
| GSE180200,GSE180201_5_v_1_qpctl_mouse | bm (qpctl wt) strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ vs ln (qpctl ko) tumor bearing strain qpctl ko c57/bl6jr homozygous innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ |
| GSE180200,GSE180201_12_v_9_qpctl_mouse | ln (qpctl wt) tumor bearing strain qpctl ko c57/bl6jr wild type allele (littermate) innoculation b16f10 cells 14 days post lymph nodes ( ) whole organ vs bm (qpctl ko) strain qpctl ko c57/bl6jr homozygous innoculation (baseline) baseline animals aged 10 15 wks bone marrow whole organ |
| GSE96777,GSE96778_1_v_0_zbtb4_human | hela wt clone cell line /variation vs u2os zbtb48 ko clone cell line /variation |
| GSE96777,GSE96778_3_v_0_zbtb4_human | u2os wt clone cell line /variation vs u2os zbtb48 ko clone cell line /variation |
| GSE96777,GSE96778_3_v_2_zbtb4_human | u2os wt clone cell line /variation vs hela zbtb48 ko clone cell line /variation |
| GSE171845_4_v_2_ccne1_human | control/baseline population 0 ng dox ( ccne1 overexpression) [t0 cell line rpe1 htert cells plasmid construct pinducer20 untreated retrovirus vs acute population day 2 (âx80x9cacuteâx80x9d ccne1 overexpression 48h) [t1 cell line rpe1 htert cells plasmid construct pinducer20 treated 20 ng/ml dox 48h retrovirus |
| GSE171845_4_v_3_ccne1_human | control/baseline population 0 ng dox ( ccne1 overexpression) [t0 cell line rpe1 htert cells plasmid construct pinducer20 untreated retrovirus vs adapted population days ccne1 overexpression allowed grow w/x induction [t4 cell line rpe1 htert cells plasmid construct pinducer20 growing dox cultured without retrovirus |
| GSE144120_3_v_1_plcg2_human | ipsc 1 derived microglia wt none dose 0 unit ug/ml duration 24 hours sex female group ipsc1 sample id vs plcg2 ko ipsc derived microglia / dose unit ug/ml duration 24 hours sex female 1 group sample id |
| GSE123022,GSE123030_2_v_6_trem2_mouse | strain c57bl6j wild type brain age p7 gate cd45lowcd11+ plate id 1001200160 well pooled library names n571 trem2 total counts detected genes qc ercc correlation 3 criteria microglia vs strain c57bl6j trem2 ko brain age p7 gate cd45lowcd11+gpnmb+clec7a+ plate id 1001200165 well pooled library names n571 total counts detected genes qc ercc correlation 3 criteria microglia |
| GSE157635_1_v_0_trem2_human | wt differentiation age weeks sex male wild type human microglia like ipsc macrophages (pmac) isogenic induced pluripotent stem cell (ipsc) line rin pmac vs trem2 ko differentiation age weeks sex male human microglia like ipsc macrophages (pmac) isogenic induced pluripotent stem cell (ipsc) line rin pmac |
| GSE123022,GSE123030_8_v_0_trem2_mouse | strain c57bl6j wild type brain age p7 gate plate id well pooled library names n571 trem2 total counts detected genes qc ercc correlation 3 criteria microglia vs strain c57bl6j trem2 ko brain age p7 gate cd45lowcd11+ plate id 1001200163 well pooled library names n571 total counts detected genes qc ercc correlation 3 criteria microglia |
| GSE124097_3_v_0_trem2_mouse | wt strain c57bl/6 age 4 5 months bone marrow derived macrophage vs trem2 ko strain c57bl/6 age 4 5 months 5bp bone marrow derived macrophage |
| GSE123022,GSE123030_2_v_0_trem2_mouse | strain c57bl6j wild type brain age p7 gate cd45lowcd11+ plate id 1001200160 well pooled library names n571 trem2 total counts detected genes qc ercc correlation 3 criteria microglia vs strain c57bl6j trem2 ko brain age p7 gate cd45lowcd11+ plate id 1001200163 well pooled library names n571 total counts detected genes qc ercc correlation 3 criteria microglia |
| GSE160017,GSE160022_1_v_0_trem2_mouse | kupffer cells wt liver sex male control high fat diet model vs kupffer cells ko liver sex male trem2 high fat diet model |
| GSE230573_1_v_0_dcaf1_human | g361 cells shcontrol cell line melanoma wt ld611 vs g361 cells shdcaf1 cell line melanoma dcaf1 knockdown ld611 |
| GSE130217_0_v_2_sesn2_mouse | lv sham strain c57bl/6 wt age 3 4 months left ventricle young vs lv sham sesn2 strain c57bl/6 / age 3 4 months left ventricle ko |
| GSE130217_0_v_3_sesn2_mouse | lv sham strain c57bl/6 wt age 3 4 months left ventricle young vs lv ir sesn2 strain c57bl/6 / age 3 4 months left ventricle ko |
| GSE130217_5_v_3_sesn2_mouse | lv sham strain c57bl/6 wt age 24 26 months left ventricle aged vs lv ir sesn2 strain c57bl/6 / age 3 4 months left ventricle ko |
| GSE130217_5_v_2_sesn2_mouse | lv sham strain c57bl/6 wt age 24 26 months left ventricle aged vs lv sham sesn2 strain c57bl/6 / age 3 4 months left ventricle ko |
| GSE196259_2_v_0_gcm1_human | ctrl ct placenta derived trophoblasts wildtype cytotrophoblast vs gcm1 kd1 ct placenta derived trophoblasts knockdown cytotrophoblast |
| GSE196259_2_v_3_gcm1_human | ctrl ct placenta derived trophoblasts wildtype cytotrophoblast vs gcm1 kd1 evt placenta derived trophoblasts knockdown extravillous trophoblast |
| GSE196259_1_v_3_gcm1_human | ctrl evt placenta derived trophoblasts wildtype extravillous trophoblast vs gcm1 kd1 evt placenta derived trophoblasts knockdown extravillous trophoblast |
| GSE229698_1_v_2_traf7_mouse | wt rep mouse embryo developmental stage e9.5 wild type none vs traf7 gloko rep mouse embryo developmental stage e9.5 global knockout none |
| GSE229698_1_v_3_traf7_mouse | wt rep mouse embryo developmental stage e9.5 wild type none vs traf7 ecko rep mouse embryo developmental stage e9.5 endothelim specific knockout none |
| GSE97278,GSE97280_2_v_1_nsd2_mouse | wt pretreated rep /variation strain c57bl/6 group murine embryonic fibroblasts (mefs) vs nsd2 ko pretreated rep /variation strain c57bl/6 group murine embryonic fibroblasts (mefs) |
| GSE232564,GSE232566_3_v_1_nsd2_mouse | e15.5 brain female wt developmental stage sex vs e15.5 brain male nsd2 knockout sex |
| GSE97278,GSE97280_2_v_3_nsd2_mouse | wt pretreated rep /variation strain c57bl/6 group murine embryonic fibroblasts (mefs) vs nsd2 ko naive rep /variation strain c57bl/6 group murine embryonic fibroblasts (mefs) |
| GSE232564,GSE232566_0_v_2_nsd2_mouse | e15.5 brain male wt sex vs e15.5 brain female nsd2 knockout developmental stage sex |
| GSE232564,GSE232566_0_v_1_nsd2_mouse | e15.5 brain male wt sex vs e15.5 brain male nsd2 knockout sex |
| GSE143955_1_v_0_ripk1_mouse | wild type p3 epidermis vs ripk1e ko total skin |
| GSE143955_1_v_2_ripk1_mouse | wild type p3 epidermis vs ripk1e ko rti treated total skin agent drug |
| GSE118765_1_v_5_rreb1_mouse | eb rreb1 wt cell line e14 time embryonic stem cells vs eb rreb1 ko cell line e14 time embryonic stem cells |
| GSE148514_0_v_1_rreb1_mouse | rreb1 wt rep strain cd1 developmental stage e7.5 whole embryo rreb1+/+ embryonic day 7.5 mouse vs rreb1 ko rep strain cd1 developmental stage e7.5 whole embryo / embryonic day 7.5 mouse |
| GSE146074_6_v_7_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation mhv time 5 p.. sections murine |
| GSE146074_0_v_7_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation mhv time 5 p.. sections murine |
| GSE146074_0_v_3_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_6_v_3_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_1_v_8_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_1_v_11_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation mhv time 3 p.. sections murine |
| GSE146074_9_v_3_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_6_v_8_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_0_v_11_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation mhv time 3 p.. sections murine |
| GSE146074_1_v_7_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation mhv time 5 p.. sections murine |
| GSE146074_10_v_8_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 5 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_9_v_8_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_9_v_7_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation mhv time 5 p.. sections murine |
| GSE146074_9_v_11_ly6e_mouse | sp liver gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation mhv time 3 p.. sections murine |
| GSE146074_10_v_3_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 5 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_1_v_3_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 3 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation pbs time 5 p.. sections murine |
| GSE146074_6_v_11_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation pbs time 5 p.. sections murine vs sp spleen gender female conditional ly6e knock ko inoculation mhv time 3 p.. sections murine |
| GSE146074_10_v_7_ly6e_mouse | sp spleen gender female conditional ly6e knock wt inoculation mhv time 5 p.. sections murine vs sp liver gender female conditional ly6e knock ko inoculation mhv time 5 p.. sections murine |
| GSE201735_3_v_1_cdca7_human | kyse180 cells native control cell line esophageal squamous carcinoma wt vs kyse180 cdca7exp cells cell line esophageal squamous carcinoma cdca7 overexpression |
| GSE226259_0_v_1_scd2_mouse | wt primary cells cell line bone marrow derived macrophages vs scd2ko primary cells cell line bone marrow derived macrophages scd2 ko |
| GSE146425,GSE146428_1_v_0_lef1_mouse | control rnaseq inguinal lymph nodes cell phenotypes cd4+ cxcr5+ pd1+ strain c57bl/6 genotypes wt follicular helper cells vs tcf7 lef1 knockout rnaseq inguinal lymph nodes cell phenotypes cd4+ cxcr5+ pd1+ strain c57bl/6 genotypes follicular helper cells |
| GSE185865_0_v_1_celf6_human | control celf6 oe cell line a549 cells vs celf6 cell line a549 overexpression cells |
| GSE160293_2_v_4_celf6_mouse | celf6 5ht trap & total rna wt input strain add info developmental stage post natal day 9 fraction wild type mouse brain vs celf6 5ht trap & total rna ko strain add info developmental stage post natal day 9 fraction serotonin cell knockout mouse brain |
| GSE160293_2_v_1_celf6_mouse | celf6 5ht trap & total rna wt input strain add info developmental stage post natal day 9 fraction wild type mouse brain vs celf6 5ht trap & total rna ko input strain add info developmental stage post natal day 9 fraction knockout mouse brain |
| GSE160293_3_v_1_celf6_mouse | celf6 5ht trap & total rna wt strain add info developmental stage post natal day 9 fraction serotonin cell wild type mouse brain vs celf6 5ht trap & total rna ko input strain add info developmental stage post natal day 9 fraction knockout mouse brain |
| GSE139239_1_v_5_ddr1_mouse | d4 strain c57bl/6 cell line e0771 ddr1 wt mammary tumor vs strain rag1 / cell line e0771 ddr1 ko mammary tumor |
| GSE139239_3_v_5_ddr1_mouse | day6 ctrl strain c57bl/6 e0771 mammary tumor igg vs strain rag1 / cell line e0771 ddr1 ko mammary tumor |
| GSE139239_2_v_6_ddr1_mouse | strain rag1 / cell line e0771 ddr1 wt mammary tumor vs d4 strain c57bl/6 cell line e0771 ddr1 ko mammary tumor |
| GSE139239_2_v_5_ddr1_mouse | strain rag1 / cell line e0771 ddr1 wt mammary tumor vs strain rag1 / cell line e0771 ddr1 ko mammary tumor |
| GSE139239_3_v_6_ddr1_mouse | day6 ctrl strain c57bl/6 e0771 mammary tumor igg vs d4 strain c57bl/6 cell line e0771 ddr1 ko mammary tumor |
| GSE70935_3_v_4_cyfip1_human | cell line 690.c5 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line ips5.c4 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_1_v_0_cyfip1_human | cell line ips5.c4 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line 690.c5 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_3_v_5_cyfip1_human | cell line 690.c5 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line 553.c2 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_2_v_4_cyfip1_human | cell line 553.c2 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line ips5.c4 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_2_v_0_cyfip1_human | cell line 553.c2 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line 690.c5 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_1_v_5_cyfip1_human | cell line ips5.c4 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line 553.c2 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE70935_3_v_0_cyfip1_human | cell line 690.c5 npcs derived ipscs non silencing control neural progenitor cells induced pluripotent stem vs cell line 690.c5 npcs derived ipscs cyfip1 knockdown neural progenitor cells induced pluripotent stem |
| GSE103122_0_v_1_riok3_human | healthy donor cd34+ non targeting shrna control day 14 culture cells transduced negative vs donor cd34+ cells riok3 knockdown day 14 culture transduced shrna clone trcn0000005418 gene expression |
| GSE60367_2_v_1_cxcr4_mouse | rna seq analysis vehicle treated mouse notch1 deltae+ cells (ex vivo ) strain/background c57bl/6 /variation cell acute lymphoblastic leukemia ( control vs rna seq analysis cxcr4 ko notch1 deltae+ mouse cells (primary tumor) strain/background c57bl/6 /variation / cell acute lymphoblastic leukemia ( ) |
| GSE231648_4_v_2_lsm14b_mouse | lsm14b wt mi oocyte cell line vs lsm14b ko mi oocyte cell line |
| GSE231648_1_v_2_lsm14b_mouse | lsm14b wt mii oocyte cell line vs lsm14b ko mi oocyte cell line |
| GSE231648_4_v_5_lsm14b_mouse | lsm14b wt mi oocyte cell line vs lsm14b ko mii oocyte cell line |
| GSE206270_1_v_0_lsm14b_mouse | wt11 28 ovary oocyte wt scarce sample polysome profiling vs ko1 10 ovary oocyte lsm14b ko scarce sample polysome profiling |
| GSE231648_1_v_3_lsm14b_mouse | lsm14b wt mii oocyte cell line vs lsm14b ko gv oocyte cell line |
| GSE231648_0_v_5_lsm14b_mouse | lsm14b wt gv oocyte cell line vs lsm14b ko mii oocyte cell line |
| GSE206270_1_v_3_lsm14b_mouse | wt11 28 ovary oocyte wt scarce sample polysome profiling vs ko11 28 ovary oocyte lsm14b ko scarce sample polysome profiling |
| GSE231648_0_v_2_lsm14b_mouse | lsm14b wt gv oocyte cell line vs lsm14b ko mi oocyte cell line |
| GSE231648_1_v_5_lsm14b_mouse | lsm14b wt mii oocyte cell line vs lsm14b ko mii oocyte cell line |
| GSE231648_0_v_3_lsm14b_mouse | lsm14b wt gv oocyte cell line vs lsm14b ko gv oocyte cell line |
| GSE206270_2_v_0_lsm14b_mouse | wt1 10 ovary oocyte wt scarce sample polysome profiling vs ko1 10 ovary oocyte lsm14b ko scarce sample polysome profiling |
| GSE231648_4_v_3_lsm14b_mouse | lsm14b wt mi oocyte cell line vs lsm14b ko gv oocyte cell line |
| GSE206270_2_v_3_lsm14b_mouse | wt1 10 ovary oocyte wt scarce sample polysome profiling vs ko11 28 ovary oocyte lsm14b ko scarce sample polysome profiling |
| GSE239457_1_v_0_rasa1_mouse | con gastric cancer cell line s1 monolayer control vs gastric cancer cell line s1 monolayer rasa1 ko nf2 |
| GSE244199,GSE244200_0_v_1_chmp5_mouse | icn1 wt mouse spleen chmp5f/f cd4 cre vs icn1 ko mouse spleen chmp5f/f cd4 cre+ |
| GSE180982_1_v_0_mlst8_human | mlst8 knockout h1299 cells reconstituted wild type [wt human non small cell lung cancer /variation vs mlst8 knockout h1299 cells reconstituted e303d mutant [303 human non small cell lung cancer /variation |
| GSE193993_5_v_6_sstr2_human | mkn74 con strain homo sapiens control gastric cancer cell line vs snu638 del strain homo sapiens sstr2 deletion gastric cancer cell line |
| GSE193993_1_v_3_sstr2_human | mkn45 con strain homo sapiens control gastric cancer cell line vs ags strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_4_v_7_sstr2_human | ags con strain homo sapiens control gastric cancer cell line vs mkn45 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_5_v_3_sstr2_human | mkn74 con strain homo sapiens control gastric cancer cell line vs ags strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_0_v_3_sstr2_human | snu638 con strain homo sapiens control gastric cancer cell line vs ags strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_0_v_6_sstr2_human | snu638 con strain homo sapiens control gastric cancer cell line vs snu638 del strain homo sapiens sstr2 deletion gastric cancer cell line |
| GSE193993_1_v_7_sstr2_human | mkn45 con strain homo sapiens control gastric cancer cell line vs mkn45 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_0_v_7_sstr2_human | snu638 con strain homo sapiens control gastric cancer cell line vs mkn45 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_4_v_3_sstr2_human | ags con strain homo sapiens control gastric cancer cell line vs ags strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_5_v_7_sstr2_human | mkn74 con strain homo sapiens control gastric cancer cell line vs mkn45 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_5_v_2_sstr2_human | mkn74 con strain homo sapiens control gastric cancer cell line vs mkn74 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_4_v_2_sstr2_human | ags con strain homo sapiens control gastric cancer cell line vs mkn74 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_1_v_2_sstr2_human | mkn45 con strain homo sapiens control gastric cancer cell line vs mkn74 strain homo sapiens sstr2 overexpression gastric cancer cell line |
| GSE193993_1_v_6_sstr2_human | mkn45 con strain homo sapiens control gastric cancer cell line vs snu638 del strain homo sapiens sstr2 deletion gastric cancer cell line |
| GSE131903_0_v_2_abca12_human | crwt wildtype htert cells organotypic 3d model vs crko crispr cas9 abca12 ko htert cells organotypic 3d model |
| GSE112761,GSE112767_1_v_3_ddx6_mouse | wt low embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko high embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE112760,GSE112767_1_v_5_ddx6_mouse | wt 4su embryonic stem cells /variation wild type escs vs ddx6ko 4su sequenced embryonic stem cells /variation ddx6 ko type escs |
| GSE112765,GSE112767_1_v_0_ddx6_mouse | embryonic stem cells /variation wild type escs vs ddx6ko embryonic stem cells /variation ddx6 ko escs |
| GSE112760,GSE112767_4_v_5_ddx6_mouse | wt 4su sequenced embryonic stem cells /variation wild type escs vs ddx6ko 4su sequenced embryonic stem cells /variation ddx6 ko type escs |
| GSE112760,GSE112767_2_v_5_ddx6_mouse | wt total embryonic stem cells /variation wild type rna escs vs ddx6ko 4su sequenced embryonic stem cells /variation ddx6 ko type escs |
| GSE112761,GSE112767_1_v_0_ddx6_mouse | wt low embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko mono embryonic stem cells /variation ddx6 ko polysome fraction monosome escs |
| GSE112761,GSE112767_4_v_5_ddx6_mouse | wt high embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko low embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE112761,GSE112767_2_v_5_ddx6_mouse | wt mono embryonic stem cells /variation wild type polysome fraction monosome escs vs ddx6ko low embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE112761,GSE112767_4_v_0_ddx6_mouse | wt high embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko mono embryonic stem cells /variation ddx6 ko polysome fraction monosome escs |
| GSE112761,GSE112767_1_v_5_ddx6_mouse | wt low embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko low embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE112761,GSE112767_4_v_3_ddx6_mouse | wt high embryonic stem cells /variation wild type polysome fraction escs vs ddx6ko high embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE171486_4_v_0_ddx6_human | panc 1 sicontrol cell line control sirna transfected human cancer vs panc 1 siddx60l cell line ddx60l sirna transfected knockdown human cancer |
| GSE112761,GSE112767_2_v_0_ddx6_mouse | wt mono embryonic stem cells /variation wild type polysome fraction monosome escs vs ddx6ko mono embryonic stem cells /variation ddx6 ko polysome fraction monosome escs |
| GSE112761,GSE112767_2_v_3_ddx6_mouse | wt mono embryonic stem cells /variation wild type polysome fraction monosome escs vs ddx6ko high embryonic stem cells /variation ddx6 ko polysome fraction escs |
| GSE171486_4_v_6_ddx6_human | panc 1 sicontrol cell line control sirna transfected human cancer vs miapaca2 siddx60l cell line ddx60l sirna transfected knockdown human cancer |
| GSE112760,GSE112767_4_v_3_ddx6_mouse | wt 4su sequenced embryonic stem cells /variation wild type escs vs ddx6ko total embryonic stem cells /variation ddx6 ko type rna escs |
| GSE112760,GSE112767_1_v_3_ddx6_mouse | wt 4su embryonic stem cells /variation wild type escs vs ddx6ko total embryonic stem cells /variation ddx6 ko type rna escs |
| GSE242199_2_v_11_ntrk2_human | wt 3h bdnf neural progenitors stimulation rencell vm vs ntrk2ko vehicle 3h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_6_v_7_ntrk2_human | wt 24h bdnf neural progenitors stimulation rencell vm vs ntrk2ko bdnf 3h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_6_v_3_ntrk2_human | wt 24h bdnf neural progenitors stimulation rencell vm vs ntrk2ko bdnf 24h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_9_v_0_ntrk2_human | wt 24h vehicle neural progenitors stimulation non rencell vm vs ntrk2ko 0h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_9_v_11_ntrk2_human | wt 24h vehicle neural progenitors stimulation non rencell vm vs ntrk2ko vehicle 3h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_9_v_7_ntrk2_human | wt 24h vehicle neural progenitors stimulation non rencell vm vs ntrk2ko bdnf 3h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_2_v_7_ntrk2_human | wt 3h bdnf neural progenitors stimulation rencell vm vs ntrk2ko bdnf 3h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_2_v_3_ntrk2_human | wt 3h bdnf neural progenitors stimulation rencell vm vs ntrk2ko bdnf 24h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_9_v_5_ntrk2_human | wt 24h vehicle neural progenitors stimulation non rencell vm vs ntrk2ko vehicle 24h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_6_v_5_ntrk2_human | wt 24h bdnf neural progenitors stimulation rencell vm vs ntrk2ko vehicle 24h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_9_v_3_ntrk2_human | wt 24h vehicle neural progenitors stimulation non rencell vm vs ntrk2ko bdnf 24h neural progenitors ntrk2 ko stimulation rencell vm |
| GSE242199_2_v_0_ntrk2_human | wt 3h bdnf neural progenitors stimulation rencell vm vs ntrk2ko 0h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_2_v_5_ntrk2_human | wt 3h bdnf neural progenitors stimulation rencell vm vs ntrk2ko vehicle 24h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_6_v_11_ntrk2_human | wt 24h bdnf neural progenitors stimulation rencell vm vs ntrk2ko vehicle 3h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE242199_6_v_0_ntrk2_human | wt 24h bdnf neural progenitors stimulation rencell vm vs ntrk2ko 0h neural progenitors ntrk2 ko stimulation non rencell vm |
| GSE190235_0_v_2_foxo3_mouse | wt strain fvb/n bone marrow agent dexamethasone (100nm) wildtype derived macrophages vs ko strain fvb/n bone marrow agent dexamethasone (100nm) foxo3 / derived macrophages |
| GSE190235_3_v_2_foxo3_mouse | wt v strain fvb/n bone marrow agent dmso wildtype derived macrophages vs ko strain fvb/n bone marrow agent dexamethasone (100nm) foxo3 / derived macrophages |
| GSE190235_1_v_2_foxo3_mouse | ko v strain fvb/n bone marrow agent dmso foxo3 / derived macrophages vs ko strain fvb/n bone marrow agent dexamethasone (100nm) foxo3 / derived macrophages |
| GSE254155_5_v_0_per2_mouse | hypothalamus sex male strain b6/j control ad libitum fed timepoint zt16 vs hypothalamus sex male strain b6/j per2 ko 16 hour fast timepoint zt16 |
| GSE254155_1_v_0_per2_mouse | hypothalamus sex male strain b6/j control ad libitum fed timepoint zt16 vs hypothalamus sex male strain b6/j per2 ko 16 hour fast timepoint zt16 |
| GSE130620_1_v_0_kdm4b_human | control lncap cells cell line prostate cancer stable overexpression plenti6 plasmid vs kdm4b overexpression lncap cells d6092 cell line prostate cancer stable flag |
| GSE159206_1_v_3_drd5_mouse | wt 4 1 strain c57bl/6 bone da m2 macrophages age 10 weeks bmdm vs ko 4 1 strain c57bl/6 bone da m2 macrophages drd5 age 10 weeks bmdm |
| GSE168697_0_v_1_wdr6_mouse | con 1 cell line hl cardiac muscle wt stable express vector vs kd 1 cell line hl cardiac muscle wdr62 knockdown |
| GSE108614,GSE108615_0_v_2_setd1a_mouse | setd1awt cell line mll af9 leukemia cells /variation setd1a wild type mouse vs setd1aho cell line mll af9 leukemia cells /variation setd1a knockout mouse |
| GSE108614,GSE108615_3_v_2_setd1a_mouse | cell line mll af9 leukemia cells /variation control mouse vs setd1aho cell line mll af9 leukemia cells /variation setd1a knockout mouse |
| GSE96641_3_v_4_esrp2_mouse | 3t3 l1 empty vector control biological replicate cell line /variation murine preadipocyte vs m6 esrp2 knockdown biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model |
| GSE96641_1_v_2_esrp2_mouse | m27h4 empty vector control biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model vs 3t3 l1 esrp2 overexpression biological replicate cell line /variation murine preadipocyte |
| GSE96641_5_v_4_esrp2_mouse | m6 empty vector control biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model vs m6 esrp2 knockdown biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model |
| GSE96641_5_v_2_esrp2_mouse | m6 empty vector control biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model vs 3t3 l1 esrp2 overexpression biological replicate cell line /variation murine preadipocyte |
| GSE96641_5_v_0_esrp2_mouse | m6 empty vector control biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model vs m27h4 esrp2 overexpression biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model |
| GSE96641_3_v_0_esrp2_mouse | 3t3 l1 empty vector control biological replicate cell line /variation murine preadipocyte vs m27h4 esrp2 overexpression biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model |
| GSE96641_1_v_4_esrp2_mouse | m27h4 empty vector control biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model vs m6 esrp2 knockdown biological cell line /variation murine derived mammary gland tumor c3(1)sv40 tag mouse model |
| GSE131377_4_v_2_spocd1_mouse | rna seq e16 control strain mixed b6cbaf1/crl c57bl/6n gonocytes developmental stage e16.5 spocd1+/ miwi2+/tom vs rna seq p20 miwi2 ko strain c57bl/6n testis developmental stage miwi2^tom/tom |
| GSE131377_1_v_0_spocd1_mouse | rna seq p20 control strain c57bl/6n testis developmental stage wildtype vs rna seq e16 spocd1 ko strain mixed b6cbaf1/crl c57bl/6n gonocytes developmental stage e16.5 / miwi2+/tom |
| GSE131377_4_v_3_spocd1_mouse | rna seq e16 control strain mixed b6cbaf1/crl c57bl/6n gonocytes developmental stage e16.5 spocd1+/ miwi2+/tom vs rna seq p20 spocd1 ko strain mixed b6cbaf1/crl c57bl/6n testis developmental stage / |
| GSE131377_1_v_3_spocd1_mouse | rna seq p20 control strain c57bl/6n testis developmental stage wildtype vs rna seq p20 spocd1 ko strain mixed b6cbaf1/crl c57bl/6n testis developmental stage / |
| GSE178521_1_v_0_prmt5_human | nci h460 cells control cell line lentivirus infection shrna gfp human lung adenocarcinoma vs nci h460 cells prmt5 knockdown cell line lentivirus infection shrna human lung adenocarcinoma |
| GSE107854_2_v_0_prmt5_mouse | lk prmt5 wt /variation prmt5fl/fl wild type sorted cells (wt) vs lk prmt5 ko /variation prmt5fl/fl sorted cells mx1 cre (ko) |
| GSE142430_3_v_0_prmt5_human | wt t1 44 cell line rna seq replicate colorectal carcinoma hct116 vector empty treated prmt5 inhibitor conditions 1um 48h stable cells vs e2f1cr cell line rna seq replicate colorectal carcinoma hct116 vector e2f1 knockdown stable cells |
| GSE142430_3_v_1_prmt5_human | wt t1 44 cell line rna seq replicate colorectal carcinoma hct116 vector empty treated prmt5 inhibitor conditions 1um 48h stable cells vs e2f1cr t1 44 cell line rna seq replicate colorectal carcinoma hct116 vector e2f1 knockdown treated prmt5 inhibitor conditions 1um 48h stable cells |
| GSE142430_2_v_1_prmt5_human | wt cell line rna seq replicate colorectal carcinoma hct116 vector empty stable cells vs e2f1cr t1 44 cell line rna seq replicate colorectal carcinoma hct116 vector e2f1 knockdown treated prmt5 inhibitor conditions 1um 48h stable cells |
| GSE241402_0_v_1_prmt5_human | dmso pancreatic cell line bxpc 3 cells cancer control group inhibition prmt5 inhibitor (gsk3326595) vs prmt5i pancreatic cell line bxpc 3 cells cancer treat group inhibition prmt5 inhibitor (gsk3326595) |
| GSE80182_2_v_1_prmt5_human | a549 gfpkd knockdown gfp (control knockdown) cell line lung adenocarcinoma control (gfp) vs a549 prmt5kd knockdown prmt5 cell line lung adenocarcinoma shrna |
| GSE133691_2_v_0_lgr5_mouse | lgr5low wt strain c57bl/6j small intestine age 8 week itgb7+/+ lgr5 gfp epithelial cell population low vs lgr5high itgb7 ko strain c57bl/6j small intestine age 8 week / lgr5 gfp epithelial cell population high |
| GSE133691_1_v_3_lgr5_mouse | lgr5high wt strain c57bl/6j small intestine age 8 week itgb7+/+ lgr5 gfp epithelial cell population high vs lgr5low itgb7 ko strain c57bl/6j small intestine age 8 week / lgr5 gfp epithelial cell population low |
| GSE224131_0_v_1_mafb_human | gm csf derived macrophages 36 hours transfection mafb specific sirna cell line monocyte knockdown untreated time 36h vs csf derived macrophages 36 hours transfection mafb specific sirna exposed sars cov 2 cell line monocyte knockdown cultured time 36h |
| GSE224131_4_v_1_mafb_human | gm csf derived macrophages 36 hours transfection control sirna cell line monocyte wt untreated time 36h vs csf derived macrophages 36 hours transfection mafb specific sirna exposed sars cov 2 cell line monocyte knockdown cultured time 36h |
| GSE224131_3_v_1_mafb_human | csf derived macrophages 36 hours transfection control sirna exposed sars cov 2 cell line monocyte wt cultured time 36h vs csf derived macrophages 36 hours transfection mafb specific sirna exposed sars cov 2 cell line monocyte knockdown cultured time 36h |
| GSE224131_2_v_1_mafb_human | csf derived macrophages 36 hours transfection control sirna cell line monocyte wt untreated time 36h vs csf derived macrophages 36 hours transfection mafb specific sirna exposed sars cov 2 cell line monocyte knockdown cultured time 36h |
| GSE224131_5_v_1_mafb_human | csf derived macrophages 36 hours transfection mafb specific sirna cell line monocyte knockdown untreated time 36h vs csf derived macrophages 36 hours transfection mafb specific sirna exposed sars cov 2 cell line monocyte knockdown cultured time 36h |
| GSE228992_0_v_1_mafb_human | endocbh2 cells shcontrol cell line human beta wt vs endocbh2 cells shmafb cell line human beta mafb knockdown |
| GSE166783_4_v_2_tp53_human | wt ctrl rpf material ribosome protected fragments pbs wild type hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE246335_1_v_5_tp53_human | molm13 tp53+/+ co incubated anti cd33 car cell replicate na line human aml tp53 wt therapy vs molm13 tp53 / co incubated anti cd33 car cell replicate na line human aml ko therapy |
| GSE168587,GSE168752_3_v_2_tp53_human | h9 wt esc rep sex female hescs vs h9 tp53 ko esc rep sex female hescs |
| GSE171572_5_v_2_tp53_human | mcf10a wt mock untreated cell line catalog # atcc crl 10317 (mammary gland breast epithelium) vs mcf10a p53 ko mmc tp53 ( / ) 0.5 mm methyl methanesulfonate 3 hours cell line catalog # sigma aldrich (catalog clls1045) cells |
| GSE171572_0_v_2_tp53_human | mcf10a pten ko mock ( / ) untreated cell line catalog # sigma aldrich (catalog clls1046) cells vs mcf10a p53 ko mmc tp53 ( / ) 0.5 mm methyl methanesulfonate 3 hours cell line catalog # sigma aldrich (catalog clls1045) cells |
| GSE166783_0_v_2_tp53_human | wt ncs rpf material ribosome protected fragments neocarzinostatin (4 h) wild type hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE246335_4_v_2_tp53_human | molm13 tp53+/+ resting replicate na cell line human aml tp53 wt none vs molm13 tp53 / resting replicate na cell line human aml ko none |
| GSE168587,GSE168752_3_v_1_tp53_human | h9 wt esc rep sex female hescs vs h9 tp53 ko npc rep sex female hescs |
| GSE246335_4_v_5_tp53_human | molm13 tp53+/+ resting replicate na cell line human aml tp53 wt none vs molm13 tp53 / co incubated anti cd33 car cell replicate na line human aml ko therapy |
| GSE166783_3_v_2_tp53_human | wt ctrl material input pbs wild type hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE166783_8_v_2_tp53_human | wt ncs material input neocarzinostatin (4 h) wild type hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE246335_1_v_2_tp53_human | molm13 tp53+/+ co incubated anti cd33 car cell replicate na line human aml tp53 wt therapy vs molm13 tp53 / resting replicate na cell line human aml ko none |
| GSE166783_1_v_2_tp53_human | tp53 ko ctrl material input pbs / hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE171572_1_v_2_tp53_human | mcf10a wt mmc 0.5 mm methyl methanesulfonate 3 hours cell line catalog # atcc crl 10317 (mammary gland breast epithelium) vs mcf10a p53 ko mmc tp53 ( / ) 0.5 mm methyl methanesulfonate 3 hours cell line catalog # sigma aldrich (catalog clls1045) cells |
| GSE171572_3_v_4_tp53_human | mcf10a p53 ko mock tp53 ( / ) untreated cell line catalog # sigma aldrich (catalog clls1045) cells vs mcf10a pten ko mmc ( / ) 0.5 mm methyl methanesulfonate 3 hours cell line catalog # sigma aldrich (catalog clls1046) cells |
| GSE171572_3_v_2_tp53_human | mcf10a p53 ko mock tp53 ( / ) untreated cell line catalog # sigma aldrich (catalog clls1045) cells vs mcf10a p53 ko mmc tp53 ( / ) 0.5 mm methyl methanesulfonate 3 hours cell line catalog # sigma aldrich (catalog clls1045) cells |
| GSE166783_6_v_2_tp53_human | tp53 ko ctrl rpf material ribosome protected fragments pbs / hct116 vs tp53 ko ncs rpf material ribosome protected fragments neocarzinostatin (4 h) / hct116 |
| GSE149903_4_v_7_myd88_mouse | wt igg strain c57bl/6 cd11c+ dendritic cells control antibody mln mc38 tumor bearing mice vs ko antipd1&lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice |
| GSE149903_6_v_2_myd88_mouse | wt antipd1&lgg strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice vs ko lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice |
| GSE149903_0_v_7_myd88_mouse | wt lgg strain c57bl/6 cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice vs ko antipd1&lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice |
| GSE149903_5_v_2_myd88_mouse | ko igg strain c57bl/6 myd88 knockout cd11c+ dendritic cells control antibody mln mc38 tumor bearing mice vs ko lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice |
| GSE149903_0_v_1_myd88_mouse | wt lgg strain c57bl/6 cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice vs ko antipd1 strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice |
| GSE149903_3_v_7_myd88_mouse | wt antipd1 strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice vs ko antipd1&lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice |
| GSE149903_4_v_1_myd88_mouse | wt igg strain c57bl/6 cd11c+ dendritic cells control antibody mln mc38 tumor bearing mice vs ko antipd1 strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice |
| GSE149903_3_v_2_myd88_mouse | wt antipd1 strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice vs ko lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice |
| GSE149903_0_v_2_myd88_mouse | wt lgg strain c57bl/6 cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice vs ko lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice |
| GSE149903_5_v_7_myd88_mouse | ko igg strain c57bl/6 myd88 knockout cd11c+ dendritic cells control antibody mln mc38 tumor bearing mice vs ko antipd1&lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice |
| GSE149903_6_v_1_myd88_mouse | wt antipd1&lgg strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice vs ko antipd1 strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice |
| GSE149903_4_v_2_myd88_mouse | wt igg strain c57bl/6 cd11c+ dendritic cells control antibody mln mc38 tumor bearing mice vs ko lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells oral administration live mln mc38 tumor bearing mice |
| GSE149903_3_v_1_myd88_mouse | wt antipd1 strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice vs ko antipd1 strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody mln mc38 tumor bearing mice |
| GSE149903_6_v_7_myd88_mouse | wt antipd1&lgg strain c57bl/6 cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice vs ko antipd1&lgg strain c57bl/6 myd88 knockout cd11c+ dendritic cells anti pd 1 antibody plus live lgg mln mc38 tumor bearing mice |
| GSE165682_0_v_3_ptbp1_mouse | hsc wt rep (lin sca 1+ c kit+ cd150+ cd48 ) strain c57bl/6 ptbp1 fl/fl bone marrow vs premege ko rep 1 premeges (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105 ) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_4_v_1_ptbp1_mouse | precfu e wt rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 fl/fl bone marrow vs precfu e ko rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_2_v_1_ptbp1_mouse | premege wt rep 1 premeges (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105 ) strain c57bl/6 ptbp1 fl/fl bone marrow vs precfu e ko rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_4_v_3_ptbp1_mouse | precfu e wt rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 fl/fl bone marrow vs premege ko rep 1 premeges (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105 ) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_2_v_5_ptbp1_mouse | premege wt rep 1 premeges (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105 ) strain c57bl/6 ptbp1 fl/fl bone marrow vs hsc ko rep (lin sca 1+ c kit+ cd150+ cd48 ) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_0_v_1_ptbp1_mouse | hsc wt rep (lin sca 1+ c kit+ cd150+ cd48 ) strain c57bl/6 ptbp1 fl/fl bone marrow vs precfu e ko rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 bone marrow |
| GSE165682_4_v_5_ptbp1_mouse | precfu e wt rep 1 es (lin sca c kit+ cd41 fcgrii/iii cd150+ cd105+) strain c57bl/6 ptbp1 fl/fl bone marrow vs hsc ko rep (lin sca 1+ c kit+ cd150+ cd48 ) strain c57bl/6 ptbp1 bone marrow |
| GSE214696_0_v_1_trim21_mouse | bmdm cell line mouse bone marrow derived macrophages wt lps vs bmdm cell line mouse bone marrow derived macrophages trim21 ko lps |
| GSE211267_1_v_0_trim21_human | hct116 cells shcontrol biol rep cell line poorly differentiated colon carcinoma wt scrambled shrna control (shrna/control) using lentiviral technique time day 21 vs hct116 cells shtrim21 biol rep cell line poorly differentiated colon carcinoma trim21 knockdown specific shrna (shrna/trim21) using lentiviral technique time day 21 |
| GSE214161,GSE214233_0_v_2_zmym2_mouse | rnaseq e8.5 whole embryo wt sample developmental stage strain c57bl/6 sex wild type vs rnaseq e8.5 whole embryo zmym2ko sample developmental stage strain c57bl/6 sex zmym2 knockout |
| GSE252958_1_v_0_znf469_human | hsc shcontrol cell line primary hepatic stellate stromal cells wt vs hsc shznf469 cell line primary hepatic stellate stromal cells znf469 knockdown |
| GSE135312_1_v_2_bmpr2_human | bmpr2 wt cell line eahy926 endothelial cells bmpr2+/+ vs bmpr2 ko cell line eahy926 endothelial cells bmpr2+/ |
| GSE155830_3_v_0_fkbp5_mouse | fkbp5 ko mice liver control diet strain c57bl/6 vs fkbp5 ko mice liver etoh diet plus binge strain c57bl/6 |
| GSE155830_1_v_0_fkbp5_mouse | wt mice liver control diet strain c57bl/6 wild type vs fkbp5 ko mice liver etoh diet plus binge strain c57bl/6 |
| GSE242367_1_v_0_dpp9_human | dpp9 nc cell line 786 clear renal carcinoma wt none vs dpp9 ko cell line 786 clear renal carcinoma knock none |
| GSE145915_3_v_1_pcm1_mouse | wt frontal cortex rep strain/background c57 bl6j /variation age adult vs pcm1 ko frontal cortex strain/background c57 bl6j /variation age adult |
| GSE145915_5_v_1_pcm1_mouse | wt hippocampus strain/background c57 bl6j /variation age adult vs pcm1 ko frontal cortex strain/background c57 bl6j /variation age adult |
| GSE145915_3_v_2_pcm1_mouse | wt frontal cortex rep strain/background c57 bl6j /variation age adult vs pcm1 ko hippocampus strain/background c57 bl6j /variation age adult |
| GSE145915_0_v_1_pcm1_mouse | wt striatum strain/background c57 bl6j /variation age adult vs pcm1 ko frontal cortex strain/background c57 bl6j /variation age adult |
| GSE145915_3_v_4_pcm1_mouse | wt frontal cortex rep strain/background c57 bl6j /variation age adult vs pcm1 ko striatum strain/background c57 bl6j /variation age adult |
| GSE145915_5_v_4_pcm1_mouse | wt hippocampus strain/background c57 bl6j /variation age adult vs pcm1 ko striatum strain/background c57 bl6j /variation age adult |
| GSE145915_0_v_2_pcm1_mouse | wt striatum strain/background c57 bl6j /variation age adult vs pcm1 ko hippocampus strain/background c57 bl6j /variation age adult |
| GSE145915_0_v_4_pcm1_mouse | wt striatum strain/background c57 bl6j /variation age adult vs pcm1 ko striatum strain/background c57 bl6j /variation age adult |
| GSE185944_5_v_1_pth1r_mouse | ctrl bone gfp+ age postnatal day 21 wild type cells vs ko bone gfp+ age postnatal day 21 conditional pth1r cells |
| GSE185944_5_v_4_pth1r_mouse | ctrl bone gfp+ age postnatal day 21 wild type cells vs ko bone gfp tm+ age postnatal day 21 conditional pth1r cells |
| GSE185944_2_v_3_pth1r_mouse | ctrl bone gfp tm+ age postnatal day 21 wild type cells vs ko bm gfp tm+ age postnatal day 21 conditional pth1r bone marrow stromal cells |
| GSE185944_0_v_1_pth1r_mouse | ctrl bm gfp tm+ age postnatal day 21 wild type bone marrow stromal cells vs ko bone gfp+ age postnatal day 21 conditional pth1r cells |
| GSE185944_2_v_1_pth1r_mouse | ctrl bone gfp tm+ age postnatal day 21 wild type cells vs ko bone gfp+ age postnatal day 21 conditional pth1r cells |
| GSE185944_2_v_4_pth1r_mouse | ctrl bone gfp tm+ age postnatal day 21 wild type cells vs ko bone gfp tm+ age postnatal day 21 conditional pth1r cells |
| GSE185944_0_v_3_pth1r_mouse | ctrl bm gfp tm+ age postnatal day 21 wild type bone marrow stromal cells vs ko bm gfp tm+ age postnatal day 21 conditional pth1r bone marrow stromal cells |
| GSE185944_5_v_3_pth1r_mouse | ctrl bone gfp+ age postnatal day 21 wild type cells vs ko bm gfp tm+ age postnatal day 21 conditional pth1r bone marrow stromal cells |
| GSE61117_0_v_1_trim24_mouse | wt strain c57bl6/j liver age 8 weeks wild type vs trim24 ko strain c57bl6/j liver age 8 weeks / |
| GSE221633_0_v_1_trim24_human | jurkat tat lko cell line lymphocyte shrna control pma/ionomycin activation time 4 hrs vs jurkat tat trim24 ko cell line lymphocyte knockout pma/ionomycin activation time 4 hrs |
| GSE95386_0_v_1_trim24_human | gbm cells control shrna vs ln229/egfrviii/shtrim24 1# gbm cells /variation overexpression egfrviii trim24 shrna |
| GSE221633_3_v_1_trim24_human | jurkat tat wt cell line lymphocyte pma/ionomycin activation time 4 hrs vs jurkat tat trim24 ko cell line lymphocyte knockout pma/ionomycin activation time 4 hrs |
| GSE179036_1_v_0_trim24_mouse | cre control strain fvb subtype normal mammary gland sequencing 1 vs trim24 coe strain fvb overexpression subtype sequencing mammary tumor |
| GSE211866_2_v_1_usp11_human | hct116 shctr cell line human colorectal carcinoma wt vs hct116 shusp11 cell line human colorectal carcinoma usp11 knockdown |
| GSE157777_1_v_0_foxa3_mouse | wt male strain background c57bl/6 /variation sex liver vs ko male strain background c57bl/6 /variation foxa3 cre yap1 sex liver |
| GSE157777_2_v_0_foxa3_mouse | wt female strain background c57bl/6 /variation sex liver vs ko male strain background c57bl/6 /variation foxa3 cre yap1 sex liver |
| GSE157777_2_v_3_foxa3_mouse | wt female strain background c57bl/6 /variation sex liver vs ko female strain background c57bl/6 /variation foxa3 cre yap1 sex liver |
| GSE157777_1_v_3_foxa3_mouse | wt male strain background c57bl/6 /variation sex liver vs ko female strain background c57bl/6 /variation foxa3 cre yap1 sex liver |
| GSE212762_1_v_2_smarcb1_human | control xenograft (bladder) cell line t24 bladder cancer cells implanted mouse intiated tumors isolated rna seq profiling. vs smarcb1 ko xenograft (bladder) cell line t24 bladder cancer cells implanted mouse intiated tumors isolated rna seq profiling. |
| GSE199255,GSE199356_6_v_1_pds5a_mouse | pds5b ko siglo knockout cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sipds5b knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_4_v_2_pds5a_mouse | wt sipds5b wildtype cell line v6.5 mouse embryonic stem cells (mescs) vs pds5a ko sistag1 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_3_v_5_pds5a_mouse | wt siglo rep wildtype cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sistag2 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_3_v_1_pds5a_mouse | wt siglo rep wildtype cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sipds5b knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_6_v_5_pds5a_mouse | pds5b ko siglo knockout cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sistag2 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_4_v_5_pds5a_mouse | wt sipds5b wildtype cell line v6.5 mouse embryonic stem cells (mescs) vs pds5a ko sistag2 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_0_v_5_pds5a_mouse | pds5a ko siglo knockout cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sistag2 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_4_v_1_pds5a_mouse | wt sipds5b wildtype cell line v6.5 mouse embryonic stem cells (mescs) vs pds5a ko sipds5b knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE194268_2_v_0_pds5a_mouse | rnaseq wt embryonic stem cells mouse vs rnaseq pds5a ko embryonic stem cells mouse |
| GSE199255,GSE199356_6_v_2_pds5a_mouse | pds5b ko siglo knockout cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sistag1 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_3_v_2_pds5a_mouse | wt siglo rep wildtype cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sistag1 knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE199255,GSE199356_0_v_1_pds5a_mouse | pds5a ko siglo knockout cell line v6.5 mouse embryonic stem cells (mescs) control vs pds5a ko sipds5b knockout cell line v6.5 mouse embryonic stem cells (mescs) |
| GSE204784,GSE204787_1_v_0_tfcp2_mouse | wildtype post flu sample lung sftpc creert2 r26r eyfp 14 day vs tfcp2l1 ko post flu sample lung sftpc creert2 fl/fl r26r eyfp 14 day |
| GSE159937_2_v_0_tfcp2_mouse | esc wt 2i wild type growth condition grown medium repeat embryonic stem cells vs esc ko 2i tfcp2l1 knockout growth condition grown medium repeat embryonic stem cells |
| GSE224599_0_v_1_tfcp2_human | a375 cells wildtype biol rep cell line malignant melanoma wt vs a375 cells tfcp2 ko biol rep cell line malignant melanoma knockout |
| GSE159937_1_v_0_tfcp2_mouse | esc wt fbs wild type growth condition grown containing medium repeat embryonic stem cells vs esc ko 2i tfcp2l1 knockout growth condition grown medium repeat embryonic stem cells |
| GSE229102_1_v_0_nr2f6_mouse | c2c12 cells day 3 cell line myogenic wt differentiation time vs c2c12 cells day 3 cell line myogenic nr2f6 knockdown differentiation time |
| GSE228162_2_v_1_nr2f6_mouse | anti pd1 cell line b16f10 wt group vs bulk tumor cell line b16f10 tumors nr2f6 ko |
| GSE228162_2_v_5_nr2f6_mouse | anti pd1 cell line b16f10 wt group vs cultured cell line b16f10 cells nr2f6 ko |
| GSE221539_1_v_0_lrrc10_mouse | wt sh full heart ventricle lrrc10 sham vs lrrc10 ko mi full heart ventricle |
| GSE221539_1_v_3_lrrc10_mouse | wt sh full heart ventricle lrrc10 sham vs lrrc10 ko sh full heart ventricle sham |
| GSE181431_0_v_1_calr_human | ctrl cell line mda mb 231 control cells vs calr cell line mda mb 231 knockdown cells |
| GSE150072,GSE169209_6_v_9_qser1_human | rna seq wt day10 ebs batch3 cell line differentiated h1 hescs wild type sequence day 10 embryoid bodies (ebs) vs rna seq h1 qser1 ko hescs cell line inactivating mutation human embryonic stem cells (hescs) |
| GSE150072,GSE169209_4_v_9_qser1_human | rna seq h1 wt hescs cell line wild type sequence human embryonic stem cells (hescs) vs rna seq h1 qser1 ko hescs cell line inactivating mutation human embryonic stem cells (hescs) |
| GSE150072,GSE169209_6_v_11_qser1_human | rna seq wt day10 ebs batch3 cell line differentiated h1 hescs wild type sequence day 10 embryoid bodies (ebs) vs rna seq qser1 ko pp1 cells batch3 cell line differentiated h1 hescs inactivating mutation pancreatic progenitors (pp1) |
| GSE150072,GSE169209_4_v_10_qser1_human | rna seq h1 wt hescs cell line wild type sequence human embryonic stem cells (hescs) vs rna seq qser1 ko day10 ebs batch3 cell line differentiated h1 hescs inactivating mutation day 10 embryoid bodies (ebs) |
| GSE150072,GSE169209_4_v_11_qser1_human | rna seq h1 wt hescs cell line wild type sequence human embryonic stem cells (hescs) vs rna seq qser1 ko pp1 cells batch3 cell line differentiated h1 hescs inactivating mutation pancreatic progenitors (pp1) |
| GSE178255_5_v_6_tlr4_mouse | wt cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 wild type pulmonary vs tlr4 ko cirp strain c57bl/6 lung fibroblasts rmcirp / pulmonary |
| GSE178255_1_v_7_tlr4_mouse | wt pbs strain c57bl/6 lung fibroblasts wild type pulmonary vs tlr4 ko tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 / pulmonary |
| GSE178255_1_v_6_tlr4_mouse | wt pbs strain c57bl/6 lung fibroblasts wild type pulmonary vs tlr4 ko cirp strain c57bl/6 lung fibroblasts rmcirp / pulmonary |
| GSE178255_2_v_7_tlr4_mouse | wt tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 wild type pulmonary vs tlr4 ko tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 / pulmonary |
| GSE178255_3_v_4_tlr4_mouse | wt cirp strain c57bl/6 lung fibroblasts rmcirp wild type pulmonary vs tlr4 ko pbs strain c57bl/6 lung fibroblasts / pulmonary |
| GSE229231_0_v_1_tlr4_mouse | w 1 tumor cell line mc38 colon cancer cells wt c57bl/6 mice salmonella .v. injection post day vs k 1 tumor cell line mc38 colon cancer cells tlr4 knockout c57bl/6 mice pbs .v. injection post day |
| GSE178255_5_v_0_tlr4_mouse | wt cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 wild type pulmonary vs tlr4 ko cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 / pulmonary |
| GSE178255_2_v_0_tlr4_mouse | wt tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 wild type pulmonary vs tlr4 ko cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 / pulmonary |
| GSE178255_3_v_7_tlr4_mouse | wt cirp strain c57bl/6 lung fibroblasts rmcirp wild type pulmonary vs tlr4 ko tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 / pulmonary |
| GSE178255_3_v_6_tlr4_mouse | wt cirp strain c57bl/6 lung fibroblasts rmcirp wild type pulmonary vs tlr4 ko cirp strain c57bl/6 lung fibroblasts rmcirp / pulmonary |
| GSE178255_1_v_4_tlr4_mouse | wt pbs strain c57bl/6 lung fibroblasts wild type pulmonary vs tlr4 ko pbs strain c57bl/6 lung fibroblasts / pulmonary |
| GSE178255_5_v_4_tlr4_mouse | wt cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 wild type pulmonary vs tlr4 ko pbs strain c57bl/6 lung fibroblasts / pulmonary |
| GSE229231_2_v_3_tlr4_mouse | w 1 tumor cell line mc38 colon cancer cells wt c57bl/6 mice pbs .v. injection post day vs k 1 tumor cell line mc38 colon cancer cells tlr4 knockout c57bl/6 mice salmonella .v. injection post day |
| GSE178255_3_v_0_tlr4_mouse | wt cirp strain c57bl/6 lung fibroblasts rmcirp wild type pulmonary vs tlr4 ko cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 / pulmonary |
| GSE178255_2_v_6_tlr4_mouse | wt tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 wild type pulmonary vs tlr4 ko cirp strain c57bl/6 lung fibroblasts rmcirp / pulmonary |
| GSE178255_1_v_0_tlr4_mouse | wt pbs strain c57bl/6 lung fibroblasts wild type pulmonary vs tlr4 ko cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 / pulmonary |
| GSE178255_2_v_4_tlr4_mouse | wt tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 wild type pulmonary vs tlr4 ko pbs strain c57bl/6 lung fibroblasts / pulmonary |
| GSE178255_5_v_7_tlr4_mouse | wt cirp tgf ãx9f strain c57bl/6 lung fibroblasts rmcirp + rmtgf beta1 wild type pulmonary vs tlr4 ko tgf ãx9f strain c57bl/6 lung fibroblasts rmtgf beta1 / pulmonary |
| GSE191174_0_v_1_ccdc92_mouse | ewat adipose strain c57bl/6 high fat diet wild type epididymal white vs ewat adipose strain c57bl/6 high fat diet ccdc92 ko epididymal white |
| GSE122067_3_v_0_mtch2_mouse | 2il strain background c57bl/6 developmental stage e3.5 /variation wild type epiblast mouse embryonic stem cells (escs) vs cre af strain background c57bl/6 developmental stage e3.5 /variation mtch2 ko epiblast post implantation like cells (epilcs) |
| GSE122067_2_v_0_mtch2_mouse | af strain background c57bl/6 developmental stage e3.5 /variation wild type epiblast post implantation like cells (epilcs) vs cre af strain background c57bl/6 developmental stage e3.5 /variation mtch2 ko epiblast post implantation like cells (epilcs) |
| GSE122067_2_v_1_mtch2_mouse | af strain background c57bl/6 developmental stage e3.5 /variation wild type epiblast post implantation like cells (epilcs) vs cre 2il strain background c57bl/6 developmental stage e3.5 /variation mtch2 ko epiblast mouse embryonic stem cells (escs) |
| GSE122067_3_v_1_mtch2_mouse | 2il strain background c57bl/6 developmental stage e3.5 /variation wild type epiblast mouse embryonic stem cells (escs) vs cre 2il strain background c57bl/6 developmental stage e3.5 /variation mtch2 ko epiblast mouse embryonic stem cells (escs) |
| GSE49929,GSE49931_1_v_0_irf4_mouse | irf4 wildtype strain background c57bl/6 /variation wild type spleens lymph nodes celltype cd8+ cells ova peptides rhil 2 time 48 hours vs irf4 knockout strain background c57bl/6 /variation spleens lymph nodes celltype cd8+ cells ova peptides rhil 2 time 48 hours |
| GSE188832,GSE188835_0_v_1_irf4_mouse | wild type strain c57bl/6 spleen 2 conventional dendritic cells (cdc2s) wt l004 r1 001.fastq.gz vs irf4 ko strain c57bl/6 spleen type 2 conventional dendritic cells (cdc2s) deficient l004 r1 001.fastq.gz |
| GSE149359_3_v_0_asap2_human | miapaca2 wt cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2094 wild type pdac vs miapaca2 ko cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2094 asap2 knockout pdac |
| GSE217201_1_v_0_asap2_human | shnc cell line thp derived macrophage wt vs shasap2 cell line thp derived macrophage knockdown |
| GSE149359_3_v_1_asap2_human | miapaca2 wt cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2094 wild type pdac vs panc1 ko cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2095 asap2 knockout pdac |
| GSE149359_2_v_0_asap2_human | panc1 wt cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2095 wild type pdac vs miapaca2 ko cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2094 asap2 knockout pdac |
| GSE149359_2_v_1_asap2_human | panc1 wt cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2095 wild type pdac vs panc1 ko cell line pancreatic ductal adenocarcinoma (pdac) cells riken brc cat# rcb2095 asap2 knockout pdac |
| GSE210662_3_v_1_znf165_human | mkn28 cell line gastric cancer wt vs mkn28 97009 cell line gastric cancer znf165 knockdown |
| GSE210662_2_v_1_znf165_human | mkn45 cell line gastric cancer wt vs mkn28 97009 cell line gastric cancer znf165 knockdown |
| GSE210662_2_v_0_znf165_human | mkn45 cell line gastric cancer wt vs mkn45 64839 cell line gastric cancer znf165 overexpression |
| GSE210662_3_v_0_znf165_human | mkn28 cell line gastric cancer wt vs mkn45 64839 cell line gastric cancer znf165 overexpression |
| GSE220058,GSE220059_0_v_1_prrc2b_human | shctrl total bio rep cell line hek293t human embryonic kidney control shrna fraction rna vs shprrc2b total bio rep cell line hek293t human embryonic kidney prrc2b knockdown fraction rna |
| GSE157555,GSE157556_3_v_2_foxa2_mouse | wt b15 male replicate fetal brain gender wildtype strain c57bl/6 vs ko p15 male replicate placenta gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_1_v_9_foxa2_mouse | rna seq wt gw3965 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 veh liver age 8 12 weeks |
| GSE157555,GSE157556_3_v_7_foxa2_mouse | wt b15 male replicate fetal brain gender wildtype strain c57bl/6 vs ko p15 female replicate placenta gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_2_v_4_foxa2_mouse | rna seq wt veh liver age 8 12 weeks vs rna seq foxa2 ko gw4064 liver age 8 12 weeks |
| GSE149075_2_v_9_foxa2_mouse | rna seq wt veh liver age 8 12 weeks vs rna seq foxa2 ko gw4064 veh liver age 8 12 weeks |
| GSE149075_6_v_11_foxa2_mouse | rna seq wt t09 liver age 8 12 weeks vs rna seq foxa2 ko veh liver age 8 12 weeks |
| GSE149075_3_v_9_foxa2_mouse | rna seq wt gw4064 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 veh liver age 8 12 weeks |
| GSE157555,GSE157556_4_v_7_foxa2_mouse | wt b15 female replicate fetal brain gender wildtype strain c57bl/6 vs ko p15 female replicate placenta gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_2_v_11_foxa2_mouse | rna seq wt veh liver age 8 12 weeks vs rna seq foxa2 ko veh liver age 8 12 weeks |
| GSE149075_3_v_5_foxa2_mouse | rna seq wt gw4064 liver age 8 12 weeks vs rna seq foxa2 ko t09 liver age 8 12 weeks |
| GSE149075_8_v_11_foxa2_mouse | rna seq wt gw4064 veh liver age 8 12 weeks vs rna seq foxa2 ko veh liver age 8 12 weeks |
| GSE157555,GSE157556_0_v_1_foxa2_mouse | wt p15 female replicate placenta gender wildtype strain c57bl/6 vs ko b15 male replicate fetal brain gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_8_v_5_foxa2_mouse | rna seq wt gw4064 veh liver age 8 12 weeks vs rna seq foxa2 ko t09 liver age 8 12 weeks |
| GSE149075_3_v_4_foxa2_mouse | rna seq wt gw4064 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 liver age 8 12 weeks |
| GSE149075_8_v_4_foxa2_mouse | rna seq wt gw4064 veh liver age 8 12 weeks vs rna seq foxa2 ko gw4064 liver age 8 12 weeks |
| GSE149075_6_v_9_foxa2_mouse | rna seq wt t09 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 veh liver age 8 12 weeks |
| GSE157555,GSE157556_4_v_2_foxa2_mouse | wt b15 female replicate fetal brain gender wildtype strain c57bl/6 vs ko p15 male replicate placenta gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_3_v_0_foxa2_mouse | rna seq wt gw4064 liver age 8 12 weeks vs rna seq foxa2 ko gw3965 liver age 8 12 weeks |
| GSE157555,GSE157556_0_v_6_foxa2_mouse | wt p15 female replicate placenta gender wildtype strain c57bl/6 vs ko b15 female replicate fetal brain gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE149075_6_v_4_foxa2_mouse | rna seq wt t09 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 liver age 8 12 weeks |
| GSE149075_1_v_5_foxa2_mouse | rna seq wt gw3965 liver age 8 12 weeks vs rna seq foxa2 ko t09 liver age 8 12 weeks |
| GSE149075_8_v_0_foxa2_mouse | rna seq wt gw4064 veh liver age 8 12 weeks vs rna seq foxa2 ko gw3965 liver age 8 12 weeks |
| GSE149075_2_v_0_foxa2_mouse | rna seq wt veh liver age 8 12 weeks vs rna seq foxa2 ko gw3965 liver age 8 12 weeks |
| GSE149075_2_v_5_foxa2_mouse | rna seq wt veh liver age 8 12 weeks vs rna seq foxa2 ko t09 liver age 8 12 weeks |
| GSE149075_6_v_0_foxa2_mouse | rna seq wt t09 liver age 8 12 weeks vs rna seq foxa2 ko gw3965 liver age 8 12 weeks |
| GSE149075_1_v_0_foxa2_mouse | rna seq wt gw3965 liver age 8 12 weeks vs rna seq foxa2 ko gw3965 liver age 8 12 weeks |
| GSE149075_6_v_5_foxa2_mouse | rna seq wt t09 liver age 8 12 weeks vs rna seq foxa2 ko t09 liver age 8 12 weeks |
| GSE149075_3_v_11_foxa2_mouse | rna seq wt gw4064 liver age 8 12 weeks vs rna seq foxa2 ko veh liver age 8 12 weeks |
| GSE149075_1_v_11_foxa2_mouse | rna seq wt gw3965 liver age 8 12 weeks vs rna seq foxa2 ko veh liver age 8 12 weeks |
| GSE149075_1_v_4_foxa2_mouse | rna seq wt gw3965 liver age 8 12 weeks vs rna seq foxa2 ko gw4064 liver age 8 12 weeks |
| GSE157555,GSE157556_5_v_6_foxa2_mouse | wt p15 male replicate placenta gender wildtype strain c57bl/6 vs ko b15 female replicate fetal brain gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE157555,GSE157556_5_v_1_foxa2_mouse | wt p15 male replicate placenta gender wildtype strain c57bl/6 vs ko b15 male replicate fetal brain gender foxa2 uterine conditional knockout strain c57bl/6 |
| GSE80383,GSE126406_1_v_0_isl1_mouse | e8 75 isl1 wt rna seq embryonic stage e8.75 (6 somites) pharyngeal mesoderm hearts strain c57bl/6 wild type vs e8 75 isl1 ko rna seq embryonic stage e8.75 (6 somites) pharyngeal mesoderm hearts strain c57bl/6 / |
| GSE206093,GSE206094_1_v_0_isl1_mouse | control e14.5 pancreas endocrine cells wt vs isl1cko e14.5 pancreas endocrine cells isl1 knockout |
| GSE206093,GSE206094_1_v_3_isl1_mouse | control e14.5 pancreas endocrine cells wt vs isl1cko p9 pancreas endocrine cells isl1 knockout |
| GSE216147_0_v_1_rbm20_mouse | lv heart wildtype male (wt 1) (lv) sex vs lv heart rbm20 knockout male (ko 1) (lv) sex |
| GSE216147_2_v_3_rbm20_mouse | lv heart wildtype female (wt f 1) (lv) sex vs lv heart rbm20 knockout female (ko f 1) (lv) sex |
| GSE216147_0_v_3_rbm20_mouse | lv heart wildtype male (wt 1) (lv) sex vs lv heart rbm20 knockout female (ko f 1) (lv) sex |
| GSE216147_2_v_1_rbm20_mouse | lv heart wildtype female (wt f 1) (lv) sex vs lv heart rbm20 knockout male (ko 1) (lv) sex |
| GSE176144_0_v_1_zfc3h1_human | control knockdown cell line u2os kd fraction vs zfc3h1 knockdown cell line u2os kd fraction |
| GSE89057_0_v_1_sox5_human | control fetal cortex construct plvu gfp overexpression primary human neuronal progenitors vs sox5 overexp fetal cortex construct plvu gfp overexpression primary human neuronal progenitors |
| GSE228695_0_v_1_cul4b_mouse | wt cd8+ cells 24 hr. stim. spleen/lymph node cell strain c57bl/6j (b6) hr anti cd3/28 mabs vs ko cd8+ cells 24 hr. stim. spleen/lymph node cell strain c57bl/6j (b6) cul4b hr anti cd3/28 mabs |
| GSE223008_9_v_12_calhm6_mouse | bmdm wt lps bone marrow derived macrophages wild type (100 ng/ml) vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_0_v_8_calhm6_mouse | bmdm wt lps ifng bone marrow derived macrophages wild type (100 ng/ml) + ifn g (10ng/ml) vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_4_v_8_calhm6_mouse | bmdm wt zymosan bone marrow derived macrophages wild type (100 ug/ml) vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_9_v_1_calhm6_mouse | bmdm wt lps bone marrow derived macrophages wild type (100 ng/ml) vs bmdm ko zymosan bone marrow derived macrophages calhm6 / (100 ug/ml) |
| GSE223008_5_v_2_calhm6_mouse | bmdm wt un bone marrow derived macrophages wild type untreated vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_11_v_2_calhm6_mouse | bmdm wt zymosan ifng bone marrow derived macrophages wild type (100 ug/ml) + ifn g (10ng/ml) vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_4_v_2_calhm6_mouse | bmdm wt zymosan bone marrow derived macrophages wild type (100 ug/ml) vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_7_v_2_calhm6_mouse | bmdm wt polyic bone marrow derived macrophages wild type poly( c) (50 ug/ml vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_6_v_3_calhm6_mouse | bmdm ko un bone marrow derived macrophages calhm6 / untreated vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE223008_0_v_12_calhm6_mouse | bmdm wt lps ifng bone marrow derived macrophages wild type (100 ng/ml) + ifn g (10ng/ml) vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_5_v_8_calhm6_mouse | bmdm wt un bone marrow derived macrophages wild type untreated vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_0_v_1_calhm6_mouse | bmdm wt lps ifng bone marrow derived macrophages wild type (100 ng/ml) + ifn g (10ng/ml) vs bmdm ko zymosan bone marrow derived macrophages calhm6 / (100 ug/ml) |
| GSE223008_11_v_3_calhm6_mouse | bmdm wt zymosan ifng bone marrow derived macrophages wild type (100 ug/ml) + ifn g (10ng/ml) vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE223008_6_v_8_calhm6_mouse | bmdm ko un bone marrow derived macrophages calhm6 / untreated vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_6_v_12_calhm6_mouse | bmdm ko un bone marrow derived macrophages calhm6 / untreated vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_11_v_8_calhm6_mouse | bmdm wt zymosan ifng bone marrow derived macrophages wild type (100 ug/ml) + ifn g (10ng/ml) vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_0_v_2_calhm6_mouse | bmdm wt lps ifng bone marrow derived macrophages wild type (100 ng/ml) + ifn g (10ng/ml) vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_5_v_12_calhm6_mouse | bmdm wt un bone marrow derived macrophages wild type untreated vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_5_v_1_calhm6_mouse | bmdm wt un bone marrow derived macrophages wild type untreated vs bmdm ko zymosan bone marrow derived macrophages calhm6 / (100 ug/ml) |
| GSE223008_9_v_2_calhm6_mouse | bmdm wt lps bone marrow derived macrophages wild type (100 ng/ml) vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_9_v_8_calhm6_mouse | bmdm wt lps bone marrow derived macrophages wild type (100 ng/ml) vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_4_v_12_calhm6_mouse | bmdm wt zymosan bone marrow derived macrophages wild type (100 ug/ml) vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_6_v_1_calhm6_mouse | bmdm ko un bone marrow derived macrophages calhm6 / untreated vs bmdm ko zymosan bone marrow derived macrophages calhm6 / (100 ug/ml) |
| GSE223008_4_v_3_calhm6_mouse | bmdm wt zymosan bone marrow derived macrophages wild type (100 ug/ml) vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE223008_7_v_3_calhm6_mouse | bmdm wt polyic bone marrow derived macrophages wild type poly( c) (50 ug/ml vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE223008_7_v_12_calhm6_mouse | bmdm wt polyic bone marrow derived macrophages wild type poly( c) (50 ug/ml vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_7_v_8_calhm6_mouse | bmdm wt polyic bone marrow derived macrophages wild type poly( c) (50 ug/ml vs bmdm ko ifng bone marrow derived macrophages calhm6 / ifn g (10ng/ml) |
| GSE223008_0_v_3_calhm6_mouse | bmdm wt lps ifng bone marrow derived macrophages wild type (100 ng/ml) + ifn g (10ng/ml) vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE223008_11_v_12_calhm6_mouse | bmdm wt zymosan ifng bone marrow derived macrophages wild type (100 ug/ml) + ifn g (10ng/ml) vs bmdm ko lps ifng bone marrow derived macrophages calhm6 / (100 ng/ml) + ifn g (10ng/ml) |
| GSE223008_7_v_1_calhm6_mouse | bmdm wt polyic bone marrow derived macrophages wild type poly( c) (50 ug/ml vs bmdm ko zymosan bone marrow derived macrophages calhm6 / (100 ug/ml) |
| GSE223008_6_v_2_calhm6_mouse | bmdm ko un bone marrow derived macrophages calhm6 / untreated vs bmdm ko polyic bone marrow derived macrophages calhm6 / poly( c) (50 ug/ml |
| GSE223008_5_v_3_calhm6_mouse | bmdm wt un bone marrow derived macrophages wild type untreated vs bmdm ko lps bone marrow derived macrophages calhm6 / (100 ng/ml) |
| GSE166308_1_v_0_pim1_mouse | mdsc pim wt strain c57bl/6 bone marrow derived mdscs cell population cd11b+ gr1+ vs mdsc pim ko strain c57bl/6 pim1 / bone marrow derived mdscs cell population cd11b+ gr1+ |
| GSE195582_3_v_1_pim1_mouse | pim1 ko bmdm untreated strain c57bl/6 / bone marrow derived macrophages (bmdms) vs pim1 ko bmdm lps treated strain c57bl/6 / bone marrow derived macrophages (bmdms) |
| GSE195582_2_v_1_pim1_mouse | wt bmdm untreated strain c57bl/6 bone marrow derived macrophages (bmdms) vs pim1 ko bmdm lps treated strain c57bl/6 / bone marrow derived macrophages (bmdms) |
| GSE195582_0_v_1_pim1_mouse | wt bmdm lps treated strain c57bl/6 bone marrow derived macrophages (bmdms) vs pim1 ko bmdm lps treated strain c57bl/6 / bone marrow derived macrophages (bmdms) |
| GSE74528_0_v_1_trex2_mouse | wt strain c57bl/6 /variation agent imiquimod back skin pulverized samples vs trex2 ko strain c57bl/6 /variation agent imiquimod back skin pulverized samples |
| GSE221327_8_v_9_clpp_human | wt sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE220600_1_v_2_clpp_mouse | control spermatocytes cell line primary male germ cells wt time pd 35 vs clpp cko spermatocytes cell line primary male germ cells knockout time pd 35 |
| GSE221327_10_v_11_clpp_human | wt sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_1_v_0_clpp_human | wt sum159 dmso control (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE221327_10_v_9_clpp_human | wt sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE221327_6_v_0_clpp_human | wt sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE221327_1_v_11_clpp_human | wt sum159 dmso control (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_6_v_2_clpp_human | wt sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE221327_7_v_9_clpp_human | clpp ko sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE221327_4_v_11_clpp_human | wt sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_4_v_9_clpp_human | wt sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE102756_3_v_2_clpp_mouse | 3m cc strain c57bl/6j age 3 months /variation wild type cumulus cells passage p1 wt vs 6m cc strain c57bl/6j age 6 months /variation clpp / cumulus cells passage p1 ko |
| GSE221327_8_v_0_clpp_human | wt sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE221327_4_v_0_clpp_human | wt sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE221327_8_v_2_clpp_human | wt sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE221327_10_v_0_clpp_human | wt sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE102269_1_v_0_clpp_mouse | 6m gv wt strain c57bl/6j oocytes passage p1 /variation wild type age 6 months (germinal vesicle) vs 6m gv ko strain c57bl/6j oocytes passage p1 /variation clpp / age 6 months (germinal vesicle) |
| GSE221327_6_v_11_clpp_human | wt sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_7_v_11_clpp_human | clpp ko sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_5_v_2_clpp_human | wt sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE221327_10_v_2_clpp_human | wt sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE221327_1_v_9_clpp_human | wt sum159 dmso control (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE221327_6_v_9_clpp_human | wt sum159 dmso control (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE221327_5_v_9_clpp_human | wt sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um |
| GSE102269_1_v_2_clpp_mouse | 6m gv wt strain c57bl/6j oocytes passage p1 /variation wild type age 6 months (germinal vesicle) vs 3m gv ko strain c57bl/6j oocytes passage p1 /variation clpp / age 3 months (germinal vesicle) |
| GSE221327_1_v_2_clpp_human | wt sum159 dmso control (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 0.1% vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE102269_3_v_0_clpp_mouse | 3m gv wt strain c57bl/6j oocytes passage p1 /variation wild type age 3 months (germinal vesicle) vs 6m gv ko strain c57bl/6j oocytes passage p1 /variation clpp / age 6 months (germinal vesicle) |
| GSE221327_5_v_0_clpp_human | wt sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 tr 57 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 150 nm |
| GSE221327_4_v_2_clpp_human | wt sum159 onc201 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um |
| GSE221327_8_v_11_clpp_human | wt sum159 onc201 (1 hr) (bio. rep. time 1 hour cell line triple negative breast cancer 10 um vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE221327_5_v_11_clpp_human | wt sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm vs clpp ko sum159 tr 57 (24 hr) (bio. rep. time 24 hour cell line triple negative breast cancer 150 nm |
| GSE115364_0_v_1_idh3a_human | nha control astrocytes wild type brain vs nha ko astrocytes idh3a brain |
| GSE160765_2_v_1_twist1_human | sk n be2c wt clone cell line wild type sample vs sk n be2c twist1 ko clone cell line sample type |
| GSE205291,GSE205292_1_v_3_drd2_mouse | spinal cord control eae day 17 biol rep strain c57bl/6 age 2 3 months wt condition vs spinal cord drd2mgfap cko basal biol rep strain c57bl/6 age 2 3 months conditional knockout condition |
| GSE135400_2_v_0_kdm1b_mouse | mda231 tumor wt type mouse athymic balb/c nude mice vs mda231 tumor kdm1bko type mouse athymic balb/c nude mice kdm1b ko |
| GSE135400_2_v_0_kdm1b_human | mda231 tumor wt type mouse athymic balb/c nude mice vs mda231 tumor kdm1bko type mouse athymic balb/c nude mice kdm1b ko |
| GSE135400_1_v_0_kdm1b_mouse | 4t1 tumor wt type mouse balb/cj immune competent mice vs 4t1 tumor kdm1bko type mouse balb/cj kdm1b ko immune competent mice |
| GSE135400_1_v_0_kdm1b_human | 4t1 tumor wt type mouse balb/cj immune competent mice vs 4t1 tumor kdm1bko type mouse balb/cj kdm1b ko immune competent mice |
| GSE117730,GSE117732_0_v_1_apobec2_mouse | rna seq gfp knockdown control cell line c2c12 days inducing differentiation target (control) vs rna seq apobec2 knockdown cell line c2c12 days inducing differentiation target |
| GSE117730,GSE117732_0_v_2_apobec2_mouse | rna seq gfp knockdown control cell line c2c12 days inducing differentiation target (control) vs rna seq apobec2 knockdown day0 cell line c2c12 days inducing differentiation 0 target |
| GSE236504,GSE236505_0_v_1_atmin_human | si nc cell line hone 1 nasopharyngeal carcinoma wt vs si atmin cell line hone 1 nasopharyngeal carcinoma knockdown |
| GSE75976_3_v_4_abl1_mouse | control day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor duration days aligner rsubread cells vs b027 knockdown day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor ikaros duration days aligner rsubread 1.16.1 cells |
| GSE75976_3_v_9_abl1_mouse | control day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor duration days aligner rsubread cells vs b031 knockdown day rep background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor ikaros duration days aligner rsubread cells |
| GSE124304_1_v_0_abl1_mouse | scrambled shrna strain c57bl/6 control bone marrow lineage bcr abl1+ shrna+ vs fubp1 shrna strain c57bl/6 knockdown bone marrow lineage bcr abl1+ shrna+ |
| GSE75976_3_v_1_abl1_mouse | control day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor duration days aligner rsubread cells vs knockdown day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor ikaros duration days aligner rsubread cells |
| GSE75976_3_v_6_abl1_mouse | control day background strain c57bl/6 mouse model bcr abl1(p190) transgenic spleen b cell markers cd19+igm tumor duration days aligner rsubread cells vs knockdown day background strain c57bl/6 mouse model bcr abl1(p190) retroviral spleen b cell markers cd19+igm tumor ikaros duration days aligner rsubread 1.12.6 cells |
| GSE173169,GSE173170_0_v_1_epc2_human | epc2 htert control 1 cell line primary immortalized human squamous esophageal genetic modification pen tmirc3 vector cut using agei xbai restriction sites gift iain fraser (addgene (cambridge usa) #25748). pslik venus #25734) version without hoxa13 used line. lgc genomics (teddington uk) sequenced plasmids. next plasmids packaged lentiviral particles following transfection hek293t cells third generation packaging supernatant collected ultracentrifuged. transduced virus fluorescence activated sorted (facs) yfp (pslik venus) positive bd facscantotm ii bought biosciences (san jose usa). grown analyzed pool. induced addition 25 âµg/ml doxycycline culture medium. overexpression determined qpcr according scientific standards (data shown). vs epc2 htert hoxa13 1 cell line primary immortalized human squamous esophageal genetic modification gene including single intron amplified using q5 polymerase gdna primers (agei f ggtggtaccggtgccaccatgacagcctccgtgctcct xbai r accacctctagattaactagtggttttcagtt) cloned pen tmirc3 agei restriction sites gift iain fraser (addgene (cambridge usa) #25748). subsequently insert transferred pslik venus gateway reaction. #25734). lgc genomics (teddington uk) sequenced plasmids. next plasmids packaged lentiviral particles following transfection hek293t cells third generation packaging supernatant collected ultracentrifuged. transduced virus fluorescence activated sorted (facs) yfp (pslik venus) positive bd facscantotm ii bought biosciences (san jose usa). grown analyzed pool. induced addition 25 âµg/ml doxycycline culture medium. overexpression determined qpcr according scientific standards. |
| GSE169205_0_v_2_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs a375 sirt5 knockdown (shrna 546) rep cell line melanoma shrna 546 |
| GSE188382_2_v_1_sirt5_human | wt mock cell line lung adenocarcinoma a549 cells vs ko infected sirt5 sars cov 2 cell line lung adenocarcinoma a549 cells |
| GSE169205_0_v_1_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs skmel2 sirt5 knockdown (shrna 547) rep cell line skmel 2 melanoma shrna 547 |
| GSE188382_2_v_0_sirt5_human | wt mock cell line lung adenocarcinoma a549 cells vs ko mock sirt5 cell line lung adenocarcinoma a549 cells |
| GSE169205_3_v_8_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs a2058 sirt5 knockdown (shrna 546) rep cell line melanoma shrna 546 |
| GSE169205_0_v_6_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs skmel2 sirt5 knockdown (shrna 546) rep cell line skmel 2 melanoma shrna 546 |
| GSE169205_4_v_7_sirt5_human | a375 non targetting control rep cell line melanoma shrna targeting vs a375 sirt5 knockdown (shrna 547) rep cell line melanoma shrna 547 |
| GSE188382_4_v_1_sirt5_human | wt infected sars cov 2 cell line lung adenocarcinoma a549 cells vs ko infected sirt5 sars cov 2 cell line lung adenocarcinoma a549 cells |
| GSE169205_0_v_5_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs a2058 sirt5 knockdown (shrna 547) rep cell line melanoma shrna 547 |
| GSE169205_3_v_6_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs skmel2 sirt5 knockdown (shrna 546) rep cell line skmel 2 melanoma shrna 546 |
| GSE169205_0_v_7_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs a375 sirt5 knockdown (shrna 547) rep cell line melanoma shrna 547 |
| GSE169205_3_v_1_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs skmel2 sirt5 knockdown (shrna 547) rep cell line skmel 2 melanoma shrna 547 |
| GSE188382_4_v_0_sirt5_human | wt infected sars cov 2 cell line lung adenocarcinoma a549 cells vs ko mock sirt5 cell line lung adenocarcinoma a549 cells |
| GSE169205_0_v_8_sirt5_human | a2058 non targetting control rep cell line melanoma shrna targeting vs a2058 sirt5 knockdown (shrna 546) rep cell line melanoma shrna 546 |
| GSE169205_3_v_5_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs a2058 sirt5 knockdown (shrna 547) rep cell line melanoma shrna 547 |
| GSE169205_3_v_2_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs a375 sirt5 knockdown (shrna 546) rep cell line melanoma shrna 546 |
| GSE169205_3_v_7_sirt5_human | skmel2 non targetting control rep cell line skmel 2 melanoma shrna targeting vs a375 sirt5 knockdown (shrna 547) rep cell line melanoma shrna 547 |
| GSE159049_1_v_0_sox2_human | sample metastatic melanoma cells source derived passage >100 subcutaneous metastasis control vector shrna mediated knockdowns 2a c rna seq rv c/lv vs sample metastatic melanoma cells source derived passage >100 subcutaneous metastasis shrna mediated knockdown sox2 rna seq lv shsox2 |
| GSE159049_3_v_0_sox2_human | sample metastatic melanoma cells source derived passage >100 subcutaneous metastasis control vector shrna mediated knockdowns 6a c rna seq lv vs sample metastatic melanoma cells source derived passage >100 subcutaneous metastasis shrna mediated knockdown sox2 rna seq lv shsox2 |
| GSE166184,GSE166185_1_v_0_sox2_human | cwrr1 untreated cell line cwr r1 castration resistant sox2 positive prostate vs cwrr1 sox2 ko cell line cwr r1 castration resistant negative prostate |
| GSE226408_2_v_3_inpp4b_human | y79 etop control cell line retinoblastoma etoposide resistant vector empty vs rb355 etop inpp4b cell line retinoblastoma etoposide resistant vector overexpression |
| GSE226408_1_v_0_inpp4b_human | rb355 etop control cell line retinoblastoma etoposide resistant vector empty vs y79 etop inpp4b cell line retinoblastoma etoposide resistant vector overexpression |
| GSE106130_0_v_1_grhl2_mouse | strain background c57bl/6 /variation grhl2+/+ developmental stage e10.5 first pharyngeal arch grhl2 wt vs strain background c57bl/6 /variation grhl2 / developmental stage e10.5 first pharyngeal arch ko |
| GSE105781_1_v_0_grhl2_mouse | grhl2 control epcam status positive sex age e16.5 murine lung epithelium epcam+ vs grhl2 conditional knockout epcam status positive sex age e16.5 murine lung epithelium cko epcam+ |
| GSE182179_2_v_4_kdsr_human | ncih838 ctrl lung disease adenocarcinoma condition crispr non targeting guide cancer cell line vs dld1 kdsr ko colon disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_5_v_3_kdsr_human | huh7 ctrl liver disease hepatocellular carcinoma condition crispr non targeting guide cancer cell line vs ncih838 kdsr ko lung disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_0_v_1_kdsr_human | dld1 ctrl colon disease adenocarcinoma condition crispr non targeting guide cancer cell line vs huh7 kdsr ko liver disease hepatocellular carcinoma condition crispr gene cancer cell line |
| GSE182179_0_v_4_kdsr_human | dld1 ctrl colon disease adenocarcinoma condition crispr non targeting guide cancer cell line vs dld1 kdsr ko colon disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_5_v_4_kdsr_human | huh7 ctrl liver disease hepatocellular carcinoma condition crispr non targeting guide cancer cell line vs dld1 kdsr ko colon disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_0_v_3_kdsr_human | dld1 ctrl colon disease adenocarcinoma condition crispr non targeting guide cancer cell line vs ncih838 kdsr ko lung disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_2_v_3_kdsr_human | ncih838 ctrl lung disease adenocarcinoma condition crispr non targeting guide cancer cell line vs ncih838 kdsr ko lung disease adenocarcinoma condition crispr gene cancer cell line |
| GSE182179_2_v_1_kdsr_human | ncih838 ctrl lung disease adenocarcinoma condition crispr non targeting guide cancer cell line vs huh7 kdsr ko liver disease hepatocellular carcinoma condition crispr gene cancer cell line |
| GSE159148_0_v_1_sdc1_mouse | effect sdc1 knockout mouse bccml cells condition wt donor strain background b6 recipient nsg blast crisis chronic myeloid leukemia (bccml) vs effect sdc1 knockout mouse bccml cells condition ko donor strain background b6 recipient nsg blast crisis chronic myeloid leukemia (bccml) |
| GSE172146_2_v_1_mettl1_human | hnscc cells normal vs hnscc cells mettl1 knockout |
| GSE172146_3_v_1_mettl1_human | polyribosome bound mrna hnscc cells mrnas isolated total rna ultra centrifugation normal vs hnscc cells mettl1 knockout |
| GSE172146_2_v_0_mettl1_human | hnscc cells normal vs polyribosome bound mrna hnscc cells mrnas isolated total rna ultra centrifugation mettl1 knockout |
| GSE239768,GSE239769_1_v_0_mettl1_human | lncap ai shscramble replicate prostate cell line castration resistant cancer control androgen deprivation therapy vs lncap ai shmettl1 replicate prostate cell line castration resistant cancer mettl1 knockdown androgen deprivation therapy |
| GSE172146_3_v_0_mettl1_human | polyribosome bound mrna hnscc cells mrnas isolated total rna ultra centrifugation normal vs polyribosome bound mrna hnscc cells mrnas isolated total rna ultra centrifugation mettl1 knockout |
| GSE98831_1_v_0_brca1_mouse | ev control immortalized mefs (brca1 i26a mutant) strain c57bl/6 cell line vs oct1 ko mutant immortalized mefs (brca1 i26a mutant) strain c57bl/6 cell line |
| GSE145430_0_v_1_zmat3_mouse | control cas9+ e1a hrasg12v sgrna sgnegative embryonic fibroblasts mouse vs zmat3 knockout cas9+ e1a hrasg12v sgrna sgzmat3 embryonic fibroblasts mouse |
| GSE95543_1_v_0_klhl41_mouse | skeletal muscle age p0 wt hindlimb vs skeletal muscle age p0 klhl41 ko hindlimb |
| GSE138841_0_v_1_trim6_human | a549 cell line airway epithelial cells /variation wild type infection lung sample vs ko3 cell line a549 airway epithelial cells /variation trim6 knockout infection lung sample type |
| GSE211357_1_v_3_atg7_human | con cell line a549 alveolar epithelial cells wt without pr8 infection vs shatg7 cell line a549 alveolar epithelial cells atg7 knockdown pr8 infection 16 hours |
| GSE211357_1_v_0_atg7_human | con cell line a549 alveolar epithelial cells wt without pr8 infection vs shatg7 cell line a549 alveolar epithelial cells atg7 knockdown without pr8 infection |
| GSE211357_2_v_0_atg7_human | iav cell line a549 alveolar epithelial cells wt pr8 infection 16 hours vs shatg7 cell line a549 alveolar epithelial cells atg7 knockdown without pr8 infection |
| GSE135439_0_v_1_pax5_human | h1155 empty cell line lung transfection wild type sclc vs h1155 pax5 ko cell line lung transfection sclc |
| GSE161842_1_v_2_kdm6b_mouse | p14 thy1.1 wt rna strain c57bl/6 (thy1.1) cd8+ cells (p14 tcr transgenic) experimental lcmv d4 infected animals mice vs p14 thy1.1 thy1.2 kdm6b ko rna strain c57bl/6 (thy1.1/thy1.2) cd8+ cells (p14 tcr transgenic) experimental lcmv d4 infected animals mice |
| GSE197117_0_v_1_kdm6b_mouse | wt strain background c57bl/6 /variation wild type neuron vs ko strain background c57bl/6 /variation kdm6b neuron |
| GSE224547_1_v_0_cftr_human | h1 es derived salivary gland epithelial progenitors cell line human embryonic stem wt progenitors' differentiation time day 16 vs cftr knockout h1 es derived salivary gland epithelial progenitors cell line human embryonic stem progenitors' differentiation time day 16 |
| GSE146247_0_v_1_sirt7_human | rna wt h5ylwdsxx l1 1.fq.gz mesenchymal stem cell hmscs passage p2 vs rna sirt7 ko h5ylwdsxx l1 1.fq.gz mesenchymal stem cell defecient hmscs passage p2 |
| GSE140092_0_v_1_socs3_mouse | gr 1 strain/background c57bl/6 /variation wild type age 6 8 weeks myeloid cells white vs ko strain/background c57bl/6 /variation socs3 age 6 8 weeks myeloid cells white |
| GSE140092_2_v_1_socs3_mouse | fl strain/background c57bl/6 /variation wild type age 6 8 weeks myeloid cells white vs ko strain/background c57bl/6 /variation socs3 age 6 8 weeks myeloid cells white |
| GSE162688_1_v_4_pink1_mouse | wt zikv infection zika virus wildtype mouse embryonic fibroblasts vs pink1 ko zikv infection zika virus / mouse embryonic fibroblasts |
| GSE162688_1_v_2_pink1_mouse | wt zikv infection zika virus wildtype mouse embryonic fibroblasts vs pink1 ko mock infection / mouse embryonic fibroblasts |
| GSE162688_3_v_2_pink1_mouse | wt mock infection wildtype mouse embryonic fibroblasts vs pink1 ko mock infection / mouse embryonic fibroblasts |
| GSE162688_3_v_4_pink1_mouse | wt mock infection wildtype mouse embryonic fibroblasts vs pink1 ko zikv infection zika virus / mouse embryonic fibroblasts |
| GSE81803,GSE81912_0_v_5_fmr1_mouse | wt dmso wildtype cultured cortical neurons vs ko thz fmr1 knockout thz1 cultured cortical neurons |
| GSE114015_1_v_0_fmr1_mouse | wt strain c57bl/6 hippocampus hippocampal neuron vs fmr1 ko strain c57bl/6 hippocampus hippocampal neuron |
| GSE121809_1_v_0_fmr1_mouse | wt npc npcs derived e13.5 forebrain passage 6 7 fmr1 neural precursor cells (npcs) vs ko npc npcs derived e13.5 forebrain passage 6 7 fmr1 neural precursor cells (npcs) |
| GSE201239_6_v_1_fmr1_mouse | strain c57bl/6 sample type ip vehicle wt ribosome bound mrna hippocampal slice vs strain c57bl/6 sample type input vehicle ko (fmr1 /) hippocampal slice |
| GSE81803,GSE81912_0_v_1_fmr1_mouse | wt dmso wildtype cultured cortical neurons vs ko jq1 fmr1 knockout cultured cortical neurons |
| GSE81803,GSE81912_3_v_1_fmr1_mouse | wt jq1 wildtype cultured cortical neurons vs ko jq1 fmr1 knockout cultured cortical neurons |
| GSE201239_3_v_2_fmr1_mouse | strain c57bl/6 sample type input vehicle wt hippocampal slice vs strain c57bl/6 sample type ip dhpg ko (fmr1 /) ribosome bound mrna hippocampal slice |
| GSE201239_0_v_7_fmr1_mouse | strain c57bl/6 sample type ip dhpg wt ribosome bound mrna hippocampal slice vs strain c57bl/6 sample type input dhpg ko (fmr1 /) hippocampal slice |
| GSE81803,GSE81912_4_v_1_fmr1_mouse | ko dmso fmr1 knockout cultured cortical neurons vs ko jq1 fmr1 knockout cultured cortical neurons |
| GSE81803,GSE81912_2_v_1_fmr1_mouse | wt thz wildtype thz1 cultured cortical neurons vs ko jq1 fmr1 knockout cultured cortical neurons |
| GSE81803,GSE81912_2_v_5_fmr1_mouse | wt thz wildtype thz1 cultured cortical neurons vs ko thz fmr1 knockout thz1 cultured cortical neurons |
| GSE81803,GSE81912_4_v_5_fmr1_mouse | ko dmso fmr1 knockout cultured cortical neurons vs ko thz fmr1 knockout thz1 cultured cortical neurons |
| GSE201239_0_v_1_fmr1_mouse | strain c57bl/6 sample type ip dhpg wt ribosome bound mrna hippocampal slice vs strain c57bl/6 sample type input vehicle ko (fmr1 /) hippocampal slice |
| GSE201239_3_v_4_fmr1_mouse | strain c57bl/6 sample type input vehicle wt hippocampal slice vs strain c57bl/6 sample type ip vehicle ko (fmr1 /) ribosome bound mrna hippocampal slice |
| GSE201239_6_v_7_fmr1_mouse | strain c57bl/6 sample type ip vehicle wt ribosome bound mrna hippocampal slice vs strain c57bl/6 sample type input dhpg ko (fmr1 /) hippocampal slice |
| GSE81803,GSE81912_3_v_5_fmr1_mouse | wt jq1 wildtype cultured cortical neurons vs ko thz fmr1 knockout thz1 cultured cortical neurons |
| GSE218356_1_v_0_cited1_mouse | scramble cell line raw 264.7 macrophage like wild type guide rna vs cited1 ko clone 9 cell line raw 264.7 macrophage like guide rna (clone 9) |
| GSE151435_1_v_0_gdf11_human | sictrl human dental pulp stem cells (hdpscs) control sirna vs sigdf11 human dental pulp stem cells (hdpscs) gdf11 sirna knockdown |
| GSE100923_3_v_1_gadd45a_mouse | wildtype strain c57bl/6n wild type hippocampus vs gadd45a ko strain c57bl/6n / hippocampus |
| GSE178370_1_v_0_asgr1_mouse | wt strain background c57/bl6 wild type age 13 week liver vs a1 strain background c57/bl6 asgr1 knockout age 13 week liver / |
| GSE131425_2_v_0_arg2_mouse | arginase 2 wildtype mouse room air ( wt ra strain c57/129 lung /variation vs arginase 2 knockout mouse room air ( arg2ko ra strain c57/129 lung /variation arg2 / |
| GSE131425_2_v_3_arg2_mouse | arginase 2 wildtype mouse room air ( wt ra strain c57/129 lung /variation vs arginase 2 knockout mouse hypoxia ( arg2ko hyp strain c57/129 lung /variation arg2 / |
| GSE201478_1_v_0_zfp281_mouse | sgsv40 mesc dox cell line e14 embryonic stem wt vs sgzfp281 mesc dox cell line e14 embryonic stem zfp281 ko |
| GSE123689_1_v_0_cbx8_human | wt cbx8 expression rep /variation wild type t98g gbm cell line vs cbx8 ko rep /variation t98g cell line |
| GSE139325_0_v_3_cd36_mouse | ln strain foxp3 yfpcre+/+ age 8 weeks wt (foxp3 yfp+) lymph node treg vs ko tumor strain cd36floxed foxp3 yfpcre+/ age 8 weeks cd36 (foxp3 yfp+) melanoma infiltrated treg yumm1.7 deficient |
| GSE139325_2_v_3_cd36_mouse | spleen strain foxp3 yfpcre+/+ age 8 weeks wt (foxp3 yfp+) treg vs ko tumor strain cd36floxed foxp3 yfpcre+/ age 8 weeks cd36 (foxp3 yfp+) melanoma infiltrated treg yumm1.7 deficient |
| GSE151160_0_v_1_cd36_mouse | sample 8 s25 strain background c57bl/6 /variation wild type b16 tumor infiltrating cd8 cells wt vs sample 12 s28 strain background c57bl/6 /variation cd36 ko b16 tumor infiltrating cd8 cells |
| GSE213219_0_v_1_st3gal3_mouse | shcontrol tumors tumor cell line hm1 murine ovarian cancer wild type tissues vs hm1 shst3gal3 cell line murine ovarian cancer st3gal3 knockdown cells |
| GSE213219_0_v_3_st3gal3_mouse | shcontrol tumors tumor cell line hm1 murine ovarian cancer wild type tissues vs shst3gal3 tumors tumor cell line hm1 murine ovarian cancer st3gal3 knockdown tissues |
| GSE213219_2_v_1_st3gal3_mouse | hm1 shcontrol cell line murine ovarian cancer wild type cells vs hm1 shst3gal3 cell line murine ovarian cancer st3gal3 knockdown cells |
| GSE213219_2_v_3_st3gal3_mouse | hm1 shcontrol cell line murine ovarian cancer wild type cells vs shst3gal3 tumors tumor cell line hm1 murine ovarian cancer st3gal3 knockdown tissues |
| GSE224856_0_v_1_st3gal3_mouse | oc shcontrol tumors tumor cell line hm1 murine ovarian cancer wild type vs oc shst3gal3 tumors tumor cell line hm1 murine ovarian cancer st3gal3 knockdown |
| GSE98898_8_v_1_hoxa1_human | c42b rna seq genome editing wild type human prostate cell line vs hoxa13 overexpression rna seq cell line prostate rwpe1 gene /variation |
| GSE98898_7_v_2_hoxa1_human | hoxa13 overexpression control rna seq cell line prostate rwpe1 gene /variation wild type vs deletion rna seq cell line prostate rwpe1 genome editing /variation 7p15.2 risk region deleted |
| GSE98898_4_v_1_hoxa1_human | control rna seq cell line prostate rwpe1 genome editing /variation wild type vs hoxa13 overexpression rna seq cell line prostate rwpe1 gene /variation |
| GSE98898_7_v_1_hoxa1_human | hoxa13 overexpression control rna seq cell line prostate rwpe1 gene /variation wild type vs hoxa13 overexpression rna seq cell line prostate rwpe1 gene /variation |
| GSE193249_0_v_1_gpx8_human | wt caki1 cell line wild type clear renal carcinoma (ccrcc) vs gpx8 ko caki1 cell line knockout clear renal carcinoma (ccrcc) |
| GSE223893_4_v_9_setd2_human | 786 0 setd2 wt cell dac100nm renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm+bmn10nm renal line clear carcinoma |
| GSE231720,GSE231724_3_v_0_setd2_human | 697 cells sgrna empty vector control biol cell line b setd2 wt vs kopn cells sgrna setd2 clone ba biol cell line 8 b heterozygous ko |
| GSE223893_1_v_10_setd2_human | 786 0 setd2 wt cell dac100nm+bmn10nm renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm renal line clear carcinoma |
| GSE136742,GSE136744_0_v_3_setd2_mouse | setd2 cko nt knockout normal liver age 8 month none vs setd2 cko knockout liver tumor age 8 month intraperitoneal injection den |
| GSE182840,GSE182844_0_v_1_setd2_mouse | rrs ilc3 rnaseq ctrl ilc3s gender pooled male female rag1 / setd2flox/flox small intestinal lamina propria proprial lymphocytes vs rrs ilc3 rnaseq ko ilc3s gender pooled male female rag1 / setd2flox/floxrorc cre small intestinal lamina propria proprial lymphocytes |
| GSE131588,GSE131690_1_v_0_setd2_mouse | rna seq mouse prob cell line primary cells timepoint 8 weeks genetic alteration control seqbatch 171124 vs rna seq mouse prob setd2 ko cell line primary cells timepoint 8 weeks genetic alteration knockout seqbatch 171124 |
| GSE136742,GSE136744_1_v_3_setd2_mouse | setd2 wt wild type liver tumor age 8 month intraperitoneal injection den vs setd2 cko knockout liver tumor age 8 month intraperitoneal injection den |
| GSE151967,GSE151968_0_v_1_setd2_mouse | wt strain c57bl/6 age two month old setd2f/f intestinal epithelial cells vs ko strain c57bl/6 age two month old setd2vil intestinal epithelial cells |
| GSE223893_2_v_10_setd2_human | 786 0 setd2 wt cell bmn10nm rep1 renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm renal line clear carcinoma |
| GSE231720,GSE231724_2_v_0_setd2_human | kopn cells sgrna empty vector control biol cell line 8 b setd2 wt vs kopn cells sgrna setd2 clone ba biol cell line 8 b heterozygous ko |
| GSE231720,GSE231724_3_v_1_setd2_human | 697 cells sgrna empty vector control biol cell line b setd2 wt vs 697 cells sgrna setd2 clone bm b biol cell line heterozygous ko |
| GSE223893_4_v_10_setd2_human | 786 0 setd2 wt cell dac100nm renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm renal line clear carcinoma |
| GSE223893_11_v_10_setd2_human | 786 0 setd2 wt cell bmn10nm rep2 renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm renal line clear carcinoma |
| GSE231720,GSE231724_2_v_1_setd2_human | kopn cells sgrna empty vector control biol cell line 8 b setd2 wt vs 697 cells sgrna setd2 clone bm b biol cell line heterozygous ko |
| GSE223893_11_v_9_setd2_human | 786 0 setd2 wt cell bmn10nm rep2 renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm+bmn10nm renal line clear carcinoma |
| GSE223893_1_v_9_setd2_human | 786 0 setd2 wt cell dac100nm+bmn10nm renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm+bmn10nm renal line clear carcinoma |
| GSE223893_2_v_9_setd2_human | 786 0 setd2 wt cell bmn10nm rep1 renal line clear carcinoma vs 786 0 setd2 ko cell dac100nm+bmn10nm renal line clear carcinoma |
| GSE136742,GSE136744_2_v_3_setd2_mouse | setd2 wt nt wild type normal liver age 8 month none vs setd2 cko knockout liver tumor age 8 month intraperitoneal injection den |
| GSE96093_1_v_0_abca1_mouse | wt strain c57bl/6 liver /variation wildtype vs hsko strain c57bl/6 liver /variation abca1 deletion |
| GSE213041,GSE241532_1_v_0_tle3_mouse | rna seq tem wt tam treated splenocytes cells ex vivo 4 oht time 48 hrs vs rna seq tem tle3 induced deletion splenocytes ko cells ex vivo 4 oht time 48 hrs |
| GSE116894_1_v_0_tle3_mouse | control background strain c57bl/6 source inguinal white adipose differentiation state beige adipocytes tle3f/f creert2 etoh iwat svf vs tle3 ko background strain c57bl/6 source inguinal white adipose differentiation state beige adipocytes tle3f/f creert2 4 oh tamoxifen iwat svf |
| GSE158715_2_v_4_cyp1b1_mouse | cd45 epcam+ lung epithelial cells wildtype disease state hdm sensitized vs cd45 epcam+ lung epithelial cells cyp1b1 ko disease state naive |
| GSE158715_3_v_0_cyp1b1_mouse | cd45 epcam+ lung epithelial cells wildtype disease state naive vs cd45 epcam+ lung epithelial cells cyp1b1 ko disease state hdm sensitized |
| GSE149442_1_v_0_gdpd3_mouse | wt cml strain c57bl/6 /variation gdpd3+/+ murine bone marrow long term stem cells post 5 wks induction vs gdpd3 ko cml 5 strain c57bl/6 /variation / murine bone marrow long term stem cells post wks induction |
| GSE100316_5_v_6_mtor_mouse | lung steady state cd11b wt /variation wild type littermate facs purified cd11b+ dcs vs lung steady state ko /variation mtor {delta}apc alveolar macrophage mtor{delta}apc |
| GSE100316_3_v_4_mtor_mouse | lung steady state wt /variation wild type littermate alveolar macrophage vs spleen ko /variation mtor {delta}apc steady state facs purified dcs mtor{delta}apc |
| GSE100316_5_v_2_mtor_mouse | lung steady state cd11b wt /variation wild type littermate facs purified cd11b+ dcs vs lung inflammatory dcs ko /variation mtor {delta}apc house dust mite (hdm) treated d17 hdm mtor{delta}apc |
| GSE134316_1_v_0_mtor_mouse | rnaseq ctr mtor wt group control age adult mx1 cre / mtorflox/flox hsc cells vs rnaseq mtor ko group mutant age adult mx1 cre+/ mtorflox/flox hsc cells |
| GSE100316_5_v_1_mtor_mouse | lung steady state cd11b wt /variation wild type littermate facs purified cd11b+ dcs vs lung steady state cd11b ko /variation mtor {delta}apc facs purified cd11b+ dcs mtor{delta}apc |
| GSE100316_0_v_1_mtor_mouse | spleen wt /variation wild type littermate steady state facs purified dcs vs lung steady state cd11b ko /variation mtor {delta}apc facs purified cd11b+ dcs mtor{delta}apc |
| GSE172247,GSE172250_0_v_2_mtor_mouse | rnaseq ctr mtor wt ( analyzed) hsc cells developmental stage adult mx1 cre / mtorflox/flox control vs rnaseq mtor ko ( analyzed) hsc cells developmental stage adult mx1 cre+/ mtorflox/flox |
| GSE100316_7_v_6_mtor_mouse | lung inflammatory dcs wt /variation wild type littermate house dust mite (hdm) treated d17 hdm vs lung steady state ko /variation mtor {delta}apc alveolar macrophage mtor{delta}apc |
| GSE100316_7_v_4_mtor_mouse | lung inflammatory dcs wt /variation wild type littermate house dust mite (hdm) treated d17 hdm vs spleen ko /variation mtor {delta}apc steady state facs purified dcs mtor{delta}apc |
| GSE100316_3_v_6_mtor_mouse | lung steady state wt /variation wild type littermate alveolar macrophage vs lung steady state ko /variation mtor {delta}apc alveolar macrophage mtor{delta}apc |
| GSE215314_0_v_1_mtor_mouse | wt gastrocnemius muscles cell line wildtype tamoxifen induced deletion vs dko gastrocnemius muscles cell line raptor mtor double knock tamoxifen induced deletion |
| GSE100316_3_v_2_mtor_mouse | lung steady state wt /variation wild type littermate alveolar macrophage vs lung inflammatory dcs ko /variation mtor {delta}apc house dust mite (hdm) treated d17 hdm mtor{delta}apc |
| GSE100316_7_v_1_mtor_mouse | lung inflammatory dcs wt /variation wild type littermate house dust mite (hdm) treated d17 hdm vs lung steady state cd11b ko /variation mtor {delta}apc facs purified cd11b+ dcs mtor{delta}apc |
| GSE100316_3_v_1_mtor_mouse | lung steady state wt /variation wild type littermate alveolar macrophage vs lung steady state cd11b ko /variation mtor {delta}apc facs purified cd11b+ dcs mtor{delta}apc |
| GSE100316_0_v_2_mtor_mouse | spleen wt /variation wild type littermate steady state facs purified dcs vs lung inflammatory dcs ko /variation mtor {delta}apc house dust mite (hdm) treated d17 hdm mtor{delta}apc |
| GSE100316_5_v_4_mtor_mouse | lung steady state cd11b wt /variation wild type littermate facs purified cd11b+ dcs vs spleen ko /variation mtor {delta}apc steady state facs purified dcs mtor{delta}apc |
| GSE100316_0_v_6_mtor_mouse | spleen wt /variation wild type littermate steady state facs purified dcs vs lung steady state ko /variation mtor {delta}apc alveolar macrophage mtor{delta}apc |
| GSE100316_7_v_2_mtor_mouse | lung inflammatory dcs wt /variation wild type littermate house dust mite (hdm) treated d17 hdm vs lung inflammatory dcs ko /variation mtor {delta}apc house dust mite (hdm) treated d17 hdm mtor{delta}apc |
| GSE151119_3_v_0_hsf1_mouse | wt lid mouse embryonic fibroblasts (mef) /variation licl 20mm 48 treated vs ko lid mouse embryonic fibroblasts (mef) /variation hsf1 licl 20mm 48 treated |
| GSE95602_3_v_0_hsf1_mouse | vehicle hsp90 inhibition strain background cba x c57bl/6 f1 (b6cbaf1/olahsd harlan olac bicester uk). /variation age 12 wks group control time post 4 hours quadriceps femoris muscle vs hsf1 / hsp90 inhibition strain background cba x c57bl/6 f1 (b6cbaf1/olahsd harlan olac bicester uk). /variation age 8 wks group time post 4 hours quadriceps femoris muscle |
| GSE151119_2_v_1_hsf1_mouse | wt mouse embryonic fibroblasts (mef) /variation vs ko mouse embryonic fibroblasts (mef) /variation hsf1 |
| GSE151119_2_v_0_hsf1_mouse | wt mouse embryonic fibroblasts (mef) /variation vs ko lid mouse embryonic fibroblasts (mef) /variation hsf1 licl 20mm 48 treated |
| GSE151119_3_v_1_hsf1_mouse | wt lid mouse embryonic fibroblasts (mef) /variation licl 20mm 48 treated vs ko mouse embryonic fibroblasts (mef) /variation hsf1 |
| GSE235596_0_v_1_pikfyve_mouse | dc day9 pikfyvef/f primary dendritic cells conventional wt none vs dc day9 cd11ccre pikfyvef/f primary dendritic cells conventional ko none |
| GSE235945_1_v_0_pikfyve_mouse | kpc1361 control tumor pancreatic cell line kpc ductal adenocarcinoma wt vs kpc1361 pikfyve ko pancreatic tumor cell line kpc ductal adenocarcinoma knockout |
| GSE226233_0_v_1_pccb_human | u2f pccb g2 cell line nc hipscs control human forebrain organoids (hfos) organoid vs u2f pccb g1 cell line hipscs knockdown human forebrain organoids (hfos) organoid |
| GSE104604_1_v_0_eif5a_human | ctrl cell line mcf 7 transfection control sirna cells vs eif5a cell line mcf 7 transfection sirna mediated knockdown cells |
| GSE71674,GSE71676_0_v_2_cbfa2t2_mouse | wild type cell line kh2 embryonic stem (es) mescs vs cbfa2t2 knockout cell line kh2 embryonic stem (es) mescs |
| GSE113734_1_v_2_qprt_human | wt gender female cell line sh sy5y neuroblastoma wild type differentiation day 3day vs del268t gender female cell line sh sy5y neuroblastoma qprt knockout differentiation day 3day |
| GSE113734_1_v_0_qprt_human | wt gender female cell line sh sy5y neuroblastoma wild type differentiation day 3day vs ins395a gender female cell line sh sy5y neuroblastoma qprt knockout differentiation day 3day |
| GSE113734_3_v_0_qprt_human | ectrl gender female cell line sh sy5y neuroblastoma empty control vector differentiation day 3day vs ins395a gender female cell line sh sy5y neuroblastoma qprt knockout differentiation day 3day |
| GSE113734_3_v_2_qprt_human | ectrl gender female cell line sh sy5y neuroblastoma empty control vector differentiation day 3day vs del268t gender female cell line sh sy5y neuroblastoma qprt knockout differentiation day 3day |
| GSE148494,GSE182513_1_v_0_hoxd13_human | tc32 shns cell line ewing sarcoma control vs tc32 shhoxd13 cell line ewing sarcoma hoxd13 knockdown |
| GSE168807_0_v_7_dnmt3a_mouse | control restricted progenitor rna seq strain c57bl/6 wild type age 8 weeks cre driver vav pbs vs dnmt3a ifng hematopoietic stem cell rna seq strain c57bl/6 ko age 8 weeks cre driver vav hsc |
| GSE104508_2_v_3_dnmt3a_mouse | gfp pcdh cell line 3t3 l1 mature adipoyctes control vs dnmt3a pcdh cell line 3t3 l1 mature adipoyctes overexpression |
| GSE104508_2_v_1_dnmt3a_mouse | gfp pcdh cell line 3t3 l1 mature adipoyctes control vs shdnmt3a cell line 3t3 l1 mature adipoyctes dnmt3a knockdown |
| GSE87412,GSE92423_2_v_1_dnmt3a_mouse | wt bulge rna seq dmba backskin treated (hair follicle stem cells) age 14 weeks gender female genetic background cu black six dnmt3a flox/flox (wild type) facs sorted dmba/tpa vs ko ife rna seq dnmt3a dmba treated (interfollicular epidermal stem cells) age 14 weeks gender female genetic background cu black six flox/flox krt14cre(dnmt3a krt14 ko) facs sorted dmba/tpa |
| GSE168807_6_v_7_dnmt3a_mouse | control hematopoietic stem cell rna seq strain c57bl/6 wild type age 8 weeks cre driver vav pbs vs dnmt3a ifng hematopoietic stem cell rna seq strain c57bl/6 ko age 8 weeks cre driver vav hsc |
| GSE87412,GSE92423_3_v_1_dnmt3a_mouse | wt ife rna seq dmba treated (interfollicular epidermal stem cells) age 14 weeks gender female genetic background cu black six dnmt3a flox/flox (wild type) facs sorted dmba/tpa vs ko ife rna seq dnmt3a dmba treated (interfollicular epidermal stem cells) age 14 weeks gender female genetic background cu black six flox/flox krt14cre(dnmt3a krt14 ko) facs sorted dmba/tpa |
| GSE139911_0_v_4_dnmt3a_mouse | control rp rna seq strain c57bl/6 wild type age 8 weeks cre driver vav restricted progenitor vs dnmt3ako hsc rna seq strain c57bl/6 dnmt3a ko age 8 weeks cre driver vav hematopoietic stem cell |
| GSE183480,GSE184446_1_v_0_dnmt3a_mouse | rna seq wt [wt bmdm strain c57bl/6 /variation bmdms (bone marrow derived macrophages) stage day 8 10 macrophages vs rna seq dnmt3a ko [ bmdm strain c57bl/6 /variation bmdms (bone marrow derived macrophages) stage day 8 10 macrophages |
| GSE196540,GSE196542_4_v_0_dnmt3a_mouse | cd4 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs cd4 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE186124,GSE186128_1_v_0_dnmt3a_human | se5 gender female es cells wt human embryonic stem vs 3a3b dko se5 gender female es cells dnmt3a/3b deletion human embryonic stem |
| GSE87412,GSE92423_3_v_4_dnmt3a_mouse | wt ife rna seq dmba treated (interfollicular epidermal stem cells) age 14 weeks gender female genetic background cu black six dnmt3a flox/flox (wild type) facs sorted dmba/tpa vs ko bulge rna seq dnmt3a dmba backskin treated (hair follicle stem cells) age 14 weeks gender female genetic background cu black six flox/flox krt14cre(dnmt3a krt14 ko) facs sorted dmba/tpa |
| GSE168807_0_v_8_dnmt3a_mouse | control restricted progenitor rna seq strain c57bl/6 wild type age 8 weeks cre driver vav pbs vs dnmt3ako hematopoietic stem cell rna seq strain c57bl/6 dnmt3a ko age 8 weeks cre driver vav pbs |
| GSE104508_0_v_3_dnmt3a_mouse | scr cell line 3t3 l1 mature adipoyctes scramble control vs dnmt3a pcdh cell line 3t3 l1 mature adipoyctes overexpression |
| GSE196540,GSE196542_4_v_3_dnmt3a_mouse | cd4 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs dp strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE196540,GSE196542_2_v_3_dnmt3a_mouse | cd8 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs dp strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE87412,GSE92423_0_v_4_dnmt3a_mouse | wt rna seq tumor cells skin age 6months gender female genetic background cu black six dnmt3a flox/flox (wild type) facs sorted vs ko bulge rna seq dnmt3a dmba backskin treated (hair follicle stem cells) age 14 weeks gender female genetic background cu black six flox/flox krt14cre(dnmt3a krt14 ko) facs sorted dmba/tpa |
| GSE196540,GSE196542_2_v_5_dnmt3a_mouse | cd8 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs cd8 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE87412,GSE92423_0_v_1_dnmt3a_mouse | wt rna seq tumor cells skin age 6months gender female genetic background cu black six dnmt3a flox/flox (wild type) facs sorted vs ko ife rna seq dnmt3a dmba treated (interfollicular epidermal stem cells) age 14 weeks gender female genetic background cu black six flox/flox krt14cre(dnmt3a krt14 ko) facs sorted dmba/tpa |
| GSE196540,GSE196542_4_v_5_dnmt3a_mouse | cd4 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs cd8 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE196540,GSE196542_2_v_0_dnmt3a_mouse | cd8 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a wt littermates day +10 post transplant sorted splenic donor cells vs cd4 strain primary age (weeks) donors 6 12 weeks recipients 8 dnmt3a ko (cd4 cre 2loxp) day +10 post transplant sorted splenic donor cells |
| GSE208435_0_v_1_dnmt3a_mouse | 1 mxcre+v dnmt3a+/+ bm cells cell line primary mouse wt il3 scf supplemented culture week vs dnmt3a ko 1 mxcre+v / bm cells cell line primary mouse knockdown il3 scf supplemented culture week |
| GSE104508_0_v_1_dnmt3a_mouse | scr cell line 3t3 l1 mature adipoyctes scramble control vs shdnmt3a cell line 3t3 l1 mature adipoyctes dnmt3a knockdown |
| GSE168807_2_v_8_dnmt3a_mouse | control ifng hematopoietic stem cell rna seq strain c57bl/6 wild type age 8 weeks cre driver vav vs dnmt3ako hematopoietic stem cell rna seq strain c57bl/6 dnmt3a ko age 8 weeks cre driver vav pbs |
| GSE102870_7_v_9_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type vs ko1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_1_v_0_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout vs ko2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_5_v_9_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous r436h vs ko1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_7_v_0_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type vs ko2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_1_v_9_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout vs ko1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_3_v_9_nr1h4_human | wt2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type 5um vs ko1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_11_v_0_nr1h4_human | wt1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type 5um vs ko2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_5_v_0_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous r436h vs ko2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_1_v_2_nr1h4_human | dmso ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout vs gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous r436h 5um |
| GSE102870_11_v_9_nr1h4_human | wt1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type 5um vs ko1 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE102870_3_v_0_nr1h4_human | wt2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) wild type 5um vs ko2 gw4064 ipsc derived hepatocytes parental cell line human episomal (thermofisher a18945) nr1h4 homozygous knockout 5um |
| GSE202310_1_v_0_ube3d_mouse | 3t3 l1 cells wt biol rep cell line mouse embryonic fibroblast vs 3t3 l1 cells ube3d ko biol rep cell line mouse embryonic fibroblast knockout |
| GSE226770_3_v_0_atrx_human | gi n atrx wild type clone cell line neuroblastoma sex female vs gi n atrx exon 2 13 deletion clone cell line neuroblastoma frame sex female |
| GSE261563_5_v_1_atrx_human | 603 veh cell line ts glioma stem atrx wildtype dmso time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE240027,GSE240030_1_v_4_atrx_mouse | wt rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs sg5 g7 cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE261563_3_v_1_atrx_human | 543 veh cell line ts glioma stem atrx wildtype dmso time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE240030,GSE252532_0_v_2_atrx_human | wt (rna seq) cell line ups (3672 3) undifferentiated pleomorphic sarcoma vs sg1 clone4 (rna seq) cell line ups (3672 3) undifferentiated pleomorphic sarcoma atrx knockout |
| GSE226770_1_v_6_atrx_human | sk n atrx wild type clone cell line neuroblastoma sex female vs gi n atrx exon 2 10 deletion clone cell line neuroblastoma frame sex female |
| GSE261563_0_v_1_atrx_human | 818 veh cell line gs 8 18 glioma stem atrx deficient dmso time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE261563_9_v_4_atrx_human | sh590 veh cell line ts 543 glioma stem atrx knockdown dmso time 48 hours vs 522 cx cell line gs 5 22 glioma stem atrx deficient 5461 time 48 hours |
| GSE194396,GSE194429_2_v_3_atrx_human | hffs wt control untreated human foreskin fibroblasts (hffs) vs hffs dox ifn induced atrx knockdown treated stimulated î² human foreskin fibroblasts (hffs) |
| GSE240027,GSE240030_1_v_0_atrx_mouse | wt rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs sg6 b10 cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE100464,GSE100465_1_v_3_atrx_mouse | p53 wt atrx ko forebrain neuroepithelial progenitor cell passage 8 10 strain mixed tp53+/+ npc vs p53 ko atrx forebrain neuroepithelial progenitor cell passage 8 10 strain mixed tp53 / npc |
| GSE240027,GSE240030_5_v_4_atrx_mouse | wt cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs sg5 g7 cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE194396,GSE194429_1_v_3_atrx_human | hffs wt ifn control stimulated î² human foreskin fibroblasts (hffs) vs hffs dox ifn induced atrx knockdown treated stimulated î² human foreskin fibroblasts (hffs) |
| GSE194396,GSE194429_1_v_0_atrx_human | hffs wt ifn control stimulated î² human foreskin fibroblasts (hffs) vs hffs dox induced atrx knockdown treated human foreskin fibroblasts (hffs) |
| GSE240027,GSE240030_1_v_2_atrx_mouse | wt rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs g7 rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE261563_9_v_1_atrx_human | sh590 veh cell line ts 543 glioma stem atrx knockdown dmso time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE167546_1_v_2_atrx_human | rna seq non silenced control cell line 143b human osteosarcoma (gfp) os vs rna seq shrna 1 rep cell line 143b human osteosarcoma knockdown atrx construct os |
| GSE226770_1_v_0_atrx_human | sk n atrx wild type clone cell line neuroblastoma sex female vs gi n atrx exon 2 13 deletion clone cell line neuroblastoma frame sex female |
| GSE240027,GSE240030_1_v_3_atrx_mouse | wt rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs b10 rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE261563_9_v_8_atrx_human | sh590 veh cell line ts 543 glioma stem atrx knockdown dmso time 48 hours vs 818 cx cell line gs 8 18 glioma stem atrx deficient 5461 time 48 hours |
| GSE240027,GSE240030_5_v_3_atrx_mouse | wt cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs b10 rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE261563_6_v_1_atrx_human | 522 veh cell line gs 5 22 glioma stem atrx deficient dmso time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE194396,GSE194429_2_v_0_atrx_human | hffs wt control untreated human foreskin fibroblasts (hffs) vs hffs dox induced atrx knockdown treated human foreskin fibroblasts (hffs) |
| GSE261563_7_v_1_atrx_human | 603 cx cell line ts glioma stem atrx wildtype 5461 time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE100464,GSE100465_0_v_3_atrx_mouse | p53 ko atrx fl ctrl forebrain neuroepithelial progenitor cell passage 8 10 strain mixed tp53 / atrx+ npc vs p53 ko atrx forebrain neuroepithelial progenitor cell passage 8 10 strain mixed tp53 / npc |
| GSE178113,GSE178116_0_v_1_atrx_mouse | 4247michigan c39e atrx wild type gbm neurosphere cell line mouse vs 4247michigan c54b atrx knockout gbm neurosphere cell line mouse |
| GSE226770_3_v_6_atrx_human | gi n atrx wild type clone cell line neuroblastoma sex female vs gi n atrx exon 2 10 deletion clone cell line neuroblastoma frame sex female |
| GSE261563_2_v_1_atrx_human | 543 cx cell line ts glioma stem atrx wildtype 5461 time 48 hours vs sh590 cx cell line ts 543 glioma stem atrx knockdown 5461 time 48 hours |
| GSE240027,GSE240030_5_v_0_atrx_mouse | wt cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs sg6 b10 cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE240027,GSE240030_5_v_2_atrx_mouse | wt cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor vs g7 rrnadeplete cell line c3h/10t1/2 (ccl 226) cells mesenchymal progenitor atrx knockout |
| GSE144745_0_v_1_mettl4_human | wt rnaseq cell line hek293t m6a antibody na passage number 3 20 human embryonic kidney cells vs mettl4 ko rnaseq cell line hek293t m6a antibody na passage number 3 20 human embryonic kidney cells |
| GSE214212_2_v_0_chd6_human | rnaseq chd6 control cell line c4 2 prostate none castration resistant cancer vs rnaseq e2f1 cell line c4 2 prostate knockdown none castration resistant cancer |
| GSE214212_3_v_1_chd6_human | rnaseq e2f1 control cell line c4 2 prostate none castration resistant cancer vs rnaseq chd6 cell line c4 2 prostate knockdown none castration resistant cancer |
| GSE214212_2_v_1_chd6_human | rnaseq chd6 control cell line c4 2 prostate none castration resistant cancer vs rnaseq chd6 cell line c4 2 prostate knockdown none castration resistant cancer |
| GSE218378_1_v_0_pbx1_human | hct116 cells ovcontrol colon cell line cancer wt vs hct116 cells ov pbx1 colon cell line cancer overexpression |
| GSE70883,GSE71179_0_v_1_pbx1_mouse | d2 mn clone hb9 gfp mesc /variation wildtype control protocol clones harvested day 2 differentiation media mouse motor neuron cultures (d2 mn) vs d2 mn pbx1 i6 +/ clone hb9 gfp mesc /variation crispr deletion protocol clones harvested day 2 differentiation media mouse motor neuron cultures (d2 mn) |
| GSE212074_0_v_1_pus1_human | mda mb 231 cells shcontrol bio cell line breast cancer shrna control vs mda mb 231 cells shpus1 bio cell line breast cancer pus1 knockdown |
| GSE183890_7_v_6_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain mock second x31 days post infection vs ifitm3 lung ko sex first challenge strain mock second pr8 days post infection 3 |
| GSE183890_7_v_0_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain mock second x31 days post infection vs ifitm3 lung ko sex first challenge strain pr8 second days post infection 3 |
| GSE155305_2_v_1_ifitm3_mouse | bcr abl1 wt hematopoietic malignancy pre b cells transformed ifitm3+/+ oncogene vs nras g12d ifitm3 ko hematopoietic malignancy pre b cells transformed / oncogene |
| GSE176472_1_v_0_ifitm3_mouse | control retina vs ifitm ifitm3 knockdown retina |
| GSE155305_2_v_0_ifitm3_mouse | bcr abl1 wt hematopoietic malignancy pre b cells transformed ifitm3+/+ oncogene vs bcr abl1 ifitm3 ko hematopoietic malignancy pre b cells transformed / oncogene |
| GSE155305_3_v_1_ifitm3_mouse | nras g12d wt hematopoietic malignancy pre b cells transformed ifitm3+/+ oncogene vs nras g12d ifitm3 ko hematopoietic malignancy pre b cells transformed / oncogene |
| GSE155305_3_v_0_ifitm3_mouse | nras g12d wt hematopoietic malignancy pre b cells transformed ifitm3+/+ oncogene vs bcr abl1 ifitm3 ko hematopoietic malignancy pre b cells transformed / oncogene |
| GSE183890_2_v_0_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain pr8 second x31 days post infection 3 vs ifitm3 lung ko sex first challenge strain pr8 second days post infection 3 |
| GSE183890_7_v_10_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain mock second x31 days post infection vs ifitm3 lung ko sex f first challenge strain pr8 second days post infection 3 |
| GSE183890_3_v_6_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain mock second pr8 days post infection 3 vs ifitm3 lung ko sex first challenge strain mock second pr8 days post infection 3 |
| GSE183890_2_v_6_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain pr8 second x31 days post infection 3 vs ifitm3 lung ko sex first challenge strain mock second pr8 days post infection 3 |
| GSE183890_2_v_10_ifitm3_mouse | ifitm3 lung wt sex f first challenge strain pr8 second x31 days post infection 3 vs ifitm3 lung ko sex f first challenge strain pr8 second days post infection 3 |
| GSE224677_2_v_1_dhx9_human | cell line breast cancer sk br 3 knockdown transduced shrna scramble control + shscr vs cell line breast cancer adar1 dhx9 knockdown transduced shrnas shadar1 + shdhx9 |
| GSE165074_0_v_1_fam114a1_mouse | wt acf strain c57bl/6 cardiac cells heart vs fam114a1 / acf strain c57bl/6 cardiac cells ko heart |
| GSE119973_5_v_1_phf6_mouse | wt c99f strain c57bl/6 cortex age p0 vs phf6 ko strain c57bl/6 cortex age p0 |
| GSE129465_3_v_2_phf6_mouse | p6 wt mpp3 strain c57bl/6 bone marrow phf6 wild type age 12 weeks vs p7 phf6 ko mpp2 strain c57bl/6 bone marrow knockout age 12 weeks |
| GSE120248,GSE120252_1_v_0_macf1_mouse | mc3t3 e1 nc cell line osteoblast control age vs mc3t3 e1 sh cell line osteoblast macf1 knockdown age |
| GSE176310_1_v_0_c1qbp_mouse | wt strain c57bl/6 spleen wild type sex male day post infection age 11 weeks cd8+ cells cell subtype p14 vs c1qbp ko strain c57bl/6 spleen c1qpb sex day post infection age 11 weeks cd8+ cells cell subtype p14 |
| GSE206784_3_v_4_ninl_human | a549 wt interferon 24h cell line epithelial cells 100u ifn alpha time vs a549 ninl ko 24h cell line epithelial cells time |
| GSE206784_2_v_4_ninl_human | a549 wt 24h cell line epithelial cells time vs a549 ninl ko 24h cell line epithelial cells time |
| GSE225684_0_v_2_tfap4_mouse | control bone marrow pre b cells vs tfap4 ko bone marrow pre b cells |
| GSE119564_1_v_3_zfp217_mouse | wt 2 rna seq cell line 3t3l1 /variation wild type growth mdi day vs ko 0 rna seq cell line 3t3l1 /variation zfp217 / growth mdi day |
| GSE119564_2_v_0_zfp217_mouse | wt 0 rna seq cell line 3t3l1 /variation wild type growth mdi day vs ko 2 rna seq cell line 3t3l1 /variation zfp217 / growth mdi day |
| GSE119564_2_v_3_zfp217_mouse | wt 0 rna seq cell line 3t3l1 /variation wild type growth mdi day vs ko 0 rna seq cell line 3t3l1 /variation zfp217 / growth mdi day |
| GSE119564_1_v_0_zfp217_mouse | wt 2 rna seq cell line 3t3l1 /variation wild type growth mdi day vs ko 2 rna seq cell line 3t3l1 /variation zfp217 / growth mdi day |
| GSE227698_2_v_4_g0s2_human | cell line mda mb 231 er breast cancer origin g0s2 overexpression control vs cell line t47d er+ breast cancer origin g0s2 overexpression 15 day |
| GSE227698_2_v_3_g0s2_human | cell line mda mb 231 er breast cancer origin g0s2 overexpression control vs cell line mda mb 231 er breast cancer origin g0s2 overexpression 15 day |
| GSE227698_5_v_0_g0s2_human | cell line t47d er+ breast cancer origin g0s2 overexpression control vs cell line mda mb 231 er breast cancer origin g0s2 overexpression 3 day |
| GSE227698_5_v_3_g0s2_human | cell line t47d er+ breast cancer origin g0s2 overexpression control vs cell line mda mb 231 er breast cancer origin g0s2 overexpression 15 day |
| GSE227698_5_v_1_g0s2_human | cell line t47d er+ breast cancer origin g0s2 overexpression control vs cell line t47d er+ breast cancer origin g0s2 overexpression 3 day |
| GSE227698_2_v_0_g0s2_human | cell line mda mb 231 er breast cancer origin g0s2 overexpression control vs cell line mda mb 231 er breast cancer origin g0s2 overexpression 3 day |
| GSE227698_5_v_4_g0s2_human | cell line t47d er+ breast cancer origin g0s2 overexpression control vs cell line t47d er+ breast cancer origin g0s2 overexpression 15 day |
| GSE227698_2_v_1_g0s2_human | cell line mda mb 231 er breast cancer origin g0s2 overexpression control vs cell line t47d er+ breast cancer origin g0s2 overexpression 3 day |
| GSE165678_3_v_5_stat5a_human | wt 0 cell line mcf7 stat5a knockdown endogenous rescue wild type (wt) untreated biological replicate rep cells vs y694f prl cell line mcf7 stat5a knockdown endogenous rescue point mutant treated 2 hours biological replicate rep cells |
| GSE165678_8_v_5_stat5a_human | s780a 0 cell line mcf7 stat5a knockdown endogenous rescue point mutant untreated biological replicate rep cells vs y694f prl cell line mcf7 stat5a knockdown endogenous rescue point mutant treated 2 hours biological replicate rep cells |
| GSE165678_0_v_5_stat5a_human | s726a 0 cell line mcf7 stat5a knockdown endogenous rescue point mutant untreated biological replicate rep cells vs y694f prl cell line mcf7 stat5a knockdown endogenous rescue point mutant treated 2 hours biological replicate rep cells |
| GSE165678_4_v_5_stat5a_human | wt prl cell line mcf7 stat5a knockdown endogenous rescue wild type (wt) treated 2 hours biological replicate rep cells vs y694f prl cell line mcf7 stat5a knockdown endogenous rescue point mutant treated 2 hours biological replicate rep cells |
| GSE165678_3_v_2_stat5a_human | wt 0 cell line mcf7 stat5a knockdown endogenous rescue wild type (wt) untreated biological replicate rep cells vs prl cell line mcf7 stat5a knockdown endogenous rescue point mutant treated 2 hours biological replicate rep cells |
| GSE122708,GSE123105_2_v_1_pcf11_human | chrrna seq wild type hela trex flip molecule subtype chromatin bound rna / control pcf11 pas1 deletion vs chrrna seq mub hela trex flip molecule subtype chromatin bound rna / pcf11 pas1 deletion clone |
| GSE123105,GSE124556_0_v_2_pcf11_human | 3'mrnaseq wt molecule subtype 3' end mrna / wild type control pcf11 pas1 deletion hela trex flip vs 3'mrnaseq sipcf11 molecule subtype 3' end mrna / pcf11 knock nm) hela cells |
| GSE123105,GSE124556_0_v_5_pcf11_human | 3'mrnaseq wt molecule subtype 3' end mrna / wild type control pcf11 pas1 deletion hela trex flip vs 3'mrnaseq mub molecule subtype 3' end mrna / pcf11 pas1 deletion clone hela trex flip |
| GSE123105,GSE124556_0_v_3_pcf11_human | 3'mrnaseq wt molecule subtype 3' end mrna / wild type control pcf11 pas1 deletion hela trex flip vs 3'mrnaseq molecule subtype 3' end mrna / pcf11 pas1 deletion clone hela trex flip |
| GSE143994_0_v_1_ythdf1_human | hek293 control total rnaseq wild type cell line human embryonic kidney cells vs hek293 y1 ko tt(nascent) rnaseq ythdf1 / cell line human embryonic kidney cells |
| GSE143994_2_v_3_ythdf1_human | hek293 control tt(nascent) rnaseq wild type cell line human embryonic kidney cells vs hek293 y1 ko total rnaseq ythdf1 / cell line human embryonic kidney cells |
| GSE143994_2_v_1_ythdf1_human | hek293 control tt(nascent) rnaseq wild type cell line human embryonic kidney cells vs hek293 y1 ko tt(nascent) rnaseq ythdf1 / cell line human embryonic kidney cells |
| GSE203308_15_v_3_brf1_mouse | pindd0 cell line st2 stromal cells empty control maf1 overexpression osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_14_v_5_brf1_mouse | scrbd0 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shmad4 cell line st2 stromal cells maf1 knockdown osteoblast differentiation |
| GSE203308_8_v_10_brf1_mouse | scrmd0 cell line st2 stromal cells scramble control shmaf1 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_4_v_10_brf1_mouse | pindd4 cell line st2 stromal cells empty control maf1 overexpression osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_7_v_3_brf1_mouse | scrbd4 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_6_v_3_brf1_mouse | dmsod0 cell line st2 stromal cells dmso control ml 60218 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_8_v_3_brf1_mouse | scrmd0 cell line st2 stromal cells scramble control shmaf1 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_14_v_10_brf1_mouse | scrbd0 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_6_v_10_brf1_mouse | dmsod0 cell line st2 stromal cells dmso control ml 60218 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_1_v_10_brf1_mouse | scrmd4 cell line st2 stromal cells scramble control shmaf1 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_9_v_10_brf1_mouse | dmsod4 cell line st2 stromal cells dmso control ml 60218 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_9_v_3_brf1_mouse | dmsod4 cell line st2 stromal cells dmso control ml 60218 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_14_v_0_brf1_mouse | scrbd0 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs cell line st2 stromal cells maf1 overexpression osteoblast differentiation |
| GSE203308_15_v_10_brf1_mouse | pindd0 cell line st2 stromal cells empty control maf1 overexpression osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_7_v_5_brf1_mouse | scrbd4 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shmad4 cell line st2 stromal cells maf1 knockdown osteoblast differentiation |
| GSE203308_4_v_3_brf1_mouse | pindd4 cell line st2 stromal cells empty control maf1 overexpression osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_7_v_0_brf1_mouse | scrbd4 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs cell line st2 stromal cells maf1 overexpression osteoblast differentiation |
| GSE203308_7_v_10_brf1_mouse | scrbd4 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shbrd0 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_1_v_3_brf1_mouse | scrmd4 cell line st2 stromal cells scramble control shmaf1 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE203308_14_v_3_brf1_mouse | scrbd0 cell line st2 stromal cells scramble control shbrf1 osteoblast differentiation vs shbrd4 cell line st2 stromal cells brf1 knockdown osteoblast differentiation |
| GSE225083_0_v_1_kras_mouse | kp vim wt lung cell line kpv+/+ adenocarcinoma krasg12d/+ tp53 / vim+/+ none vs kpv vim ko lung cell line / adenocarcinoma krasg12d/+ tp53 none |
| GSE189637_0_v_1_parg_mouse | 3t3 cells induced cell line type malignant control vs 3t3 cells overexpressing parg cell line type malignant overexpression |
| GSE196962_2_v_6_parg_human | pc 3 teton parg h6 exp nodox control type prostate cancer cell line vs pc 3 teton parg i4 exp "n" dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE196962_2_v_3_parg_human | pc 3 teton parg h6 exp nodox control type prostate cancer cell line vs pc 3 teton parg h6 exp dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE196962_2_v_1_parg_human | pc 3 teton parg h6 exp nodox control type prostate cancer cell line vs pc 3 teton parg i4 exp "b" dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE196962_4_v_3_parg_human | pc 3 teton parg i4 exp nodox control type prostate cancer cell line vs pc 3 teton parg h6 exp dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE196962_4_v_1_parg_human | pc 3 teton parg i4 exp nodox control type prostate cancer cell line vs pc 3 teton parg i4 exp "b" dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE196962_4_v_6_parg_human | pc 3 teton parg i4 exp nodox control type prostate cancer cell line vs pc 3 teton parg i4 exp "n" dox overexpression type prostate cancer cell line 500ng/ml doxycycline |
| GSE126777_3_v_1_otub1_mouse | strain background c57bl/6 /variation otub1 dko age 6 8 week old spleen splenic dcs untreated ko vs 24h ko strain background c57bl/6 /variation otub1 dko age 6 8 week old anti cd3 (1ug/ml) plus cd28 24 h spleen splenic dcs treated |
| GSE126777_2_v_1_otub1_mouse | 24h wt strain background c57bl/6 /variation age 6 8 week old anti cd3 (1ug/ml) plus cd28 24 h spleen splenic dcs treated vs 24h ko strain background c57bl/6 /variation otub1 dko age 6 8 week old anti cd3 (1ug/ml) plus cd28 24 h spleen splenic dcs treated |
| GSE126777_0_v_1_otub1_mouse | strain background c57bl/6 /variation wt age 6 8 week old spleen splenic dcs untreated vs 24h ko strain background c57bl/6 /variation otub1 dko age 6 8 week old anti cd3 (1ug/ml) plus cd28 24 h spleen splenic dcs treated |
| GSE137144_5_v_6_nlrp3_mouse | vat wt visceral adipose b cells cohort vs vat nlrp3 ko old age visceral adipose b cells cohort 3 |
| GSE137144_3_v_1_nlrp3_mouse | spleen wt old age b cells cohort 3 vs spleen nlrp3 b cells ko cohort |
| GSE137144_3_v_0_nlrp3_mouse | spleen wt old age b cells cohort 3 vs vat nlrp3 visceral adipose b cells ko cohort |
| GSE137144_3_v_6_nlrp3_mouse | spleen wt old age b cells cohort 3 vs vat nlrp3 ko old age visceral adipose b cells cohort 3 |
| GSE137144_2_v_7_nlrp3_mouse | vat wt young age visceral adipose b cells cohort 3 vs spleen nlrp3 ko old age b cells cohort 3 |
| GSE137144_4_v_1_nlrp3_mouse | spleen wt 1 b cells cohort vs spleen nlrp3 b cells ko cohort |
| GSE217363_4_v_1_nlrp3_mouse | liver oil wild type 6 week .p. vs liver taa hepatocyte specific nlrp3 deletion 8 week thioacetamide .p. |
| GSE217363_2_v_1_nlrp3_mouse | liver ccl4 wild type 6 week .p. vs liver taa hepatocyte specific nlrp3 deletion 8 week thioacetamide .p. |
| GSE217363_5_v_1_nlrp3_mouse | liver taa wild type 8 week thioacetamide .p. vs liver taa hepatocyte specific nlrp3 deletion 8 week thioacetamide .p. |
| GSE137144_5_v_1_nlrp3_mouse | vat wt visceral adipose b cells cohort vs spleen nlrp3 b cells ko cohort |
| GSE137144_5_v_7_nlrp3_mouse | vat wt visceral adipose b cells cohort vs spleen nlrp3 ko old age b cells cohort 3 |
| GSE137144_4_v_7_nlrp3_mouse | spleen wt 1 b cells cohort vs spleen nlrp3 ko old age b cells cohort 3 |
| GSE137144_2_v_1_nlrp3_mouse | vat wt young age visceral adipose b cells cohort 3 vs spleen nlrp3 b cells ko cohort |
| GSE137144_4_v_0_nlrp3_mouse | spleen wt 1 b cells cohort vs vat nlrp3 visceral adipose b cells ko cohort |
| GSE217363_6_v_1_nlrp3_mouse | hepatocyte lps+nigericin+mcc950 primary murine wild type 6h lps 30min nigericin mcc950 2h vs liver taa hepatocyte specific nlrp3 deletion 8 week thioacetamide .p. |
| GSE137144_2_v_6_nlrp3_mouse | vat wt young age visceral adipose b cells cohort 3 vs vat nlrp3 ko old age visceral adipose b cells cohort 3 |
| GSE137144_4_v_6_nlrp3_mouse | spleen wt 1 b cells cohort vs vat nlrp3 ko old age visceral adipose b cells cohort 3 |
| GSE137144_2_v_0_nlrp3_mouse | vat wt young age visceral adipose b cells cohort 3 vs vat nlrp3 visceral adipose b cells ko cohort |
| GSE217363_0_v_1_nlrp3_mouse | hepatocyte lps+nigericin primary murine wild type 6h lps 30min nigericin vs liver taa hepatocyte specific nlrp3 deletion 8 week thioacetamide .p. |
| GSE165939_2_v_1_poldip2_mouse | endothelial enriched poldip2 floxed repeat strain c57bl/6 carotid artery endothelium age 10 wk old littermate control vs left carotid artery poldip2 smc / repeat strain c57bl/6 age 10 wk old knockout |
| GSE165274_1_v_2_poldip2_mouse | left carotid artery littermate ctrl repeat strain c57bl/6 age 10 wk old control vs left carotid artery global poldip2 / repeat strain c57bl/6 age 10 wk old knockout |
| GSE207158_0_v_1_poldip2_human | wildtype biol rep cell line arpe19 retinal pigment epithelial cells regular maintenance time day 3 vs poldip2 ko biol rep cell line arpe19 retinal pigment epithelial cells poldip knockout regular maintenance time day 3 |
| GSE197571_3_v_1_foxm1_human | con cell line mgc803 cells gastric adenocarcinoma infected control virus vs crisp cell line mgc803 cells gastric adenocarcinoma foxm1 knockout |
| GSE197571_2_v_1_foxm1_human | wt cell line mgc803 cells gastric adenocarcinoma untreated vs crisp cell line mgc803 cells gastric adenocarcinoma foxm1 knockout |
| GSE70499_3_v_6_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE214514_1_v_7_bmal1_mouse | wt young microglia cd11b cre age vs ko aged microglia cd11b cre bmal1 lox/lox age |
| GSE148510_1_v_2_bmal1_mouse | wt m1 8h bone marrow derived macrophages primimg interferon gamma primed stimulated lipolysaccharide wild type strain c57/bl6 vs bko m1 8h bone marrow derived macrophages primimg interferon gamma primed stimulated lipolysaccharide myeloid bmal1 ko strain c57/bl6 |
| GSE70499_3_v_7_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex female age weeks weight gram cage number liver sample collection time |
| GSE70499_0_v_2_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE70499_5_v_6_bmal1_mouse | wt zt12 strain/background c57bl/6 /variation sex age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE148510_3_v_2_bmal1_mouse | wt ifng bone marrow derived macrophages primimg interferon gamma primed subsequent stimulation wild type strain c57/bl6 vs bko m1 8h bone marrow derived macrophages primimg interferon gamma primed stimulated lipolysaccharide myeloid bmal1 ko strain c57/bl6 |
| GSE70499_5_v_7_bmal1_mouse | wt zt12 strain/background c57bl/6 /variation sex age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex female age weeks weight gram cage number liver sample collection time |
| GSE135359_0_v_1_bmal1_mouse | wild type sample strain c57bl/6 bmal1 flox sorted ilc3s small intestine lamina propria vs ko sample strain c57bl/6 bmal1 flox rorc cre sorted ilc3s small intestine lamina propria |
| GSE239541_5_v_7_bmal1_mouse | opcs bmal1 wt zt18 rep forebrain time oligodendrocyte precursor cells ng2 cre bmal1fl/fl devleopmental stage p6 p7 vs opcs bmal1 ko zt18 rep forebrain time oligodendrocyte precursor cells ng2 cre+ bmal1fl/fl devleopmental stage p6 p7 |
| GSE239541_8_v_4_bmal1_mouse | opcs bmal1 wt zt6 rep forebrain time oligodendrocyte precursor cells ng2 cre bmal1fl/fl devleopmental stage p6 p7 vs opcs bmal1 ko zt12 rep forebrain time oligodendrocyte precursor cells ng2 cre+ bmal1fl/fl devleopmental stage p6 p7 |
| GSE70499_4_v_2_bmal1_mouse | wt strain/background c57bl/6 /variation sex female age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE70499_4_v_1_bmal1_mouse | wt strain/background c57bl/6 /variation sex female age weeks weight gram cage number liver sample collection time vs ko zt20 strain/background c57bl/6 /variation bmal1 sex age weeks weight gram cage number liver sample collection time |
| GSE239541_11_v_7_bmal1_mouse | opcs bmal1 wt zt0 rep forebrain time oligodendrocyte precursor cells ng2 cre bmal1fl/fl devleopmental stage p6 p7 vs opcs bmal1 ko zt18 rep forebrain time oligodendrocyte precursor cells ng2 cre+ bmal1fl/fl devleopmental stage p6 p7 |
| GSE70499_0_v_6_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE202284,GSE202289_12_v_4_bmal1_mouse | cell line yumm2.1 arntl ctr bmal1 myh9 shnc sirna 1 replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE148510_3_v_0_bmal1_mouse | wt ifng bone marrow derived macrophages primimg interferon gamma primed subsequent stimulation wild type strain c57/bl6 vs bko ifng bone marrow derived macrophages primimg interferon gamma primed subsequent stimulation myeloid bmal1 ko strain c57/bl6 |
| GSE202284,GSE202289_7_v_4_bmal1_mouse | cell line yumm2.1 arntl ctr bmal1 ev myh9 shmyh9 sirna replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE202284,GSE202289_3_v_4_bmal1_mouse | cell line yumm1.7 arntl ctr bmal1 myh9 na sirna replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE129725_4_v_5_bmal1_mouse | cre ctrl f adrenal gland age months scc sex vs cre bmal ko f adrenal gland age months scc bmal1 sex |
| GSE129725_1_v_0_bmal1_mouse | cre ctrl adrenal gland age months scc sex vs cre bmal ko adrenal gland age months scc bmal1 sex |
| GSE70499_3_v_1_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko zt20 strain/background c57bl/6 /variation bmal1 sex age weeks weight gram cage number liver sample collection time |
| GSE70499_0_v_7_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex female age weeks weight gram cage number liver sample collection time |
| GSE129725_1_v_5_bmal1_mouse | cre ctrl adrenal gland age months scc sex vs cre bmal ko f adrenal gland age months scc bmal1 sex |
| GSE70499_4_v_6_bmal1_mouse | wt strain/background c57bl/6 /variation sex female age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE70499_4_v_7_bmal1_mouse | wt strain/background c57bl/6 /variation sex female age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex female age weeks weight gram cage number liver sample collection time |
| GSE129725_4_v_0_bmal1_mouse | cre ctrl f adrenal gland age months scc sex vs cre bmal ko adrenal gland age months scc bmal1 sex |
| GSE239541_8_v_7_bmal1_mouse | opcs bmal1 wt zt6 rep forebrain time oligodendrocyte precursor cells ng2 cre bmal1fl/fl devleopmental stage p6 p7 vs opcs bmal1 ko zt18 rep forebrain time oligodendrocyte precursor cells ng2 cre+ bmal1fl/fl devleopmental stage p6 p7 |
| GSE70499_3_v_2_bmal1_mouse | wt strain/background c57bl/6 /variation sex male age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE115264_12_v_11_bmal1_mouse | sample strain c57bl/6 wt collection time replicate liver adipocyte vs sample strain c57bl/6 bmal1 knockout (ko) collection time replicate liver adipocyte |
| GSE202284,GSE202289_5_v_4_bmal1_mouse | cell line yumm2.1 arntl ctr bmal1 dh myh9 shmyh9 sirna replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE202284,GSE202289_0_v_4_bmal1_mouse | cell line yumm2.1 arntl ctr bmal1 myh9 na sirna replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE239541_0_v_7_bmal1_mouse | opcs bmal1 wt zt12 rep forebrain time oligodendrocyte precursor cells ng2 cre bmal1fl/fl devleopmental stage p6 p7 vs opcs bmal1 ko zt18 rep forebrain time oligodendrocyte precursor cells ng2 cre+ bmal1fl/fl devleopmental stage p6 p7 |
| GSE214514_3_v_2_bmal1_mouse | wt aged microglia cd11b cre age vs ko young microglia cd11b cre bmal1 lox/lox age |
| GSE70499_5_v_1_bmal1_mouse | wt zt12 strain/background c57bl/6 /variation sex age weeks weight gram cage number liver sample collection time vs ko zt20 strain/background c57bl/6 /variation bmal1 sex age weeks weight gram cage number liver sample collection time |
| GSE70499_5_v_2_bmal1_mouse | wt zt12 strain/background c57bl/6 /variation sex age weeks weight gram cage number liver sample collection time vs ko strain/background c57bl/6 /variation bmal1 sex male age weeks weight gram cage number liver sample collection time |
| GSE202284,GSE202289_1_v_4_bmal1_mouse | cell line yumm2.1 arntl ctr bmal1 wt myh9 shmyh9 sirna replicate vs cell line yumm2.1 arntl ko bmal1 myh9 na sirna replicate |
| GSE113221,GSE113968_4_v_1_prdm1_mouse | wt strain c57bl/6 tumor /variation wild type b16f10 melanoma vs prdm1 ko strain c57bl/6 tumor /variation cko b16f10 melanoma |
| GSE113221,GSE113968_6_v_1_prdm1_mouse | wt strain c57bl/6 tumor /variation wild type b16f10 melanoma vs prdm1 ko strain c57bl/6 tumor /variation cko b16f10 melanoma |
| GSE197562_1_v_3_nox4_mouse | wt tgfb2 rep strain c57bl/6 skin stimulation 10 ng/ml tgf beta 2 24h primary mouse fibroblasts vs nox4 ko tgfb2 strain b6.129 nox4tm1kkr/j skin stimulation 10 ng/ml tgf beta 2 24h primary mouse fibroblasts |
| GSE197562_2_v_3_nox4_mouse | wt ctrl rep strain c57bl/6 skin stimulation non primary mouse fibroblasts vs nox4 ko tgfb2 strain b6.129 nox4tm1kkr/j skin stimulation 10 ng/ml tgf beta 2 24h primary mouse fibroblasts |
| GSE197562_0_v_3_nox4_mouse | nox4 ko ctrl rep strain b6.129 nox4tm1kkr/j skin stimulation non primary mouse fibroblasts vs nox4 ko tgfb2 strain b6.129 nox4tm1kkr/j skin stimulation 10 ng/ml tgf beta 2 24h primary mouse fibroblasts |
| GSE88777_0_v_1_cnot7_mouse | scrambled cultured hippocampal neurons /variation control days vitro (div) 17 19 div poly() tail size vs cnot7kd cultured hippocampal neurons /variation cnot7 knockdown days vitro (div) 17 19 div poly() tail size |
| GSE202198,GSE202199_1_v_0_hmg20a_mouse | mesc wt rna cell line mes v6.5 embryonic stem cardiomyocyte differentiation vs mesc hmg20a ko rna cell line mes v6.5 embryonic stem knock cardiomyocyte differentiation |
| GSE121866_0_v_2_six4_human | pc9 neo cell line non small lung cancer cells control vs pc9 six4 cell line non small lung cancer cells stable overexpression |
| GSE121866_1_v_3_six4_human | a549 neo cell line non small lung cancer cells control vs a549 six4 cell line non small lung cancer cells stable overexpression |
| GSE121866_0_v_3_six4_human | pc9 neo cell line non small lung cancer cells control vs a549 six4 cell line non small lung cancer cells stable overexpression |
| GSE183251_1_v_6_cyp2c70_mouse | fwtsc female wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs fcypsc female cyp ko sc435 strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex 0.006% sc 435 diet |
| GSE183251_7_v_6_cyp2c70_mouse | fwtch female wt chow strain c57bl/6 liver age 12 week adult mouse wild type sex vs fcypsc female cyp ko sc435 strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex 0.006% sc 435 diet |
| GSE183251_7_v_3_cyp2c70_mouse | fwtch female wt chow strain c57bl/6 liver age 12 week adult mouse wild type sex vs mcypsc male cyp ko sc435 strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex 0.006% sc 435 diet |
| GSE183251_4_v_5_cyp2c70_mouse | mwtsc male wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs mcypch male cyp ko chow strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex |
| GSE183251_1_v_0_cyp2c70_mouse | fwtsc female wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs fcypch female cyp ko chow strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex |
| GSE183251_1_v_3_cyp2c70_mouse | fwtsc female wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs mcypsc male cyp ko sc435 strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex 0.006% sc 435 diet |
| GSE183251_4_v_0_cyp2c70_mouse | mwtsc male wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs fcypch female cyp ko chow strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex |
| GSE183251_1_v_5_cyp2c70_mouse | fwtsc female wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs mcypch male cyp ko chow strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex |
| GSE183251_7_v_5_cyp2c70_mouse | fwtch female wt chow strain c57bl/6 liver age 12 week adult mouse wild type sex vs mcypch male cyp ko chow strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex |
| GSE183251_4_v_6_cyp2c70_mouse | mwtsc male wt sc435 strain c57bl/6 liver age 12 week adult mouse wild type sex 0.006% sc 435 diet vs fcypsc female cyp ko sc435 strain c57bl/6 liver age 12 week adult mouse cyp2c70 / sex 0.006% sc 435 diet |
| GSE173873_10_v_11_stra8_mouse | wt23 dmso replicate wt germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_8_v_3_stra8_mouse | ko21 dmso replicate stra8 ko germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_4_v_3_stra8_mouse | ra replicate wt germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_4_v_11_stra8_mouse | ra replicate wt germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_4_v_13_stra8_mouse | ra replicate wt germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_0_v_11_stra8_mouse | ko20 dmso replicate stra8 ko germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_12_v_13_stra8_mouse | ko12 dmso replicate stra8 ko germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_1_v_6_stra8_mouse | wt17 ra replicate wt germ cell culture vs ntc 0hr replicate stra8 ko 0h germ cell culture |
| GSE173873_1_v_11_stra8_mouse | wt17 ra replicate wt germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_1_v_13_stra8_mouse | wt17 ra replicate wt germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_10_v_13_stra8_mouse | wt23 dmso replicate wt germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_8_v_11_stra8_mouse | ko21 dmso replicate stra8 ko germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_2_v_11_stra8_mouse | wt17 dmso replicate wt germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_12_v_11_stra8_mouse | ko12 dmso replicate stra8 ko germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_8_v_13_stra8_mouse | ko21 dmso replicate stra8 ko germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_1_v_3_stra8_mouse | wt17 ra replicate wt germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_5_v_3_stra8_mouse | wt25 dmso replicate wt germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_2_v_3_stra8_mouse | wt17 dmso replicate wt germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_2_v_13_stra8_mouse | wt17 dmso replicate wt germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_12_v_3_stra8_mouse | ko12 dmso replicate stra8 ko germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_10_v_3_stra8_mouse | wt23 dmso replicate wt germ cell culture vs ko20 ra replicate stra8 ko germ cell culture |
| GSE173873_0_v_13_stra8_mouse | ko20 dmso replicate stra8 ko germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_5_v_13_stra8_mouse | wt25 dmso replicate wt germ cell culture vs ko21 ra replicate stra8 ko germ cell culture |
| GSE173873_10_v_6_stra8_mouse | wt23 dmso replicate wt germ cell culture vs ntc 0hr replicate stra8 ko 0h germ cell culture |
| GSE173873_4_v_6_stra8_mouse | ra replicate wt germ cell culture vs ntc 0hr replicate stra8 ko 0h germ cell culture |
| GSE173873_5_v_11_stra8_mouse | wt25 dmso replicate wt germ cell culture vs ko12 ra replicate stra8 ko germ cell culture |
| GSE173873_8_v_6_stra8_mouse | ko21 dmso replicate stra8 ko germ cell culture vs ntc 0hr replicate stra8 ko 0h germ cell culture |
| GSE233548_1_v_0_plscr1_human | wt ifn cell line huh7.5 hepatocyte î³ vs pko ifn cell line huh7.5 hepatocyte plscr1 ko î³ |
| GSE233548_3_v_0_plscr1_human | pko untreated cell line huh7.5 hepatocyte plscr1 ko vs pko ifn cell line huh7.5 hepatocyte plscr1 ko î³ |
| GSE233548_2_v_0_plscr1_human | wt untreated cell line huh7.5 hepatocyte vs pko ifn cell line huh7.5 hepatocyte plscr1 ko î³ |
| GSE200214_0_v_2_mrgpra1_mouse | neutrophils wildtype sp infection streptococcus pneumoniae 6303 mrgpra1+/+ neutrophil vs neutrophils ko sp infection streptococcus pneumoniae 6303 mrgpra1 / neutrophil |
| GSE138019_1_v_2_nudt12_mouse | kidney nudt12 wt age 3 4 months zeitgeber na vs liver nudt12 ko age 3 4 months zeitgeber na |
| GSE138019_3_v_6_nudt12_mouse | liver nudt12 wt age 4 6 months zeitgeber vs kidney nudt12 ko age 3 4 months zeitgeber na |
| GSE138019_1_v_5_nudt12_mouse | kidney nudt12 wt age 3 4 months zeitgeber na vs liver nudt12 ko age 4 6 months zeitgeber |
| GSE138019_4_v_5_nudt12_mouse | liver nudt12 wt age 3 4 months zeitgeber na vs liver nudt12 ko age 4 6 months zeitgeber |
| GSE138019_4_v_6_nudt12_mouse | liver nudt12 wt age 3 4 months zeitgeber na vs kidney nudt12 ko age 3 4 months zeitgeber na |
| GSE138019_3_v_2_nudt12_mouse | liver nudt12 wt age 4 6 months zeitgeber vs liver nudt12 ko age 3 4 months zeitgeber na |
| GSE180525,GSE180528_2_v_0_tbx3_human | ipsc+/+ gt [wt d6] wildtype gut tube (day 6) differentiation protocol pancreatic differentation pluripotent stem cell derived cells vs ipsc / gt [tbx3 ko d6] tbx3 gut tube (day 6) differentiation protocol pancreatic differentation pluripotent stem cell derived cells |
| GSE180525,GSE180528_2_v_3_tbx3_human | ipsc+/+ gt [wt d6] wildtype gut tube (day 6) differentiation protocol pancreatic differentation pluripotent stem cell derived cells vs ipsc / pp1 1 [tbx3 ko d8] tbx3 pancreatic progenitor (day 8) differentiation protocol differentation pluripotent stem cell derived cells |
| GSE180525,GSE180528_1_v_3_tbx3_human | ipsc+/+ pp1 1 [wt d8] wildtype pancreatic progenitor (day 8) differentiation protocol differentation pluripotent stem cell derived cells vs ipsc / pp1 1 [tbx3 ko d8] tbx3 pancreatic progenitor (day 8) differentiation protocol differentation pluripotent stem cell derived cells |
| GSE180525,GSE180528_1_v_0_tbx3_human | ipsc+/+ pp1 1 [wt d8] wildtype pancreatic progenitor (day 8) differentiation protocol differentation pluripotent stem cell derived cells vs ipsc / gt [tbx3 ko d6] tbx3 gut tube (day 6) differentiation protocol pancreatic differentation pluripotent stem cell derived cells |
| GSE121319_1_v_2_gprc5a_human | pc3 control cell line background prostatic adenocarcinoma form epithelial like /variation pmscv luc transfected vs gprc5ako#1 cell line background pc3 prostatic adenocarcinoma form epithelial like /variation gprc5a knockout |
| GSE121319_1_v_0_gprc5a_human | pc3 control cell line background prostatic adenocarcinoma form epithelial like /variation pmscv luc transfected vs gprc5ako#2 cell line background pc3 prostatic adenocarcinoma form epithelial like /variation gprc5a knockout |
| GSE64642_0_v_1_sirt6_human | passage wt cell line background h9 /variation sirt6+/+ human mesenchymal stem (hmscs) vs passage ko cell line background h9 /variation sirt6 / human mesenchymal stem (hmscs) |
| GSE130690,GSE130692_2_v_0_sirt6_mouse | wt embryonic stem cells wild type passages passage 21 strain 129 svjae f1 mouse vs sirt6 ko embryonic stem cells knock passages passage 21 strain 129 svjae f1 mouse |
| GSE221077_1_v_0_sirt6_mouse | wt rep sex female brain vs brsirt6 ko rep sex female brain specific sirt6 knockout |
| GSE130690,GSE130692_1_v_0_sirt6_mouse | wtnoglucose embryonic stem cells wild type glucose deprivation passages passage 21 strain 129 svjae f1 mouse vs sirt6 ko embryonic stem cells knock passages passage 21 strain 129 svjae f1 mouse |
| GSE154069_2_v_1_satb1_mouse | wt tcrd strain c57bl/6 thymus age 4 12 weeks wild type thymocytes vs ko strain c57bl/6 thymus age 4 12 weeks satb1 / thymocytes |
| GSE154069_2_v_4_satb1_mouse | wt tcrd strain c57bl/6 thymus age 4 12 weeks wild type thymocytes vs ko tcrg strain c57bl/6 thymus age 4 12 weeks satb1 / thymocytes |
| GSE158853_0_v_1_hmgcs2_mouse | p7 liver hmgcs2 strain c57bl/6 /variation wt vs p7 liver hmgcs2 strain c57bl/6 /variation ko |
| GSE138097_0_v_2_otx2_mouse | cc p30 retina /variation control ablation occurs n/ days ko induction crx vs cc p34 retina /variation otx2 ko ablation occurs photoreceptor days induction 4 tam4 crx |
| GSE237426_0_v_1_eif4a1_mouse | ctrl strain c57bl/6 spleen b cells eif4a1+/+ cd23 cre 24h activation cd40lb sex vs eif4a1 ko strain c57bl/6 spleen b cells eif4a1fl/fl cd23 cre 24h activation cd40lb sex |
| GSE163275_1_v_0_irf8_human | mv4 11 rna seq control cell line myeloid leukaemia (aml) vs mv4 11 rna seq irf8ko cell line myeloid leukaemia (aml) irf8 ko |
| GSE208254_4_v_1_irf8_mouse | cell spleen activated b sorting markers cd11b f4/80 thy1.2 b220+gl7+cd138 thy1.1 irf8 wt sgrna none lps il2 il5 72 hrs vs cell spleen activated b sorting markers cd11b f4/80 thy1.2 b220+gl7+cd138 thy1.1+ irf8 ko sgrna 1 lps il2 il5 72 hrs |
| GSE208254_4_v_5_irf8_mouse | cell spleen activated b sorting markers cd11b f4/80 thy1.2 b220+gl7+cd138 thy1.1 irf8 wt sgrna none lps il2 il5 72 hrs vs spleen naive b cell sorting markers cd11b f4/80 thy1.2 b220+thy1.1+ irf8 ko sgrna none |
| GSE208254_3_v_2_irf8_mouse | spleen naive b cell sorting markers cd11b f4/80 thy1.2 b220+thy1.1 irf8 wt sgrna none vs spleen plasma cell sorting markers cd11b f4/80 thy1.2 b220+/midcd138+thy1.1+ irf8 ko sgrna 1 lps il2 il5 72 hrs |
| GSE208254_3_v_5_irf8_mouse | spleen naive b cell sorting markers cd11b f4/80 thy1.2 b220+thy1.1 irf8 wt sgrna none vs spleen naive b cell sorting markers cd11b f4/80 thy1.2 b220+thy1.1+ irf8 ko sgrna none |
| GSE208254_4_v_2_irf8_mouse | cell spleen activated b sorting markers cd11b f4/80 thy1.2 b220+gl7+cd138 thy1.1 irf8 wt sgrna none lps il2 il5 72 hrs vs spleen plasma cell sorting markers cd11b f4/80 thy1.2 b220+/midcd138+thy1.1+ irf8 ko sgrna 1 lps il2 il5 72 hrs |
| GSE208254_3_v_1_irf8_mouse | spleen naive b cell sorting markers cd11b f4/80 thy1.2 b220+thy1.1 irf8 wt sgrna none vs cell spleen activated b sorting markers cd11b f4/80 thy1.2 b220+gl7+cd138 thy1.1+ irf8 ko sgrna 1 lps il2 il5 72 hrs |
| GSE124048,GSE124067_1_v_0_irf6_mouse | skin wt sample id primary /variation rna kinase dead e16.5 vs skin irf6 ko sample id primary /variation rna kinase dead e16.5 |
| GSE201361_0_v_1_mpst_mouse | hfd inguinal white adipose wt high fat diet (hfd) vs hfd inguinal white adipose mpst knockout high fat diet (hfd) |
| GSE205630_0_v_1_gmds_human | hct116 cells shctrl biol rep cell line colorectal cancer wt vs hct116 cells gmds as1 shrna2 biol rep cell line colorectal cancer knockdown |
| GSE156033_1_v_2_sparc_mouse | t23 fibrob6 tumor cells co cultured wild type (fibro) fibroblasts + rep vs t23 fibro sparc ko tumor cells co cultured deficient (fibro sparcko) fibroblasts + sparcko rep |
| GSE240747_0_v_1_sparc_human | hepg2 cells expressing empty vector replicate cell line liver cancer wt none vs hepg2 cells hsparc overexpression replicate cell line liver cancer sparc none |
| GSE64513_0_v_1_foxd3_human | non small cell lung cancer (nsclc) cells line a549 wild type group tag control vs non small cell lung cancer (nsclc) cells line a549 foxd3 knockdown group tag |
| GSE158743_1_v_2_nfkbia_human | untreated cell line u2os osteosarcoma cells / vs nfkbia knockdown cell line u2os osteosarcoma cells / |
| GSE146156_2_v_3_tagap_mouse | wt untreated strain c57bl/6 bone marrow derived macrophages (bmdms) vs ko curdlan strain c57bl/6 bone marrow derived macrophages (bmdms) tagap treated (10ug/ml) |
| GSE146156_0_v_3_tagap_mouse | wt curdlan strain c57bl/6 bone marrow derived macrophages (bmdms) treated (10ug/ml) vs ko curdlan strain c57bl/6 bone marrow derived macrophages (bmdms) tagap treated (10ug/ml) |
| GSE146156_1_v_3_tagap_mouse | ko untreated strain c57bl/6 bone marrow derived macrophages (bmdms) tagap vs ko curdlan strain c57bl/6 bone marrow derived macrophages (bmdms) tagap treated (10ug/ml) |
| GSE118430_0_v_1_xbp1_mouse | cd4 xbp1 wild type replicate /variation wt cd45+cd3+cd4+ peritoneal wash samples xbp1f/f mice vs cd4 xbp1 knock replicate /variation ko cd45+cd3+cd4+ peritoneal wash samples xbp1f/f cd4cre mice |
| GSE190947_1_v_0_xbp1_mouse | hepatocytes flox chow isolated strain c57bl/6 group control vs hepatocytes ko isolated strain c57bl/6 group liver specific xbp1 deletion |
| GSE190947_2_v_0_xbp1_mouse | hepatocytes flox hfs isolated strain c57bl/6 group control high fat sugar (hfs) diet vs hepatocytes ko isolated strain c57bl/6 group liver specific xbp1 deletion |
| GSE73562,GSE73563_1_v_2_preb_mouse | rna seq analysis blnk / preb cells tomoxifen inducible /variation ko protocol (genetic modification) overexpression ert2 time control vs rna seq analysis blnk / preb cells tomoxifen inducible stimulated 0.5 hours /variation ko protocol (genetic modification) overexpression ert2 time |
| GSE73562,GSE73563_1_v_3_preb_mouse | rna seq analysis blnk / preb cells tomoxifen inducible /variation ko protocol (genetic modification) overexpression ert2 time control vs rna seq analysis blnk / preb cells tomoxifen inducible stimulated 1.5 hours /variation ko protocol (genetic modification) overexpression ert2 time |
| GSE180793_1_v_0_sorl1_human | wt ipsc derived neurons a6 wild type clone differentiation vs ko ipsc derived neurons e4 sorl1 clone differentiation |
| GSE212628_6_v_1_mier1_mouse | hfd control liver cas9 aav cre phx h diet vs hfd mier1 ko liver cas9 aav sgrna phx h diet |
| GSE212628_3_v_5_mier1_mouse | aging control liver cas9 aav cre phx h age aged vs lipe ako mier1 ko liver cas9 aav sgrna phx h |
| GSE212628_2_v_1_mier1_mouse | ncd/young control liver cas9 aav cre phx h diet ncd vs hfd mier1 ko liver cas9 aav sgrna phx h diet |
| GSE212628_2_v_5_mier1_mouse | ncd/young control liver cas9 aav cre phx h diet ncd vs lipe ako mier1 ko liver cas9 aav sgrna phx h |
| GSE229309,GSE229314_0_v_1_elavl1_human | thp1 scr az5576 1 acute myeloid leukemia cell line thp 100nm az 5576 6 hours cells expressing cas9 non targeting control sgrna (scr) vs thp1 elavl1 ko 1 az5576 acute myeloid leukemia cell line thp 100nm az 5576 6 hours cells expressing cas9 sgrna targeting |
| GSE229309,GSE229314_4_v_1_elavl1_human | thp1 elavl1 ko 1 dmso acute myeloid leukemia cell line thp 6 hours cells expressing cas9 sgrna targeting vs thp1 elavl1 ko 1 az5576 acute myeloid leukemia cell line thp 100nm az 5576 6 hours cells expressing cas9 sgrna targeting |
| GSE127916_1_v_0_nras_human | wt cells plko.1 vector replicate cell line m93 047 nras mutant melanoma /varaition hairpin vs shs6k1 cells sh5 trnc0000003162 replicate cell line m93 047 nras mutant melanoma /varaition s6k1 knockdown hairpin |
| GSE127916_1_v_4_nras_human | wt cells plko.1 vector replicate cell line m93 047 nras mutant melanoma /varaition hairpin vs shs6k1 cells sh1 trcn0000003158 + sh4 trnc0000003161 replicate cell line m93 047 nras mutant melanoma /varaition s6k1 knockdown hairpin |
| GSE127916_1_v_3_nras_human | wt cells plko.1 vector replicate cell line m93 047 nras mutant melanoma /varaition hairpin vs shs6k2 cells sh4 trnc0000010540 replicate cell line m93 047 nras mutant melanoma /varaition s6k2 knockdown hairpin |
| GSE118939_1_v_0_nras_human | nras tam /variation control 381 erms cell line vs nras tam /variation knockout 381t erms cell line |
| GSE127916_1_v_2_nras_human | wt cells plko.1 vector replicate cell line m93 047 nras mutant melanoma /varaition hairpin vs shs6k2 cells sh1 trnc0000000729 replicate cell line m93 047 nras mutant melanoma /varaition s6k2 knockdown hairpin |
| GSE196104,GSE196106_3_v_1_vsx2_mouse | vsx2 se wt e14.5 developmental stage retina model strain c57bl/6 mouse vs vsx2 en1 ko e14.5 developmental stage retina model strain c57bl/6 mouse |
| GSE196104,GSE196106_2_v_0_vsx2_mouse | vsx2 en1 wt e14.5 developmental stage retina model strain c57bl/6 mouse vs vsx2 se ko e14.5 developmental stage retina model strain c57bl/6 mouse |
| GSE196104,GSE196106_2_v_1_vsx2_mouse | vsx2 en1 wt e14.5 developmental stage retina model strain c57bl/6 mouse vs vsx2 en1 ko e14.5 developmental stage retina model strain c57bl/6 mouse |
| GSE123887,GSE123888_3_v_4_hpgd_mouse | treg wt strain c57bl/6jrcc line hpgd fl foxp3 yfp cre cell specific deletion vat age 12 weeks vs tconv ko strain c57bl/6jrcc line hpgd fl foxp3 yfp cre treg cell specific deletion vat age 12 weeks |
| GSE123887,GSE123888_2_v_1_hpgd_mouse | tconv wt strain c57bl/6jrcc line hpgd fl foxp3 yfp cre treg cell specific deletion vat age 12 weeks vs treg ko strain c57bl/6jrcc line hpgd fl foxp3 yfp cre cell specific deletion vat age 12 weeks |
| GSE123887,GSE123888_3_v_1_hpgd_mouse | treg wt strain c57bl/6jrcc line hpgd fl foxp3 yfp cre cell specific deletion vat age 12 weeks vs treg ko strain c57bl/6jrcc line hpgd fl foxp3 yfp cre cell specific deletion vat age 12 weeks |
| GSE126001_3_v_0_il13_mouse | wt strain c57bl6/j gender male age 20 weeks old wild type untrained gastrocnemius muscle mouse id vs il13 ko strain c57bl6/j gender male age 20 weeks old / untrained gastrocnemius muscle mouse id |
| GSE126001_3_v_2_il13_mouse | wt strain c57bl6/j gender male age 20 weeks old wild type untrained gastrocnemius muscle mouse id vs il13 ko strain c57bl6/j gender male age 20 weeks old / 5 endurance exercise gastrocnemius muscle mouse id |
| GSE201877_1_v_0_yap1_human | mda mb 231 cells shnc cell line epithelial triple negative breast cancer wt time day 3 vs mda mb 231 cells shyap1 cell line epithelial triple negative breast cancer yap1 knockdown time day 3 |
| GSE180631_1_v_0_yap1_mouse | ctrl aorta gender male thoracic modification cre negative tamoxifen treated age 5 7 weeks vs ko aorta gender male thoracic modification smc specific inducible yap1/wwtr1 age 5 7 weeks |
| GSE205163,GSE205164_9_v_4_znf808_human | wt h1 s0 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s3 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_3_v_0_znf808_human | wt h1 s1 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s0 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_2_v_7_znf808_human | wt h1 s2 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s2 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_1_v_0_znf808_human | wt h1 s4 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s0 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_3_v_4_znf808_human | wt h1 s1 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s3 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_9_v_0_znf808_human | wt h1 s0 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s0 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_5_v_6_znf808_human | wt h1 s3 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s4 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_2_v_6_znf808_human | wt h1 s2 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s4 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_3_v_7_znf808_human | wt h1 s1 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s2 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_1_v_7_znf808_human | wt h1 s4 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s2 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_5_v_8_znf808_human | wt h1 s3 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s1 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_1_v_8_znf808_human | wt h1 s4 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s1 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_5_v_4_znf808_human | wt h1 s3 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s3 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_3_v_6_znf808_human | wt h1 s1 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s4 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_1_v_6_znf808_human | wt h1 s4 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s4 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_2_v_4_znf808_human | wt h1 s2 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s3 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_9_v_6_znf808_human | wt h1 s0 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s4 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_9_v_7_znf808_human | wt h1 s0 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s2 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_1_v_4_znf808_human | wt h1 s4 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s3 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_2_v_0_znf808_human | wt h1 s2 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s0 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_3_v_8_znf808_human | wt h1 s1 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s1 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_2_v_8_znf808_human | wt h1 s2 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s1 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_5_v_7_znf808_human | wt h1 s3 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s2 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE205163,GSE205164_9_v_8_znf808_human | wt h1 s0 cell line human embryonic stem cells (hesc) stage replicate vs znf808 ko s1 cell line h1 human embryonic stem cells (hesc) stage replicate |
| GSE248883_0_v_1_shmt2_mouse | shmt2 liver wt amln diet vs shmt2 liver ko amln diet |
| GSE210718_1_v_0_shmt2_human | lx2 cells sinc liver cell line non parenchymal wt transfected vs lx2 cells sishmt2 liver cell line non parenchymal shmt2 knockdown transfected |
| GSE250230_1_v_3_gramd1c_mouse | wild type high cholesterol gonadal adipose liver (gramd1c +/+) vs knockout low cholesterol gonadal adipose liver (gramd1c / ) |
| GSE250230_4_v_0_gramd1c_mouse | wild type low cholesterol gonadal adipose liver (gramd1c +/+) vs knockout high cholesterol gonadal adipose liver (gramd1c / ) |
| GSE148269,GSE148273_0_v_1_arid4b_human | k562 wt cell line erythroleukemic /variation wildtype vs k562 4bko cell line erythroleukemic /variation arid4b knockout k565 |
| GSE232261,GSE232263_0_v_1_usf1_human | ctrl cell line huh7 cells hepatocellular carcinoma (hcc) control plasmid vs usf1 cell line huh7 cells hepatocellular carcinoma (hcc) overexpression |
| GSE152379_0_v_4_bach2_mouse | rna wt cl13 gp33tetramer d7 stemlike strain c57bl/6 spleen sorting marker b220 ly6g cd8+cd44+gp33+tim3 ly108+ culture condition ex vivo infection 7 days lcmv cd8 gp33 tetramer vs rna bach2ko gp33tetramer cl13 d7 stemlike strain bach2 ko spleen sorting marker b220 ly6g cd8+cd44+gp33+tim3 ly108+ culture condition ex vivo infection 7 days lcmv cd8 gp33 tetramer |
| GSE77857_1_v_2_bach2_mouse | rnaseq strain c57bl/6 spleen sample type /variation wild naive cd8+ cells vs rnaseq d5 invitro ko stim strain c57bl/6 spleen sample type stimulation /variation bach2 / pre activated cd8+ cells |
| GSE77857_3_v_2_bach2_mouse | rnaseq d5 invitro wt stim strain c57bl/6 spleen sample type stimulation /variation wild pre activated cd8+ cells vs rnaseq d5 invitro ko stim strain c57bl/6 spleen sample type stimulation /variation bach2 / pre activated cd8+ cells |
| GSE180277_0_v_1_bach2_mouse | wt strain c57bl/6 spleen active b cells b1 8hi bach2+/+ ert2cre np ova immunization cell vs ko strain c57bl/6 spleen active b cells b1 8hi bach2f/f ert2cre np ova immunization cell |
| GSE149426_1_v_0_cygb_human | hct116 mock cell line wild type human colorectal cancer cells passage 15 20 vs hct116 cygb cell line overexpression human colorectal cancer cells passage 15 20 |
| GSE128054_1_v_0_myt1_human | shnc neuroblastoma cell line control sk n (2) replicate vs shmyt1 neuroblastoma cell line myt1 knockout sk n (2) replicate |
| GSE153662,GSE153664_1_v_0_zeb1_mouse | r099 h strain c57bl/6 zeb1 wt bone marrow immunophenotype lin sca 1 low c kit cd127+ vs r099 h strain c57bl/6 zeb1 ko bone marrow immunophenotype lin sca 1 low c kit cd127+ |
| GSE153663,GSE153664_1_v_0_zeb1_mouse | r099 h strain c57bl/6 zeb1 wt bone marrow immunophenotype lsk cd48 cd150+ (hsc) vs r099 h strain c57bl/6 zeb1 ko bone marrow immunophenotype lsk cd48 cd150+ (hsc) |
| GSE178907_4_v_3_fkrp_human | ctr skeletal muscle stage myotubes disease applicable wild type differentiating hes cells vs fkrp ko skeletal muscle stage myotubes disease applicable / differentiating hes cells |
| GSE178907_5_v_3_fkrp_human | ctr wt3 skeletal muscle stage myotubes disease applicable wild type differentiating hips cells vs fkrp ko skeletal muscle stage myotubes disease applicable / differentiating hes cells |
| GSE178907_0_v_3_fkrp_human | fk hdr wws skeletal muscle stage myotubes disease applicable wild type differentiating hips cells vs fkrp ko skeletal muscle stage myotubes disease applicable / differentiating hes cells |
| GSE213992_1_v_0_nfic_human | mda mb 231 cells control cell line breast cancer transient transfection pcdna3.1 vs mda mb 231 cells nfic1 cell line breast cancer overexpression transient transfection pcdna3.1 |
| GSE236003_1_v_3_ubr5_human | shnc dmso cell line sw1116 wt vs shubr5 oxa cell line sw1116 ubr5 knockdown oxaliplatin |
| GSE236003_0_v_3_ubr5_human | shubr5 dmso cell line sw1116 ubr5 knockdown vs shubr5 oxa cell line sw1116 ubr5 knockdown oxaliplatin |
| GSE236003_2_v_3_ubr5_human | shnc oxa cell line sw1116 wt oxaliplatin vs shubr5 oxa cell line sw1116 ubr5 knockdown oxaliplatin |
| GSE214842_0_v_1_atf6_human | rheumatoid arthritis fibroblast like synoviocytes sinc day3 synovial cell line wt ra flss transfected control sirna(sinc) 72 h presence tnf î± (10 ng/ml) il 1î² vs rheumatoid arthritis fibroblast like synoviocytes siatf6î± day3 synovial cell line atf6{alpha} knockdown ra flss transfected atf6î± sirna (siatf6î±) 72 h presence tnf î± (10 ng/ml) il 1î² |
| GSE218098,GSE218099_1_v_0_tcf19_human | ishikawa sinc cell line endometrial cancer negative control vs ishikawa sitcf19 cell line endometrial cancer tcf19 knockdown |
| GSE153354_0_v_1_tcf19_human | oral squamous cell carcinoma line cal27 wt vs oral squamous cell carcinoma line cal27 tcf19 ko |
| GSE88819_0_v_4_tug1_mouse | wt spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_3_v_10_tug1_mouse | wt eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_11_v_4_tug1_mouse | wt heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_1_v_4_tug1_mouse | wt testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_3_v_8_tug1_mouse | wt eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_11_v_12_tug1_mouse | wt heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_12_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_7_v_9_tug1_mouse | wt mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_1_v_8_tug1_mouse | wt testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_3_v_4_tug1_mouse | wt eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_11_v_8_tug1_mouse | wt heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_4_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_7_v_8_tug1_mouse | wt mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_0_v_9_tug1_mouse | wt spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_0_v_10_tug1_mouse | wt spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_10_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_1_v_12_tug1_mouse | wt testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_7_v_12_tug1_mouse | wt mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_8_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_9_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_1_v_9_tug1_mouse | wt testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_6_v_12_tug1_mouse | wt liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_6_v_9_tug1_mouse | wt liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_3_v_12_tug1_mouse | wt eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_0_v_8_tug1_mouse | wt spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_7_v_10_tug1_mouse | wt mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_6_v_10_tug1_mouse | wt liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_1_v_2_tug1_mouse | wt testes lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_5_v_2_tug1_mouse | wt prostate lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_6_v_4_tug1_mouse | wt liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko mef embryonic fibroblasts lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_6_v_2_tug1_mouse | wt liver lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_11_v_9_tug1_mouse | wt heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko eye lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE88819_0_v_2_tug1_mouse | wt spleen lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex vs ko heart lncrna previous name tug1 background c57bl/6j (n3 neo) official strain tm1.1vlcg sex |
| GSE173810_0_v_3_igf2_mouse | wt eb day6 rna seq esc derived embryoid bodies time day 6 type cell line wild vs igf2 ko esc rna seq embryonic stem cells time na type cell line / |
| GSE255680_2_v_0_igf2_mouse | raw264.7 cells ctrl vsv cell line wildtype infection vs pm cells igf2bp3 ko vsv cell line knockout infection |
| GSE255680_1_v_3_igf2_mouse | pm cells wt vsv cell line wildtype infection vs raw264.7 cells igf2bp3 ko vsv cell line knockout infection |
| GSE173810_4_v_6_igf2_mouse | wt eb rna seq esc derived embryoid bodies time day 3 type cell line wild vs igf2 ko eb day6 rna seq esc derived embryoid bodies time day 6 type cell line / |
| GSE255680_2_v_3_igf2_mouse | raw264.7 cells ctrl vsv cell line wildtype infection vs raw264.7 cells igf2bp3 ko vsv cell line knockout infection |
| GSE173810_0_v_1_igf2_mouse | wt eb day6 rna seq esc derived embryoid bodies time day 6 type cell line wild vs igf2 ko eb rna seq esc derived embryoid bodies time day type cell line / |
| GSE235828_3_v_2_igf2_human | ko nc cell line u87mg glioma lines wt vs ko cell line u87mg glioma lines igf2bp3 knockout |
| GSE173810_4_v_3_igf2_mouse | wt eb rna seq esc derived embryoid bodies time day 3 type cell line wild vs igf2 ko esc rna seq embryonic stem cells time na type cell line / |
| GSE173810_4_v_1_igf2_mouse | wt eb rna seq esc derived embryoid bodies time day 3 type cell line wild vs igf2 ko eb rna seq esc derived embryoid bodies time day type cell line / |
| GSE156115_0_v_3_igf2_mouse | rnaseq wild type cd11b cd11b+ cells vs rnaseq igf2bp3 ko lin cells |
| GSE173810_0_v_6_igf2_mouse | wt eb day6 rna seq esc derived embryoid bodies time day 6 type cell line wild vs igf2 ko eb day6 rna seq esc derived embryoid bodies time day 6 type cell line / |
| GSE156115_2_v_1_igf2_mouse | rnaseq wild type lin cells vs rnaseq igf2bp3 ko cd11b cd11b+ cells |
| GSE235828_1_v_2_igf2_human | oe cell line u87mg glioma lines wt vs ko cell line u87mg glioma lines igf2bp3 knockout |
| GSE255680_1_v_0_igf2_mouse | pm cells wt vsv cell line wildtype infection vs pm cells igf2bp3 ko vsv cell line knockout infection |
| GSE186739_0_v_1_asic3_human | c1 skin fibroblast control primary culture fibroblasts vs g skin fibroblast gmq+asic3 overexpression primary culture fibroblasts |
| GSE245407,GSE245412_0_v_1_smurf1_human | sra01/04 cells shcontrol biol cell line lens epithelial wt tgf beta2 vs sra01/04 cells shsmurf1 bio cell line lens epithelial smurf1 knockdown tgf beta2 |
| GSE216238,GSE216241_0_v_1_tonsl_human | primary breast epithelial cells (rna seq) wt female vs tonsl overexpressing primary breast epithelial cells (rna seq) overexpression female |
| GSE229671,GSE229673_3_v_1_yrdc_human | tr brain cell line gsc456 glioblastoma stem wt threonine restriction (4 um thr) vs kdtr brain cell line gsc456 glioblastoma stem yrdc knockdown threonine restriction (4 um thr) |
| GSE229671,GSE229673_0_v_1_yrdc_human | nt brain cell line gsc456 glioblastoma stem wt control media (800 um thr) vs kdtr brain cell line gsc456 glioblastoma stem yrdc knockdown threonine restriction (4 um thr) |
| GSE229671,GSE229673_2_v_1_yrdc_human | kd brain cell line gsc456 glioblastoma stem yrdc knockdown control media (800 um thr) vs kdtr brain cell line gsc456 glioblastoma stem yrdc knockdown threonine restriction (4 um thr) |
| GSE231875_0_v_1_zbed3_human | hhl 5 cells control ffas750î¼m cell line human embryonic hepatocytes wt vs hhl 5 cells zbed3 oe ffas750î¼m cell line human embryonic hepatocytes overexpression |
| GSE134693_0_v_1_msr1_mouse | macrophages co culture system bmscs msr1 wt strain c57bl/6 bmm derived vs macrophages co culture system bmscs msr1 ko strain c57bl/6 bmm derived |
| GSE151782_2_v_5_aim2_mouse | wt 0h strain background c57bl6 /variation control spleen cd4+ cells vs aim2 / 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_3_v_7_aim2_mouse | wt 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_6_v_0_aim2_mouse | wt 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_2_v_0_aim2_mouse | wt 0h strain background c57bl6 /variation control spleen cd4+ cells vs aim2 / 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_4_v_0_aim2_mouse | aim2 / 0h strain background c57bl6 /variation control spleen cd4+ cells ko vs aim2 / 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE184479_3_v_2_aim2_mouse | na㯠cd4+ cells spleen wt mice cell (control) wild type (tn) vs aim2 ko cd4+ cells cultured treg conditions 2 days stimulated (2 days) / regulatory (treg) |
| GSE151782_4_v_5_aim2_mouse | aim2 / 0h strain background c57bl6 /variation control spleen cd4+ cells ko vs aim2 / 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_3_v_0_aim2_mouse | wt 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_6_v_5_aim2_mouse | wt 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_4_v_7_aim2_mouse | aim2 / 0h strain background c57bl6 /variation control spleen cd4+ cells ko vs aim2 / 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE184479_1_v_2_aim2_mouse | na㯠cd4+ cells spleen aim2 ko mice cell (control) / (tn) vs aim2 ko cd4+ cells cultured treg conditions 2 days stimulated (2 days) / regulatory (treg) |
| GSE151782_6_v_7_aim2_mouse | wt 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_1_v_0_aim2_mouse | wt 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 6h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE184479_0_v_2_aim2_mouse | wt cd4+ cells cultured treg conditions 2 days stimulated (2 days) wild type regulatory (treg) vs aim2 ko cd4+ cells cultured treg conditions 2 days stimulated (2 days) / regulatory (treg) |
| GSE151782_2_v_7_aim2_mouse | wt 0h strain background c57bl6 /variation control spleen cd4+ cells vs aim2 / 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE151782_1_v_5_aim2_mouse | wt 3h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells vs aim2 / 24h strain background c57bl6 /variation stimulation anti cd3/cd28 spleen cd4+ cells ko |
| GSE137653_4_v_0_siglecf_mouse | alveolar macrophages wtcs facs sorted (cd45+siglecf+cd11c+) protocol cigarette smoke wild type strain c57bl/6 vs alveolar macrophages koair facs sorted (cd45+siglecf+cd11c+) protocol air mir 155 ko strain b6.cg mir155tm1.1rsky/j |
| GSE137653_2_v_3_siglecf_mouse | alveolar macrophages wtair facs sorted (cd45+siglecf+cd11c+) protocol air wild type strain c57bl/6 vs alveolar macrophages kocs facs sorted (cd45+siglecf+cd11c+) protocol cigarette smoke mir 155 ko strain b6.cg mir155tm1.1rsky/j |
| GSE151364,GSE151366_1_v_2_taf4_mouse | rna seq wild type pancreas strain c57/bl6 isolated langerhans islets time n/ total nucleospin plus xs vs rna seq taf ko pancreas 1 week strain c57/bl6 isolated langerhans islets taf4 time total nucleospin plus xs |
| GSE151364,GSE151366_1_v_0_taf4_mouse | rna seq wild type pancreas strain c57/bl6 isolated langerhans islets time n/ total nucleospin plus xs vs rna seq taf ko pancreas week strain c57/bl6 isolated langerhans islets taf4 time weeks total nucleospin plus xs |
| GSE206870,GSE206872_1_v_5_ascl1_mouse | ngn2 ctrl mesc wt overexpression 1 day vs ascl1 tcf7l1 ko day0 mesc knockout induction |
| GSE206870,GSE206872_3_v_2_ascl1_mouse | ascl1 ctrl day1 mesc wt overexpression 1 day vs ascl1 tcf7l1 ko day1 mesc knockout overexpression 1 day |
| GSE87615_2_v_3_ascl1_human | wt gsi tumor glioblastoma derived cell line g523ns wildtype vs ascl1 ko gsi tumor glioblastoma derived cell line g523ns / |
| GSE206870,GSE206872_4_v_5_ascl1_mouse | ngn2 ctrl day0 mesc wt induction vs ascl1 tcf7l1 ko day0 mesc knockout induction |
| GSE87615_0_v_3_ascl1_human | ascl1 ko control tumor glioblastoma derived cell line g523ns / vs ascl1 ko gsi tumor glioblastoma derived cell line g523ns / |
| GSE214382,GSE214383_3_v_2_ascl1_human | hpsi0214i kucg 2 wt [day24 kucg2 cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE206870,GSE206872_0_v_5_ascl1_mouse | ascl1 ctrl day0 mesc wt induction vs ascl1 tcf7l1 ko day0 mesc knockout induction |
| GSE149096_2_v_0_ascl1_human | wt dorsal hesc derived npcs wild type cell line wa09 fate vs ko ventral hesc derived npcs ascl1 cell line wa09 fate |
| GSE206870,GSE206872_0_v_2_ascl1_mouse | ascl1 ctrl day0 mesc wt induction vs ascl1 tcf7l1 ko day1 mesc knockout overexpression 1 day |
| GSE87617_1_v_0_ascl1_human | ascl1 ko control #2 tumor glioblastoma derived cell line g523ns knockout vs ascl1 ko dox tumor glioblastoma derived cell line g523ns knockout |
| GSE87615_1_v_3_ascl1_human | wt control tumor glioblastoma derived cell line g523ns wildtype vs ascl1 ko gsi tumor glioblastoma derived cell line g523ns / |
| GSE214382,GSE214383_6_v_2_ascl1_human | hpsi0114ikolf2 clone1 wt [day24 kolf2c1 cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE214382,GSE214383_4_v_2_ascl1_human | hpsi0114ikolf2 clone1 wt dmso [48h cell line human induced pluripotent cells length 48h time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE149096_4_v_0_ascl1_human | wt ventral hesc derived npcs wild type cell line wa09 fate vs ko ventral hesc derived npcs ascl1 cell line wa09 fate |
| GSE214382,GSE214383_0_v_2_ascl1_human | hpsi0114ikolf2 clone1 wt cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE206870,GSE206872_1_v_2_ascl1_mouse | ngn2 ctrl mesc wt overexpression 1 day vs ascl1 tcf7l1 ko day1 mesc knockout overexpression 1 day |
| GSE214382,GSE214383_5_v_2_ascl1_human | hpsi0114ikolf2.1j wt [day24 kolf2.1j cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE149096_2_v_3_ascl1_human | wt dorsal hesc derived npcs wild type cell line wa09 fate vs ko dorsal hesc derived npcs ascl1 cell line wa09 fate |
| GSE206870,GSE206872_4_v_2_ascl1_mouse | ngn2 ctrl day0 mesc wt induction vs ascl1 tcf7l1 ko day1 mesc knockout overexpression 1 day |
| GSE206870,GSE206872_3_v_5_ascl1_mouse | ascl1 ctrl day1 mesc wt overexpression 1 day vs ascl1 tcf7l1 ko day0 mesc knockout induction |
| GSE214382,GSE214383_1_v_2_ascl1_human | hpsi0114ikolf2 clone1 wt brm014 [48h cell line human induced pluripotent cells length 48h time day 24 differentiation stage neuronal cultures vs hpsi0114ikolf2 clone1 ascl1 ko [nrs cell line human induced pluripotent cells time day 24 differentiation stage neuronal cultures |
| GSE149096_4_v_3_ascl1_human | wt ventral hesc derived npcs wild type cell line wa09 fate vs ko dorsal hesc derived npcs ascl1 cell line wa09 fate |
| GSE186620_0_v_1_ascl1_mouse | wt ascl1 strain ascl1f/f r26 eyfp/eyfp maternal liver gestation day 15 control vs ko ascl1 strain ascl1f/f r26 eyfp/eyfp maternal liver gestation day 15 hepatocyte specific |
| GSE168918_1_v_0_tmprss4_human | nc 1 cell line aspc human pancreatic cancer cells /variation tmprss4 control lentivirus vs sh 1 cell line aspc human pancreatic cancer cells /variation tmprss4 knockdown shtmprss4 lentivirus |
| GSE210885_2_v_1_klf4_mouse | ctec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs mtec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_0_v_1_klf4_mouse | ctec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs mtec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_3_v_6_klf4_mouse | mtec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs ctec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_2_v_6_klf4_mouse | ctec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs ctec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_3_v_7_klf4_mouse | mtec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs ctec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_2_v_7_klf4_mouse | ctec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs ctec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_5_v_1_klf4_mouse | mtec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs mtec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_5_v_7_klf4_mouse | mtec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs ctec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE107016_0_v_1_klf4_mouse | wt peritoneal macrophage strain background c57bl/6 /variation lysozyme cre (wt) vs k4ko peritoneal macrophage strain background c57bl/6 /variation myeloid specific klf4 knockout (k4ko) ko |
| GSE210885_3_v_1_klf4_mouse | mtec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs mtec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_2_v_4_klf4_mouse | ctec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs mtec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_3_v_4_klf4_mouse | mtec lox f klf4 wt b5t wt/wt lox/lox sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs mtec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_5_v_4_klf4_mouse | mtec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs mtec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE210885_5_v_6_klf4_mouse | mtec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell vs ctec ko e18 5 klf4 b5t icre/wt / sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_0_v_7_klf4_mouse | ctec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs ctec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell |
| GSE210885_0_v_4_klf4_mouse | ctec lox e18 5 klf4 wt b5t wt/wt lox/lox sex female condition pregnant age 12 weeks thymus (epcam+ cd45 uea1 ) cortical thymic epithelial cell vs mtec ko f klf4 b5t icre/wt / sex female condition non pregnant age 12 weeks thymus (epcam+ cd45 uea1+) medullary thymic epithelial cell |
| GSE225656_2_v_1_tsc2_mouse | tam 66 wt f replicate 39 lung cell line mvpc strain c57bl6/b129 mix vs tsc2 ko f replicate 39 âµl lung cell line mvpc female strain c57bl6/b129 mix / |
| GSE225656_0_v_1_tsc2_mouse | tam 65 wt replicate 39 lung cell line mvpc male strain c57bl6/b129 mix vs tsc2 ko f replicate 39 âµl lung cell line mvpc female strain c57bl6/b129 mix / |
| GSE225656_2_v_3_tsc2_mouse | tam 66 wt f replicate 39 lung cell line mvpc strain c57bl6/b129 mix vs tam63 tsc2 ko replicate 39 lung cell line mvpc male strain c57bl6/b129 mix / |
| GSE142232,GSE142234_0_v_2_gcgr_mouse | control homozygous knockout gcgr pancreatic none replicate non tumor vs alpha cell knockout sorted homozygous gcgr tamoxifen replicate pancreatic islet |
| GSE142232,GSE142234_0_v_3_gcgr_mouse | control homozygous knockout gcgr pancreatic none replicate non tumor vs alpha cell heterozygous sorted gcgr tamoxifen replicate pancreatic islet |
| GSE218814_1_v_0_suv39h1_mouse | renal fibroblasts ad gfp kidney primary wt tgf î² vs renal fibroblasts ad cre kidney primary suv39h1 knockdown tgf î² |
| GSE100886,GSE100893_1_v_3_parp14_mouse | rnaseq raw wt 264.7 macrophages wild type strain balb/c vs rnaseq raw ko 264.7 macrophages parp14 / strain balb/c |
| GSE110440_1_v_0_rad21_mouse | shluci vivo v2 strain c57bl/6 construct control shrna luciferase hematopoietic stem/progenitor cells bone marrow type total rna vs shrad21 vitro v2 strain c57bl/6 construct shrna rad21 knockdown hematopoietic stem/progenitor cells bone marrow type total rna |
| GSE110440_1_v_3_rad21_mouse | shluci vivo v2 strain c57bl/6 construct control shrna luciferase hematopoietic stem/progenitor cells bone marrow type total rna vs shrad21 vivo v2 strain c57bl/6 construct shrna rad21 knockdown hematopoietic stem/progenitor cells bone marrow type total rna |
| GSE110440_2_v_3_rad21_mouse | shluci vitro v2 strain c57bl/6 construct control shrna luciferase hematopoietic stem/progenitor cells bone marrow type total rna vs shrad21 vivo v2 strain c57bl/6 construct shrna rad21 knockdown hematopoietic stem/progenitor cells bone marrow type total rna |
| GSE110440_2_v_0_rad21_mouse | shluci vitro v2 strain c57bl/6 construct control shrna luciferase hematopoietic stem/progenitor cells bone marrow type total rna vs shrad21 vitro v2 strain c57bl/6 construct shrna rad21 knockdown hematopoietic stem/progenitor cells bone marrow type total rna |
| GSE149943_2_v_0_cd8a_mouse | cd8aa iel ctrl replicate strain c57bl/6 population cd45+tcrb+cd4 cd8a+cd8b cd4 cre lrffl/fl vs cd8aa splenocytes ko replicate strain c57bl/6 population cd45+tcrb+cd4 cd8a+cd8b cd4 cre+ lrffl/fl spleen |
| GSE149943_2_v_3_cd8a_mouse | cd8aa iel ctrl replicate strain c57bl/6 population cd45+tcrb+cd4 cd8a+cd8b cd4 cre lrffl/fl vs ielp lrf ko replicate strain c57bl/6 thymus thymic iel precursors (ielp) population tcrb+cd4 cd8a cd5hi cd122+h 2kb+ cd44 pd 1hi cd4 cre+ lrffl/fl |
| GSE149943_1_v_0_cd8a_mouse | ielp ctrl replicate strain c57bl/6 thymus thymic iel precursors (ielp) population tcrb+cd4 cd8a cd5hi cd122+h 2kb+ cd44 pd 1hi cd4 cre lrffl/fl vs cd8aa splenocytes ko replicate strain c57bl/6 population cd45+tcrb+cd4 cd8a+cd8b cd4 cre+ lrffl/fl spleen |
| GSE149943_1_v_3_cd8a_mouse | ielp ctrl replicate strain c57bl/6 thymus thymic iel precursors (ielp) population tcrb+cd4 cd8a cd5hi cd122+h 2kb+ cd44 pd 1hi cd4 cre lrffl/fl vs ielp lrf ko replicate strain c57bl/6 thymus thymic iel precursors (ielp) population tcrb+cd4 cd8a cd5hi cd122+h 2kb+ cd44 pd 1hi cd4 cre+ lrffl/fl |
| GSE140936,GSE140938_2_v_1_slfn11_human | parent chk1i6h [cem chk1i6 cell line ccrf cem lymphoblast /variation wild type prexasertib 100 nm 6h vs slfn11ko [cb45 cell line ccrf cem lymphoblast /variation slfn11 gene knockout |
| GSE140937,GSE140938_0_v_2_slfn11_human | parent [cem cell line ccrf cem lymphoblast /variation wild type vs slfn11ko cpt4h [cb45 cell line ccrf cem lymphoblast /variation slfn11 gene knockout camptothecin 100 nm 4h |
| GSE140937,GSE140938_1_v_2_slfn11_human | slfn11ko control [cb45 con cell line ccrf cem lymphoblast /variation slfn11 gene knockout dmso vs slfn11ko cpt4h [cb45 cell line ccrf cem lymphoblast /variation slfn11 gene knockout camptothecin 100 nm 4h |
| GSE140936,GSE140938_0_v_1_slfn11_human | parent control [cem con cell line ccrf cem lymphoblast /variation wild type dmso vs slfn11ko [cb45 cell line ccrf cem lymphoblast /variation slfn11 gene knockout |
| GSE245390_2_v_1_acss2_mouse | kidney wt shamoperated vs ko kidney acss2 knockout shamoperated |
| GSE76854,GSE90855_1_v_0_acss2_mouse | wt rep strain backgroud c57bl/6 /variation trained hippocampus vs acss2 rep strain backgroud c57bl/6 /variation knockdown trained hippocampus |
| GSE224969,GSE224971_0_v_1_chtop_mouse | nuc chtop ntc n2a flp rtta (chtop nt control frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition vs cyto chtop kd n2a flp rtta (chtop sichtop cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition sirna knockdown |
| GSE224969,GSE224971_0_v_7_chtop_mouse | nuc chtop ntc n2a flp rtta (chtop nt control frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition vs total chtop kd n2a flp rtta (chtop sichtop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction condition sirna knockdown |
| GSE224969,GSE224971_3_v_1_chtop_mouse | cyto chtop ntc n2a flp rtta (chtop nt control cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition vs cyto chtop kd n2a flp rtta (chtop sichtop cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition sirna knockdown |
| GSE224969,GSE224971_3_v_7_chtop_mouse | cyto chtop ntc n2a flp rtta (chtop nt control cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition vs total chtop kd n2a flp rtta (chtop sichtop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction condition sirna knockdown |
| GSE224969,GSE224971_0_v_4_chtop_mouse | nuc chtop ntc n2a flp rtta (chtop nt control frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition vs chtop mex5 resc n2a flp rtta (chtop w/oexon5) sichtop +dox isof resc) frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag withoutexon5 fraction condition sirna knockdown isoform rescue (+dox) |
| GSE224969,GSE224971_3_v_5_chtop_mouse | cyto chtop ntc n2a flp rtta (chtop nt control cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition vs nuc chtop kd n2a flp rtta (chtop sichtop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition sirna knockdown |
| GSE224969,GSE224971_0_v_5_chtop_mouse | nuc chtop ntc n2a flp rtta (chtop nt control frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition vs nuc chtop kd n2a flp rtta (chtop sichtop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction nuclear condition sirna knockdown |
| GSE224969,GSE224971_3_v_9_chtop_mouse | cyto chtop ntc n2a flp rtta (chtop nt control cytop frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag fraction cytoplasmic condition vs chtop pex5 resc n2a flp rtta (chtop w/exon5) sichtop +dox isof resc) frac bio rep cell line mouse neuroblastoma cdna expressed (n2a line) flag withexon5 fraction condition sirna knockdown isoform rescue (+dox) |
| GSE113952,GSE113953_1_v_0_chtop_human | hek293t control knockdown rnaseq replicate cell line sirna sicontrol (caccgugaagcugaaggug) vs hek293t chtopl knockdown rnaseq replicate cell line sirna sichtop (gacaaccaauuggaugcauau) |
| GSE228430_1_v_3_fabp5_human | huh7 cells dmso control 48 hrs replicate cell line hepatoma time vs huh7 cells sbfi103 48 hrs replicate cell line hepatoma fabp5 inhibition time |
| GSE228430_2_v_3_fabp5_human | huh7 cells shcontrol 48 hrs replicate cell line hepatoma control time vs huh7 cells sbfi103 48 hrs replicate cell line hepatoma fabp5 inhibition time |
| GSE155755,GSE155757_0_v_1_ncoa6_mouse | arr2pbi cre ptenf/+ ncoa6+/+ strain c57bl/6 prostate age 9 months pten heterozygous ko ncoa6 wild type pin vs arr2pbi cre ptenf/+ ncoa6f/f strain c57bl/6 prostate age 9 months pten heterozygous ko ncoa6 homozygous tumor |
| GSE222574_0_v_2_lmna_mouse | ndrg1 egfp lmna wt strain c57bl/6 myelinating oligodendrocytes age postnatal day 60 cnp+/+ lmnafl/fl sorted vs ndrg1 egfp lmna ko strain c57bl/6 myelinating oligodendrocytes age postnatal day 60 cnpcre/+ lmnafl/fl sorted |
| GSE199078_1_v_0_lmna_mouse | wt strain c57bl/6 (mixed) pdgfra+ cells vs pdgfra cre lmnaf/f lmna ko strain c57bl/6 (mixed) pdgfra+ cells |
| GSE110341_1_v_0_lmna_mouse | strain background c57bl/6 age post natal day 14 /variation wt heart vs strain background c57bl/6 age post natal day 14 /variation lmna knockout heart |
| GSE150548_1_v_0_rbmx_human | control sample bladder transfection t24 cells vs rbmx overexpression bladder transfection exprssing t24 cells |
| GSE156923_2_v_3_rbmx_human | ctrl npc ips derived neural progenitor cells mutation wide type vs drgg ips mutation rbmx rgg motif deletion induced pluripotent stem cells |
| GSE156923_2_v_1_rbmx_human | ctrl npc ips derived neural progenitor cells mutation wide type vs drgg npc ips derived neural progenitor cells mutation rbmx rgg motif deletion |
| GSE156923_0_v_3_rbmx_human | ctrl ips mutation wide type induced pluripotent stem cells vs drgg ips mutation rbmx rgg motif deletion induced pluripotent stem cells |
| GSE145628,GSE145629_1_v_0_myrf_human | cfpac1.hnf1b wt cfpac1 clonal cell line pancreatic ductal adenocarcinoma (pdac) vs cfpac1.myrf ko cfpac1 genome edited clonal cell line pancreatic ductal adenocarcinoma (pdac) |
| GSE240896,GSE240899_2_v_0_ccnt1_human | jlat106 wildtype cell line jurkat (j lat 10.6) vs ccnt1 lymphocyte cyclin t1 ko + cd3/cd28 antibody co stimulation |
| GSE240896,GSE240899_3_v_0_ccnt1_human | aavs1 lymphocyte control ko vs ccnt1 lymphocyte cyclin t1 ko + cd3/cd28 antibody co stimulation |
| GSE240896,GSE240899_2_v_4_ccnt1_human | jlat106 wildtype cell line jurkat (j lat 10.6) vs ccnt1 lymphocyte cyclin t1 ko |
| GSE240896,GSE240899_5_v_4_ccnt1_human | aavs1 lymphocyte control ko + cd3/cd28 antibody co stimulation vs ccnt1 lymphocyte cyclin t1 ko |
| GSE240896,GSE240899_10_v_4_ccnt1_human | jlat106 tnfa agent wildtype cell line jurkat (j lat 10.6) vs ccnt1 lymphocyte cyclin t1 ko |
| GSE240896,GSE240899_10_v_0_ccnt1_human | jlat106 tnfa agent wildtype cell line jurkat (j lat 10.6) vs ccnt1 lymphocyte cyclin t1 ko + cd3/cd28 antibody co stimulation |
| GSE167004_0_v_3_thpo_mouse | strain c57bl/6 primary hematopoietic stem cells /variation ko thpo / untreated vs ko strain c57bl/6 primary hematopoietic stem cells /variation thpo / 10 days receptor agonist (romiplostim) romiplostim |
| GSE130475_1_v_2_thpo_mouse | cd4 wt empty rv replicate spleen infection lcmv arm d7 pi population smarta ox40 cre vs cd4 zbtb7b ko thpok rv replicate spleen infection lcmv arm d7 pi population smarta ox40 cre+ zbtb7bfl/fl |
| GSE167004_2_v_3_thpo_mouse | strain c57bl/6 primary hematopoietic stem cells /variation wt thpo+/+ untreated vs ko strain c57bl/6 primary hematopoietic stem cells /variation thpo / 10 days receptor agonist (romiplostim) romiplostim |
| GSE211177,GSE211178_9_v_11_ets1_mouse | rna seq th1 wt rep1b spleen strain c57bl/6j cells vs rna seq th1 ets1 se ko ev rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_4_v_3_ets1_mouse | rna seq th1 wt ev rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th2 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_8_v_10_ets1_mouse | rna seq th1 wt ets1 rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_4_v_1_ets1_mouse | rna seq th1 wt ev rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_9_v_3_ets1_mouse | rna seq th1 wt rep1b spleen strain c57bl/6j cells vs rna seq th2 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_0_v_3_ets1_mouse | rna seq th2 wt rep1b spleen strain c57bl/6j cells vs rna seq th2 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_8_v_3_ets1_mouse | rna seq th1 wt ets1 rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th2 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_8_v_1_ets1_mouse | rna seq th1 wt ets1 rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_0_v_1_ets1_mouse | rna seq th2 wt rep1b spleen strain c57bl/6j cells vs rna seq th1 ets1 se ko rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_0_v_11_ets1_mouse | rna seq th2 wt rep1b spleen strain c57bl/6j cells vs rna seq th1 ets1 se ko ev rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_9_v_1_ets1_mouse | rna seq th1 wt rep1b spleen strain c57bl/6j cells vs rna seq th1 ets1 se ko rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_0_v_10_ets1_mouse | rna seq th2 wt rep1b spleen strain c57bl/6j cells vs rna seq th1 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE211177,GSE211178_4_v_11_ets1_mouse | rna seq th1 wt ev rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko ev rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_8_v_11_ets1_mouse | rna seq th1 wt ets1 rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko ev rv spleen strain c57bl/6j transduction retrovirus transduced cells |
| GSE211177,GSE211178_4_v_10_ets1_mouse | rna seq th1 wt ev rv spleen strain c57bl/6j transduction empty vector retrovirus transduced cells vs rna seq th1 ets1 se ko rep1b spleen strain c57bl/6j cells |
| GSE184399_0_v_2_cnot1_human | sictrl cervical cancer cell line hela knockdown cells vs sicnot1+sictrl cervical cancer cell line hela knockdown cells |
| GSE184399_0_v_3_cnot1_human | sictrl cervical cancer cell line hela knockdown cells vs sitasor+sicnot1 cervical cancer cell line hela knockdown cells |
| GSE167886_3_v_1_chd7_mouse | adipo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction wt vs adipo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction chd7 ko |
| GSE167886_2_v_0_chd7_mouse | osteo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction wt vs osteo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction chd7 ko |
| GSE167886_2_v_1_chd7_mouse | osteo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction wt vs adipo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction chd7 ko |
| GSE167886_3_v_0_chd7_mouse | adipo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction wt vs osteo strain c57bl/6 bone marrow mesenchymal stem cells age 4 weeks old induction chd7 ko |
| GSE239747_2_v_3_lrp6_mouse | liver nd nlrp6 ko knockout normal diet vs liver hfd nlrp6 ko knockout high fat diet |
| GSE239747_1_v_3_lrp6_mouse | liver nd wt normal diet vs liver hfd nlrp6 ko knockout high fat diet |
| GSE239747_0_v_3_lrp6_mouse | liver hfd wt high fat diet vs liver hfd nlrp6 ko knockout high fat diet |
| GSE164463_3_v_1_pax6_mouse | wildtype clone mouse lacrimal gland organoids vs pax6 ko clone mouse lacrimal gland organoids |
| GSE164463_2_v_1_pax6_mouse | wildtype bulk n/ mouse lacrimal gland vs pax6 ko clone mouse lacrimal gland organoids |
| GSE164463_0_v_1_pax6_mouse | differentiation wildtype bulk (dm) mouse lacrimal gland organoids vs pax6 ko clone mouse lacrimal gland organoids |
| GSE164463_4_v_1_pax6_mouse | expansion wildtype bulk (em) mouse lacrimal gland organoids vs pax6 ko clone mouse lacrimal gland organoids |
| GSE218781_3_v_1_abl2_mouse | abl2ko ctrl bio rep liver abl2 ko control vs abl2ko etoh bio rep liver abl2 ko |
| GSE224479_0_v_1_ino80_human | sirna control cell line human kidney 2 renal proximal tubular wt knockdown vs sirna ino80 cell line human kidney 2 renal proximal tubular knockdown |
| GSE98082_1_v_0_ino80_mouse | wt strain c57bl/6 whole heart age embryonic day 13.5 wild type vs ko strain c57bl/6 whole heart age embryonic day 13.5 tie2cre ino80 flox/flox |
| GSE261177_0_v_1_tnfrsf12a_human | dld 1 cells oecontrol large intestine colon cell line epithelial wt untreated vs dld 1 cells oetnfrsf12a large intestine colon cell line epithelial tnfrsf12a overexpression doxycycline treating 48 h |
| GSE154767_1_v_5_adam10_mouse | wt cd4+ dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4 dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_2_v_0_adam10_mouse | wt cd8+ dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4+ dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_4_v_0_adam10_mouse | wt cd4 dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4+ dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_4_v_3_adam10_mouse | wt cd4 dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd8+ dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_2_v_5_adam10_mouse | wt cd8+ dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4 dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_4_v_5_adam10_mouse | wt cd4 dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4 dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_1_v_0_adam10_mouse | wt cd4+ dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd4+ dc sample strain c57bl/6 spleen dendritic cell |
| GSE154767_2_v_3_adam10_mouse | wt cd8+ dc sample strain c57bl/6 spleen dendritic cell vs adam10 ko cd8+ dc sample strain c57bl/6 spleen dendritic cell |
| GSE92614_1_v_0_pten_mouse | control sample num condition region epididymis vs pten ko sample num condition knockout region epididymis |
| GSE221020,GSE221023_2_v_1_pten_mouse | sko rfp prostate basal derived organoid wildtype strain background mixed c57bl/6 129/sv fvb none vs sko cre rfp prostate basal derived organoid pten single knockout (sko) strain background mixed c57bl/6 129/sv fvb none |
| GSE156907,GSE160237_1_v_0_pten_mouse | wt cardiomyocyte rna seq es derived cardiomyocytes strain cell line wild type vs pten ko cardiomyocyte rna seq es derived cardiomyocytes strain cell line / |
| GSE221020,GSE221023_2_v_0_pten_mouse | sko rfp prostate basal derived organoid wildtype strain background mixed c57bl/6 129/sv fvb none vs dko cre rfp prostate basal derived organoid pten rb1 double knockout (dko) strain background mixed c57bl/6 129/sv fvb none |
| GSE252864_0_v_3_smad4_mouse | colonic epithelium wildtype untreated replicate epithelial cells vs colonic epithelium smad4 knockout dss treated replicate epithelial cells |
| GSE252864_1_v_3_smad4_mouse | colonic epithelium smad4 knockout untreated replicate epithelial cells vs colonic epithelium smad4 knockout dss treated replicate epithelial cells |
| GSE101527_3_v_2_smad4_mouse | wt 12hr il6sb background c57bl/6 gender female spleen+lymph nodes cd4+ cell timepoint 12 hour post il6+tgfbr inhibitor peripheral lymph spleens vs ko 3hr il6sb background c57bl/6 gender female spleen+lymph nodes cd4+ cell timepoint 3 hour post il6+tgfbr inhibitor cd4cre smad4fl/fl peripheral lymph spleens |
| GSE101527_0_v_1_smad4_mouse | wt 3hr il6sb background c57bl/6 gender female spleen+lymph nodes cd4+ cell timepoint 3 hour post il6+tgfbr inhibitor peripheral lymph spleens vs ko 12hr il6sb background c57bl/6 gender female spleen+lymph nodes cd4+ cell timepoint 12 hour post il6+tgfbr inhibitor cd4cre smad4fl/fl peripheral lymph spleens |
| GSE252864_2_v_3_smad4_mouse | colonic epithelium wildtype dss treated replicate epithelial cells vs colonic epithelium smad4 knockout dss treated replicate epithelial cells |
| GSE188933,GSE188934_1_v_2_smad4_mouse | wt strain/cell background f5 transgenic cd8 cells rag2ko lymph nodes spleen wild type replicate vs sko [cd8 strain/cell background f5 transgenic cd8 cells rag2ko lymph nodes spleen smad4 ko 1 replicate |
| GSE97275,GSE97280_0_v_1_zmynd11_mouse | wt rep /variation agent strain swiss albino nih3t3 vs zmynd11 ko rep /variation agent strain swiss albino nih3t3 |
| GSE143512,GSE143513_0_v_1_nr4a3_mouse | j3 activating condition day3 vivo activated ot cd44hi activation details adoptively transferred b6.sjl lm ova infection nr4a3 wt cd8+ cells (ot ) vs j3 activating condition day3 vivo activated ot cd44hi activation details adoptively transferred b6.sjl lm ova infection nr4a3 ko cd8+ cells (ot ) |
| GSE203429_0_v_1_angptl8_human | caki 1 cells control cell line clear renal carcinoma vs caki 1 cells angptl8 knockout cell line clear renal carcinoma |
| GSE211963_0_v_3_cd200_mouse | wt sorted v1g neuroblastoma cell line nb9464d wild type process cd45+ cells vs ko sorted v1g neuroblastoma cell line nb9464d cd200r / process cd45+ cells |
| GSE129287_0_v_1_cd200_mouse | sample wildtype strain background c57bl6 /variation wild type bone marrow neutrophils vs sample cd200r / strain background c57bl6 /variation ko bone marrow neutrophils |
| GSE176114_1_v_2_dusp1_mouse | dusp1 wt strain 129s2/svpas c57bl/6 cochlea age 5 months old wild type vs dusp1 ko strain 129s2/svpas c57bl/6 cochlea age months old / |
| GSE171401_1_v_0_adnp_human | npc wt rna seq wildtype differentiated protocol es e14 vs e14 adnp dhd ha rna seq knockout protocol es |
| GSE171401_1_v_2_adnp_mouse | npc wt rna seq wildtype differentiated protocol es e14 vs e14 adnpko rna seq adnp knockout protocol es |
| GSE171401_1_v_0_adnp_mouse | npc wt rna seq wildtype differentiated protocol es e14 vs e14 adnp dhd ha rna seq knockout protocol es |
| GSE162892_3_v_0_sox9_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs commercially available psc derived astrocytes replicate induced pluripotent stem cell overexpressed transcription factor tf overexpression differentiation day known |
| GSE162892_4_v_0_sox9_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs commercially available psc derived astrocytes replicate induced pluripotent stem cell overexpressed transcription factor tf overexpression differentiation day known |
| GSE185744,GSE185747_0_v_1_sox9_human | rnaseq ht115 cells gfp dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression control vs rnaseq ht115 cells m379 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE162892_4_v_2_sox9_human | healthy isox9 astrocytes 30 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 48 vs commercially available primary human fetal astrocytes replicate overexpressed transcription factor tf overexpression differentiation day |
| GSE198036,GSE198041_0_v_2_sox9_mouse | 01heart ec wt chow strain mixed background heart age 2 3 ctrl isolated cardiac endothelial cells vs 01heart ec sox9 ko strain mixed background heart age 2 3 knock isolated cardiac endothelial cells |
| GSE185744,GSE185747_2_v_4_sox9_human | rnaseq ht115 cells csox9 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged wildtype sox9 vs rnaseq ht115 cells m303 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE185744,GSE185747_2_v_1_sox9_human | rnaseq ht115 cells csox9 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged wildtype sox9 vs rnaseq ht115 cells m379 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE198036,GSE198041_4_v_3_sox9_mouse | 01heart ec wt hfpef strain mixed background heart age 2 3 ctrl isolated cardiac endothelial cells vs 02lung ec sox9 ko blm strain mixed background lung age 2 3 knock isolated pulmonal endothelial cells |
| GSE198036,GSE198041_0_v_3_sox9_mouse | 01heart ec wt chow strain mixed background heart age 2 3 ctrl isolated cardiac endothelial cells vs 02lung ec sox9 ko blm strain mixed background lung age 2 3 knock isolated pulmonal endothelial cells |
| GSE245405,GSE245406_0_v_1_sox9_mouse | wt mouse pancreatic islets strain mixed age 13 16 months old mice islet cells vs ko mouse pancreatic islets strain mixed age 13 16 months old mice islet cells ins cre sox9fl/fl |
| GSE162892_3_v_2_sox9_human | healthy isox9 astrocytes 5 days doxy removal replicate induced pluripotent stem cell derived overexpressed transcription factor sox9 differentiation day 23 vs commercially available primary human fetal astrocytes replicate overexpressed transcription factor tf overexpression differentiation day |
| GSE185744,GSE185747_0_v_4_sox9_human | rnaseq ht115 cells gfp dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression control vs rnaseq ht115 cells m303 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE214335_1_v_0_sox9_human | huh 7 cells cell line hapatocarcinoma wt vs sox9ko huh 7 cells cell line hapatocarcinoma sox9 knockout |
| GSE185744,GSE185747_0_v_3_sox9_human | rnaseq ht115 cells gfp dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression control vs rnaseq ht115 cells m228 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE185744,GSE185747_2_v_3_sox9_human | rnaseq ht115 cells csox9 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged wildtype sox9 vs rnaseq ht115 cells m228 dox pos colorectal cancer cell line doxycycline induction + expression induced overexpression v5 tagged mutant sox9 |
| GSE110268_0_v_3_foxd1_human | hmsc wt msc /variation human mscs vs foxd1 msc /variation knockdown human mscs |
| GSE110268_1_v_3_foxd1_human | hesc wt esc /variation human escs vs foxd1 msc /variation knockdown human mscs |
| GSE110268_2_v_3_foxd1_human | ntc msc /variation non targeting control human mscs vs foxd1 msc /variation knockdown human mscs |
| GSE110268_2_v_3_foxd1_mouse | ntc msc /variation non targeting control human mscs vs foxd1 msc /variation knockdown human mscs |
| GSE110268_1_v_3_foxd1_mouse | hesc wt esc /variation human escs vs foxd1 msc /variation knockdown human mscs |
| GSE110268_0_v_3_foxd1_mouse | hmsc wt msc /variation human mscs vs foxd1 msc /variation knockdown human mscs |
| GSE208226,GSE208227_2_v_1_ell3_mouse | rna seq wt rep cell line v6.5 mouse embryonic stem cells non vs rna seq ell3 ko cell line v6.5 mouse embryonic stem cells sgrna |
| GSE145639_7_v_2_adar_human | rnaseq adar1wt mock treated derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd mock treated derived colorectal cancer#92 adar1 knockdown time |
| GSE227592_6_v_3_adar_human | wt a549 rsev 2dpi cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE56152_3_v_5_adar_human | srna wt day strain h9 differential stage knockdown wild type embryonic stem cells vs adar1 kd day strain h9 differential stage knockdown shrna embryonic stem cells |
| GSE227592_5_v_3_adar_human | wt a549 amplicon seq rsev n5t cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE145639_7_v_6_adar_human | rnaseq adar1wt mock treated derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd pic derived colorectal cancer#92 adar1 knockdown time poly( c) |
| GSE227592_8_v_1_adar_human | wt a549 rsev p5t 2dpi cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE227592_6_v_1_adar_human | wt a549 rsev 2dpi cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE145639_1_v_2_adar_human | rnaseq adar1wt 5 aza cdr derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd mock treated derived colorectal cancer#92 adar1 knockdown time |
| GSE227592_2_v_1_adar_human | wt a549 mock 1dpi 1 cell line lung carcinoma epithelial cells dpi vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE227592_0_v_1_adar_human | wt a549 rsev n5t cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE110708_2_v_3_adar_mouse | ctrl 36h ns control sgrna non targeting 5 vehicle b16 melanoma vs adarsg1 36h ifnb 1 adar ko sgrna b16 melanoma |
| GSE110708_0_v_3_adar_mouse | ctrl 36h ifnb control sgrna non targeting 5 b16 melanoma vs adarsg1 36h ifnb 1 adar ko sgrna b16 melanoma |
| GSE227592_13_v_3_adar_human | wt a549 rsev n5r cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE227592_9_v_3_adar_human | wt a549 mock 2dpi cell line lung carcinoma epithelial cells 2 dpi vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE145639_1_v_4_adar_human | rnaseq adar1wt 5 aza cdr derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd 5 aza cdr derived colorectal cancer#92 adar1 knockdown time |
| GSE227592_4_v_3_adar_human | wt a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE145639_7_v_4_adar_human | rnaseq adar1wt mock treated derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd 5 aza cdr derived colorectal cancer#92 adar1 knockdown time |
| GSE145639_1_v_6_adar_human | rnaseq adar1wt 5 aza cdr derived colorectal cancer#92 wild type (lacz) time vs rnaseq adar1kd pic derived colorectal cancer#92 adar1 knockdown time poly( c) |
| GSE227592_13_v_1_adar_human | wt a549 rsev n5r cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE227592_10_v_1_adar_human | wt a549 rsev p5t cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE110708_1_v_3_adar_mouse | adarsg1 36h ns 1 adar ko sgrna vehicle control b16 melanoma vs adarsg1 36h ifnb 1 adar ko sgrna b16 melanoma |
| GSE227592_8_v_3_adar_human | wt a549 rsev p5t 2dpi cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE227592_0_v_3_adar_human | wt a549 rsev n5t cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE227592_10_v_3_adar_human | wt a549 rsev p5t cell line lung carcinoma epithelial cells (moi=5) vs stat1 adar1 double ko a549 adv mcherry hadar1 cell line lung carcinoma epithelial cells (moi=100) 4dpi |
| GSE227592_4_v_1_adar_human | wt a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE227592_9_v_1_adar_human | wt a549 mock 2dpi cell line lung carcinoma epithelial cells 2 dpi vs stat1 adar1 double ko a549 mock adv transduction cell line lung carcinoma epithelial cells 4dpi |
| GSE85302_0_v_1_kat6a_mouse | wild type klrg1 high background strain c57bl/6 infection infected cd8+ cells vs kat6a ko klrg1 background strain c57bl/6 knock infection infected cd8+ cells |
| GSE85302_4_v_1_kat6a_mouse | wild type klrg1 low background strain c57bl/6 infection infected cd8+ cells vs kat6a ko klrg1 background strain c57bl/6 knock infection infected cd8+ cells |
| GSE157592_1_v_0_tet2_mouse | wt lsk smart rnaseq /variation wild type recipient mouse 01142020bmt mice 10 weeks cd45.2 lin ckit+sca1+ vs t2ko lsk smart rnaseq /variation tet2 knockout recipient mouse 01142020bmt mice 10 weeks cd45.2 lin ckit+sca1+ |
| GSE183316,GSE183317_1_v_2_tet2_mouse | wt th1 genetics background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen vs ko tfh genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen |
| GSE98964_1_v_4_tet2_mouse | wt (tam) strain c57bl/6 /variation wildtype tumor associated macrophages (tams) tams vs ko (bmdm) strain c57bl/6 /variation tet2 knockout bone marrow derived macrophages (bmdms) 20 ng/ml il4 hrs bmdms |
| GSE100863,GSE100864_2_v_1_tet2_mouse | tet2rescue wt 2i cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells vs tet2rescue mut serum cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells |
| GSE183316,GSE183317_4_v_0_tet2_mouse | wt tfh genetics background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen vs ko na㯠genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset naive infection infected sex spleen |
| GSE100863,GSE100864_3_v_1_tet2_mouse | tet2rescue wt serum cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells vs tet2rescue mut serum cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells |
| GSE183316,GSE183317_1_v_0_tet2_mouse | wt th1 genetics background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen vs ko na㯠genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset naive infection infected sex spleen |
| GSE183316,GSE183317_3_v_2_tet2_mouse | wt na㯠genetics background c57bl/6 mouse smarta cd4 cells cell subset naive infection infected sex spleen vs ko tfh genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen |
| GSE120756_2_v_9_tet2_human | tet2 wt cell line mcf7 breast cancer /variation wild type passages low (6 10) cells vs tet2 ko cell line mcf7 breast cancer /variation knockout passages low (6 10) cells |
| GSE132408_1_v_3_tet2_human | tet2 ko cell line thp1 leukemic monocyte control monocyteâx80x8e vs tet2 ko+ ifnî³ cell line thp1 leukemic monocyte ko monocyteâx80x8e |
| GSE98964_0_v_2_tet2_mouse | wt (bmdm) strain c57bl/6 /variation wildtype bone marrow derived macrophages (bmdms) 20 ng/ml il4 hrs bmdms vs ko (tam) strain c57bl/6 /variation tet2 knockout tumor associated macrophages (tams) tams |
| GSE135334,GSE136010_1_v_0_tet2_mouse | tet2 wt sal lps rna seq sttrain background c57bl/6j wild type sex saline midbrain replicate biological sample vs tet2 ko lps rna seq sttrain background c57bl/6j knock sex midbrain replicate biological sample |
| GSE132408_0_v_3_tet2_human | wt+ ifnî³ cell line thp1 leukemic monocyte wt monocyteâx80x8e vs tet2 ko+ ifnî³ cell line thp1 leukemic monocyte ko monocyteâx80x8e |
| GSE98964_0_v_4_tet2_mouse | wt (bmdm) strain c57bl/6 /variation wildtype bone marrow derived macrophages (bmdms) 20 ng/ml il4 hrs bmdms vs ko (bmdm) strain c57bl/6 /variation tet2 knockout bone marrow derived macrophages (bmdms) 20 ng/ml il4 hrs bmdms |
| GSE100863,GSE100864_3_v_0_tet2_mouse | tet2rescue wt serum cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells vs tet2rescue mut 2i cell line tet2 ko medium shrna shsetdb1 rescue embryonic stem cells |
| GSE135334,GSE136010_2_v_3_tet2_mouse | tet2 wt lps rna seq sttrain background c57bl/6j wild type sex midbrain replicate biological sample vs tet2 ko sal lps rna seq sttrain background c57bl/6j knock sex saline midbrain replicate biological sample |
| GSE231327,GSE231330_1_v_0_tet2_mouse | wt actd cell line nras/ae9a leukemic cells aml 5 âµg/ml actinomycin vs ko actd cell line nras/ae9a leukemic cells aml tet2 5 âµg/ml actinomycin |
| GSE222829,GSE223009_0_v_1_tet2_human | hcc827 cells lung cell line non small cancer (nsclc) wt vs hcc827 cells tet2 ko lung cell line non small cancer (nsclc) |
| GSE148010,GSE148120_0_v_1_tet2_human | dmso batch1 (rna seq) cell line tf1 erythroleukemia clone id tet2 vehicle (dmso) treated daily x 3 days time first sequencing qc pass/fail experimental vs ko aza batch1 (rna seq) cell line tf1 erythroleukemia clone id tet2 / 200 nm 5 daily x 3 days time first sequencing qc pass/fail pass experimental |
| GSE183316,GSE183317_3_v_5_tet2_mouse | wt na㯠genetics background c57bl/6 mouse smarta cd4 cells cell subset naive infection infected sex spleen vs ko th1 genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen |
| GSE148010,GSE148120_3_v_2_tet2_human | a12 ko dmso (rna seq) cell line tf1 erythroleukemia clone id tet2 / vehicle (dmso) treated daily x 3 days time first sequencing qc pass/fail pass experimental vs t0 pre batch1 (rna seq) cell line tf1 erythroleukemia clone id tet2 time first sequencing qc pass/fail pass experimental |
| GSE205963_0_v_1_tet2_mouse | macrophages wild type msu treated vs macrophages tet2 knockout msu treated |
| GSE98964_1_v_2_tet2_mouse | wt (tam) strain c57bl/6 /variation wildtype tumor associated macrophages (tams) tams vs ko (tam) strain c57bl/6 /variation tet2 knockout tumor associated macrophages (tams) tams |
| GSE183316,GSE183317_4_v_5_tet2_mouse | wt tfh genetics background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen vs ko th1 genetics tet2 background c57bl/6 mouse smarta cd4 cells cell subset infection lcmv armstrong 7 days post sex female spleen |
| GSE68147_0_v_1_mef2c_mouse | wild type 2 strain background cd 1 /variation heart outflow tracts barcode lane replicate number wt tract vs mutant 1 strain background cd /variation anterior heart field (ahf) conditional mef2c knockout outflow tracts barcode lane replicate number tract |
| GSE73561,GSE73563_0_v_1_mef2c_mouse | rna seq analysis prob cell mb1cre mice /variation control cells vs rna seq analysis prob cell mef2c/ mb1cre mice /variation knockout cells mef2cd |
| GSE113375_0_v_1_dicer1_human | dicer1* +dox cell line hues8 embryonic stem cells wild type human (hescs) vs dicer1* dox cell line hues8 embryonic stem cells dicer1 knockout human (hescs) |
| GSE139348,GSE139349_1_v_0_dicer1_mouse | rna seq wild type ago2halo/+ mescs biological rep strain background c57bl/6 x 129/sv /variation dicer1 mouse embryonic stem cells (mescs) vs rna seq dicer1 knockout ago2halo/+ mescs biological rep strain background c57bl/6 x 129/sv /variation mouse embryonic stem cells (mescs) |
| GSE218727_0_v_1_zkscan3_human | hela wt cell line vs hk 2 ko zkscan3 cell line |
| GSE218727_2_v_1_zkscan3_human | hk 2 wt cell line vs hk 2 ko zkscan3 cell line |
| GSE218727_0_v_3_zkscan3_human | hela wt cell line vs hela ko zkscan3 cell line |
| GSE172201_1_v_0_zkscan3_human | wild type hct116 cell line zkscan3 colorectal carcinoma vs zkscan3 ko hct116 cell line knockout colorectal carcinoma |
| GSE218727_2_v_3_zkscan3_human | hk 2 wt cell line vs hela ko zkscan3 cell line |
| GSE157557,GSE157559_1_v_0_parp1_human | shctrl cell line hk 2 control vs shparp1 cell line hk 2 parp1 knockdown |
| GSE264010_0_v_1_parp1_human | wt cell line hepg2 human hepatocellular carcinomas vs sgparp1 cell line hepg2 human hepatocellular carcinomas parp1 ko |
| GSE113817_0_v_1_bach1_human | wtd0 1 embryonic stem cell /variation wild type passages 30 60 status hesc wt d0 vs 1 embryonic stem cell /variation bach1 knockout passages 30 60 status hesc |
| GSE113817_2_v_1_bach1_human | wtd3 1 embryonic stem cell /variation wild type passages 30 60 status spontaneously differentiation day3 wt hesc d3 vs 1 embryonic stem cell /variation bach1 knockout passages 30 60 status hesc |
| GSE218960_0_v_1_nrf1_mouse | wild type 8h mouse peritoneal macrophages strain background c57bl6j wt vsv infection vs nrf1 ko 8h mouse peritoneal macrophages strain background c57bl6j vsv infection |
| GSE253579_1_v_0_sectm1a_mouse | wt cell line primary cells macropahges wild type age 10 12 weeks strain c57bl/6 vs sectm1a ko cell line primary cells macropahges knockout age 10 12 weeks strain c57bl/6 |
| GSE174701_5_v_3_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs qgp 1 full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid |
| GSE174701_4_v_8_maml3_human | bon 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs qgp 1 delta exon maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid |
| GSE174701_1_v_2_maml3_human | qgp 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs bon 1 full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_1_v_0_maml3_human | qgp 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh delta exon 1 maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_1_v_7_maml3_human | qgp 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_5_v_6_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs bon 1 delta exon maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_5_v_8_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs qgp 1 delta exon maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid |
| GSE174701_4_v_3_maml3_human | bon 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs qgp 1 full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid |
| GSE174701_4_v_0_maml3_human | bon 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh delta exon 1 maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_5_v_2_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs bon 1 full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_1_v_6_maml3_human | qgp 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs bon 1 delta exon maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_5_v_0_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh delta exon 1 maml3 overexpression rep cell line/type cells /variation deletion cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_4_v_7_maml3_human | bon 1 vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE174701_5_v_7_maml3_human | sk n sh vector control rep v cell line/type cells /variation pcmv6 ac plasmid origene (ps100020) vs sk n sh full length maml3 overexpression rep f cell line/type cells /variation cdna c terminal v5 tag pcmv6 ac plasmid origene (ps100020) |
| GSE172295_1_v_2_sh3gl1_mouse | trans wt strain c57bl/6 wildtype untreated transitional b cells vs cd40l ko strain c57bl/6 sh3gl1 / 14hours treated follicular b cells |
| GSE172295_4_v_2_sh3gl1_mouse | fo ko strain c57bl/6 sh3gl1 / untreated follicular b cells vs cd40l ko strain c57bl/6 sh3gl1 / 14hours treated follicular b cells |
| GSE172295_3_v_2_sh3gl1_mouse | trans ko strain c57bl/6 sh3gl1 / untreated transitional b cells vs cd40l ko strain c57bl/6 sh3gl1 / 14hours treated follicular b cells |
| GSE172295_0_v_2_sh3gl1_mouse | fo wt strain c57bl/6 wildtype untreated follicular b cells vs cd40l ko strain c57bl/6 sh3gl1 / 14hours treated follicular b cells |
| GSE220287_2_v_1_mef2d_mouse | control tfh bio rep stimulation np ova immunization cell subset pd1+cxcr5+ empty rv otii tcrtg cd4 cells vs mef2d rv non tfh bio rep overexpression stimulation np ova immunization cell subset pd1 cxcr5 otii tcrtg cd4 cells |
| GSE220287_0_v_1_mef2d_mouse | control non tfh bio rep stimulation np ova immunization cell subset pd1 cxcr5 empty rv otii tcrtg cd4 cells vs mef2d rv non tfh bio rep overexpression stimulation np ova immunization cell subset pd1 cxcr5 otii tcrtg cd4 cells |
| GSE220287_0_v_3_mef2d_mouse | control non tfh bio rep stimulation np ova immunization cell subset pd1 cxcr5 empty rv otii tcrtg cd4 cells vs mef2d rv tfh bio rep overexpression stimulation np ova immunization cell subset pd1+cxcr5+ otii tcrtg cd4 cells |
| GSE156978_1_v_0_dnmt1_mouse | control strain background c57bl/6 /variation age 7 weeks old gender male skeletal muscle satellite cells vs cko strain background c57bl/6 /variation dnmt1 ko age 7 weeks old gender male skeletal muscle satellite cells |
| GSE150557_1_v_0_dnmt1_human | wm266.4 sictrl cell types cells stably expressing egfp firefly luciferase treated control sirna 7 days (transfected day 0 3) culture media demd supplemented 10% fbs 1% penstrep (gibco) braf.v600e pten hemizugous deletion human melanoma vs wm266.4 sidnmt1 cell types cells stably expressing egfp firefly luciferase treated sirna human dnmt1 7 days (transfected day 0 3) culture media demd supplemented 10% fbs 1% penstrep (gibco) braf.v600e pten hemizugous deletion melanoma |
| GSE109111_2_v_0_stim1_human | h9 hesc derived npcs human embryonic stem cell (h9 hesc) neural progenitor cells passage 19 20 wild type wt vs h9 hesc derived npcs kd human embryonic stem cell (h9 hesc) neural progenitor cells passage 19 20 stim1 knockdown |
| GSE138024_2_v_0_rgs4_mouse | wt brain naive sex female region ventral posterolateral thalamic nuclei vs rgs4ko brain naive rgs4 ko sex female region ventral posterolateral thalamic nuclei |
| GSE138024_2_v_3_rgs4_mouse | wt brain naive sex female region ventral posterolateral thalamic nuclei vs rgs4ko brain cfa rgs4 ko sex female region ventral posterolateral thalamic nuclei |
| GSE241622_1_v_0_ythdc2_human | group2 cell line h1975 wt vs group1 cell line h1975 ythdc2 knockout |
| GSE92562_2_v_0_cpeb1_mouse | neurite rnaseq wtax background strain c57bl/6 neurites cultured neurons age 8 days vitro /variation wild type na㯠vs neurite rnaseq background strain c57bl/6 neurites cultured neurons age 8 days vitro /variation cpeb1 flox/flox knockout |
| GSE195513_2_v_1_cpeb1_mouse | microglia wt strain c57bl6/j / age 3 4 months vs microglia cpeb1 ko lps strain c57bl6/j / age 3 4 months |
| GSE92562_1_v_0_cpeb1_mouse | neurite rnaseq wtax24 background strain c57bl/6 neurites cultured neurons age 8 days vitro /variation wild type injured vs neurite rnaseq background strain c57bl/6 neurites cultured neurons age 8 days vitro /variation cpeb1 flox/flox knockout |
| GSE195513_0_v_3_cpeb1_mouse | microglia wt lps strain c57bl6/j / age 3 4 months vs microglia cpeb1 ko strain c57bl6/j / age 3 4 months |
| GSE65617_2_v_3_aire_mouse | wt mtec hi wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko ctec aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE151829,GSE151831_1_v_8_aire_mouse | strain background c57bl/6 aire+/+ isotype control tumor b16.f10 vs ko spleen strain background c57bl/6 aire / apd1 |
| GSE203158_1_v_14_aire_mouse | otii cells proliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs rorc gfp+ otii cells ko stimulated biol lymph nodes strain c57bl/6 cre+ aire flox candida albicans |
| GSE91015_0_v_1_aire_mouse | strain c57bl/6 cell line mtec 3.10 medullary thymic epithelial (mtec) passages 2 wildtype cells co culture vs strain c57bl/6 cell line mtec 3.10 medullary thymic epithelial (mtec) passages 2 aire +/ ko cells co culture |
| GSE203158_1_v_8_aire_mouse | otii cells proliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs otii cells proliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE203158_12_v_8_aire_mouse | otii cells nonproliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs otii cells proliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE151829,GSE151831_3_v_0_aire_mouse | wt spleen strain background c57bl/6 aire+/+ apd1 vs ko ln strain background c57bl/6 aire / apd1 lymph node |
| GSE203158_1_v_15_aire_mouse | otii cells proliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs aire gfp+ilc3 stimulated ko biol lymph nodes strain c57bl/6 candida albicans |
| GSE203158_0_v_15_aire_mouse | aire gfp+ilc3 stimulated wt biol lymph nodes strain c57bl/6 candida albicans vs aire gfp+ilc3 stimulated ko biol lymph nodes strain c57bl/6 candida albicans |
| GSE65617_2_v_1_aire_mouse | wt mtec hi wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko mtec lo aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE203158_0_v_14_aire_mouse | aire gfp+ilc3 stimulated wt biol lymph nodes strain c57bl/6 candida albicans vs rorc gfp+ otii cells ko stimulated biol lymph nodes strain c57bl/6 cre+ aire flox candida albicans |
| GSE65617_0_v_4_aire_mouse | wt ctec wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko mtec hi aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE203158_12_v_14_aire_mouse | otii cells nonproliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs rorc gfp+ otii cells ko stimulated biol lymph nodes strain c57bl/6 cre+ aire flox candida albicans |
| GSE203158_5_v_15_aire_mouse | rorc gfp+ otii cells wt stimulated biol lymph nodes strain c57bl/6 cre aire flox candida albicans vs aire gfp+ilc3 stimulated ko biol lymph nodes strain c57bl/6 candida albicans |
| GSE203158_5_v_13_aire_mouse | rorc gfp+ otii cells wt stimulated biol lymph nodes strain c57bl/6 cre aire flox candida albicans vs otii cells nonproliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE65617_5_v_3_aire_mouse | wt mtec lo wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko ctec aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE65617_0_v_1_aire_mouse | wt ctec wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko mtec lo aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE65617_5_v_1_aire_mouse | wt mtec lo wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko mtec lo aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE151829,GSE151831_5_v_8_aire_mouse | wt ln strain background c57bl/6 aire+/+ apd1 lymph node vs ko spleen strain background c57bl/6 aire / apd1 |
| GSE65617_2_v_4_aire_mouse | wt mtec hi wild type strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells vs ko mtec hi aire strain b6.129s2 airetm1.1doi/j thymus age 6 8 week old thymic epithelial cells |
| GSE203158_1_v_13_aire_mouse | otii cells proliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs otii cells nonproliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE203158_12_v_13_aire_mouse | otii cells nonproliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs otii cells nonproliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE203158_5_v_14_aire_mouse | rorc gfp+ otii cells wt stimulated biol lymph nodes strain c57bl/6 cre aire flox candida albicans vs rorc gfp+ otii cells ko stimulated biol lymph nodes strain c57bl/6 cre+ aire flox candida albicans |
| GSE203158_12_v_15_aire_mouse | otii cells nonproliferating wt stimulated biol lymph nodes strain c57bl/6 rorc cre aire flox candida albicans vs aire gfp+ilc3 stimulated ko biol lymph nodes strain c57bl/6 candida albicans |
| GSE224556,GSE224557_6_v_1_aire_mouse | nod wt mtec gfp rna thymus aire gfp+ mtecs age 4 6 weeks old sex female strain nod/shiltj na vs nod aire ko mtec gfp rna thymus gfp+ mtecs age 4 6 weeks old sex female strain nod/shiltj na |
| GSE151829,GSE151831_7_v_0_aire_mouse | strain background c57bl/6 aire / isotype control tumor b16.f10 vs ko ln strain background c57bl/6 aire / apd1 lymph node |
| GSE203158_5_v_8_aire_mouse | rorc gfp+ otii cells wt stimulated biol lymph nodes strain c57bl/6 cre aire flox candida albicans vs otii cells proliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE151829,GSE151831_7_v_8_aire_mouse | strain background c57bl/6 aire / isotype control tumor b16.f10 vs ko spleen strain background c57bl/6 aire / apd1 |
| GSE203158_0_v_13_aire_mouse | aire gfp+ilc3 stimulated wt biol lymph nodes strain c57bl/6 candida albicans vs otii cells nonproliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE151829,GSE151831_1_v_0_aire_mouse | strain background c57bl/6 aire+/+ isotype control tumor b16.f10 vs ko ln strain background c57bl/6 aire / apd1 lymph node |
| GSE203158_0_v_8_aire_mouse | aire gfp+ilc3 stimulated wt biol lymph nodes strain c57bl/6 candida albicans vs otii cells proliferating ko stimulated biol lymph nodes strain c57bl/6 rorc cre+ aire flox candida albicans |
| GSE224556,GSE224557_8_v_1_aire_mouse | b6 nod f1 wt mtec gfp rna thymus aire gfp+ mtecs age 4 6 weeks old sex female strain c57bl/6j nod/shiltj na vs nod aire ko mtec gfp rna thymus gfp+ mtecs age 4 6 weeks old sex female strain nod/shiltj na |
| GSE133661_0_v_1_c19orf12_human | lung cell line a549 adenocarcinoma sh scramble (serves wild type control) human vs shc19orf12 1 lung cell line a549 adenocarcinoma c19orf12 knockdown human |
| GSE232714_0_v_1_raver1_human | sic control knockdown cell line 549 lung cancer derived vs siraver1 cell line 549 lung cancer derived raver1 knockdown |
| GSE169713,GSE169715_1_v_2_tert_mouse | wt control strain c57bl/6/129/svj liver saline (control) vs ko enu strain c57bl/6/129/svj liver g1 tert / |
| GSE184087_0_v_3_tert_human | hmsc htert20 control day7 marrow stromal cell differentiation day 7 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day0 marrow stromal cell differentiation day 0 undifferentiated dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_2_v_1_tert_human | hmsc htert20 control day0 marrow stromal cell differentiation day 0 undifferentiated mesenchymal vs hmsc htert20 mir181a1hgkd day7 marrow stromal cell differentiation day 7 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_0_v_5_tert_human | hmsc htert20 control day7 marrow stromal cell differentiation day 7 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day14 marrow stromal cell differentiation day 14 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_2_v_3_tert_human | hmsc htert20 control day0 marrow stromal cell differentiation day 0 undifferentiated mesenchymal vs hmsc htert20 mir181a1hgkd day0 marrow stromal cell differentiation day 0 undifferentiated dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_4_v_1_tert_human | hmsc htert20 control day14 marrow stromal cell differentiation day 14 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day7 marrow stromal cell differentiation day 7 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE169713,GSE169715_3_v_2_tert_mouse | ko control strain c57bl/6/129/svj liver g1 tert / saline (control) vs ko enu strain c57bl/6/129/svj liver g1 tert / |
| GSE184087_4_v_3_tert_human | hmsc htert20 control day14 marrow stromal cell differentiation day 14 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day0 marrow stromal cell differentiation day 0 undifferentiated dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_0_v_1_tert_human | hmsc htert20 control day7 marrow stromal cell differentiation day 7 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day7 marrow stromal cell differentiation day 7 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_2_v_5_tert_human | hmsc htert20 control day0 marrow stromal cell differentiation day 0 undifferentiated mesenchymal vs hmsc htert20 mir181a1hgkd day14 marrow stromal cell differentiation day 14 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE184087_4_v_5_tert_human | hmsc htert20 control day14 marrow stromal cell differentiation day 14 osteogenic mesenchymal vs hmsc htert20 mir181a1hgkd day14 marrow stromal cell differentiation day 14 osteogenic dcas9 krab knockdown mir181a1hg mesenchymal |
| GSE240396_1_v_4_rab30_mouse | liver rab30 cpt2 floxed control (littermates dko) 24hr fast vs liver rab30 whole body ko 24hr fast |
| GSE240396_1_v_0_rab30_mouse | liver rab30 cpt2 floxed control (littermates dko) 24hr fast vs liver rab30 specific ko 24hr fast |
| GSE43041,GSE43044_0_v_1_ldb1_mouse | wt ldb1+/+ flk1+ cells hemangioblast equivalent vs ko ldb1 / flk1+ cells hemangioblast equivalent |
| GSE211989_0_v_1_nlrc3_mouse | bmdms wt rpmi 1640 mice femurs tibias bmdm vs bmdms nlrc3 ko rpmi 1640 mice femurs tibias bmdm |
| GSE211989_3_v_2_nlrc3_mouse | bmdms wt lps mice femurs tibias bmdm vs bmdms nlrc3 ko lps mice femurs tibias bmdm |
| GSE145682_1_v_0_nbdy_human | js1902 /variation wild type s4u feed immortalized 293ts vs js1902 /variation nbdy ko s4u feed immortalized 293ts |
| GSE154940_1_v_0_nbdy_mouse | lv wt rnaseq strain c57bl/6 cardiac (left ventricle) age 20 weeks sex male vs lv morf4 nbdy ko rnaseq strain c57bl/6 cardiac (left ventricle) age 20 weeks sex male |
| GSE232223_1_v_0_letmd1_mouse | bat wt wild type strain c57bl/6n brown adipose sex male age 5 week old vs bat letmd1 ko knockout strain c57bl/6n brown adipose sex male age 5 week old |
| GSE200388_0_v_1_gemin5_human | input rna âx80x93 control cell line hek 293 untreated fraction total culture vs input rna âx80x93 sirnag5 cell line hek 293 gemin5 knockdown (sirna) fraction total culture |
| GSE180377_2_v_1_lipa_mouse | gfp mouse purified diet overexpression control liver vs lipa mouse fpc diet overexpression liver |
| GSE195514_0_v_1_stk25_human | wt cardiomyocyte rep cell line wtc11 wildtype culture vs stk25ko cardiomyocyte rep cell line (wtc11 background) stk25 homozygous knockout culture |
| GSE123943_1_v_0_sox1_human | reh ctrl repl. sirna replicate cell line b cells vs reh sox11 ko repl. sirna replicate cell line b cells |
| GSE123943_2_v_0_sox1_human | 697 ctrl repl. sirna replicate cell line b cells vs reh sox11 ko repl. sirna replicate cell line b cells |
| GSE123943_4_v_0_sox1_human | rch acv ctrl repl. sirna replicate cell line b cells vs reh sox11 ko repl. sirna replicate cell line b cells |
| GSE123943_4_v_5_sox1_human | rch acv ctrl repl. sirna replicate cell line b cells vs rch acv sox11 ko repl. sirna replicate cell line b cells |
| GSE210505_0_v_1_sox1_mouse | endothelial cells control normoxia lung strain c57bl/6j cdh5 creert2 rpl22tm1.1psam (room air) vs endothelial cells induced sox17 deletion adult hypoxia lung strain c57bl/6j cdh5 creert2 sox17fl/fl rpl22tm1.1psam |
| GSE123943_1_v_3_sox1_human | reh ctrl repl. sirna replicate cell line b cells vs 697 sox11 ko repl. sirna replicate cell line b cells |
| GSE123943_4_v_3_sox1_human | rch acv ctrl repl. sirna replicate cell line b cells vs 697 sox11 ko repl. sirna replicate cell line b cells |
| GSE123943_2_v_3_sox1_human | 697 ctrl repl. sirna replicate cell line b cells vs 697 sox11 ko repl. sirna replicate cell line b cells |
| GSE174383_4_v_0_ly6d_mouse | k8y hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p3 yfp+ luminal prostate yfp+ly6d+ population vs k8py cr ly6d cells age 4 months post tamoxifen condition castrated pten ko subpopulation p6 yfp+ luminal prostate yfp+ly6d population |
| GSE174383_1_v_5_ly6d_mouse | k8y hs ly6d cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p4 yfp+ luminal prostate yfp+ly6d population vs k8py cr ly6d+ cells age 4 months post tamoxifen condition castrated pten ko subpopulation p5 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_1_v_7_ly6d_mouse | k8y hs ly6d cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p4 yfp+ luminal prostate yfp+ly6d population vs k8py hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten ko subpopulation p1 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_2_v_5_ly6d_mouse | k8y cr ly6d+ cells age 4 months post tamoxifen condition castrated pten wt subpopulation p7 yfp+ luminal prostate yfp+ly6d+ population vs k8py cr ly6d+ cells age 4 months post tamoxifen condition castrated pten ko subpopulation p5 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_6_v_5_ly6d_mouse | k8y cr ly6d cells age 4 months post tamoxifen condition castrated pten wt subpopulation p8 yfp+ luminal prostate yfp+ly6d population vs k8py cr ly6d+ cells age 4 months post tamoxifen condition castrated pten ko subpopulation p5 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_1_v_0_ly6d_mouse | k8y hs ly6d cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p4 yfp+ luminal prostate yfp+ly6d population vs k8py cr ly6d cells age 4 months post tamoxifen condition castrated pten ko subpopulation p6 yfp+ luminal prostate yfp+ly6d population |
| GSE174383_4_v_5_ly6d_mouse | k8y hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p3 yfp+ luminal prostate yfp+ly6d+ population vs k8py cr ly6d+ cells age 4 months post tamoxifen condition castrated pten ko subpopulation p5 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_2_v_0_ly6d_mouse | k8y cr ly6d+ cells age 4 months post tamoxifen condition castrated pten wt subpopulation p7 yfp+ luminal prostate yfp+ly6d+ population vs k8py cr ly6d cells age 4 months post tamoxifen condition castrated pten ko subpopulation p6 yfp+ luminal prostate yfp+ly6d population |
| GSE174383_6_v_7_ly6d_mouse | k8y cr ly6d cells age 4 months post tamoxifen condition castrated pten wt subpopulation p8 yfp+ luminal prostate yfp+ly6d population vs k8py hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten ko subpopulation p1 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_4_v_7_ly6d_mouse | k8y hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten wt subpopulation p3 yfp+ luminal prostate yfp+ly6d+ population vs k8py hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten ko subpopulation p1 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_2_v_7_ly6d_mouse | k8y cr ly6d+ cells age 4 months post tamoxifen condition castrated pten wt subpopulation p7 yfp+ luminal prostate yfp+ly6d+ population vs k8py hs ly6d+ cells age 4 months post tamoxifen condition hormone sensitive pten ko subpopulation p1 yfp+ luminal prostate yfp+ly6d+ population |
| GSE174383_6_v_0_ly6d_mouse | k8y cr ly6d cells age 4 months post tamoxifen condition castrated pten wt subpopulation p8 yfp+ luminal prostate yfp+ly6d population vs k8py cr ly6d cells age 4 months post tamoxifen condition castrated pten ko subpopulation p6 yfp+ luminal prostate yfp+ly6d population |
| GSE121043_0_v_1_aldh1a1_human | vkvc320sc colon neoplasm wild type colo320 cells vs vkvc320ko colon neoplasm aldh1a1 knockdown colo320 cells |
| GSE202933_1_v_0_ugt2b28_human | lncap nt cell line prostate epithelial cancer control time 24h vs lncap kd4 cell line prostate epithelial cancer ugt2b28 knockdown time 24h |
| GSE243683_0_v_1_s100a16_mouse | primary hepatocytes cell line wt alcohol feeding vs primary hepatocytes s100a16 cell line knockdown alcohol feeding |
| GSE149264,GSE149267_9_v_3_trp53_mouse | wt early 2 cell rep embryo tag mouse vs trp53 ko egg ii mouse |
| GSE149264,GSE149267_2_v_5_trp53_mouse | wt egg rep ii mouse vs trp53 mz ko early 2 cell rep embryo tag mouse |
| GSE149264,GSE149267_2_v_1_trp53_mouse | wt egg rep ii mouse vs trp53 mz ko late 2 cell rep embryo tag mouse |
| GSE149264,GSE149267_4_v_3_trp53_mouse | wt late 2 cell rep embryo tag mouse vs trp53 ko egg ii mouse |
| GSE149264,GSE149267_4_v_5_trp53_mouse | wt late 2 cell rep embryo tag mouse vs trp53 mz ko early 2 cell rep embryo tag mouse |
| GSE149264,GSE149267_9_v_5_trp53_mouse | wt early 2 cell rep embryo tag mouse vs trp53 mz ko early 2 cell rep embryo tag mouse |
| GSE149264,GSE149267_9_v_1_trp53_mouse | wt early 2 cell rep embryo tag mouse vs trp53 mz ko late 2 cell rep embryo tag mouse |
| GSE149264,GSE149267_4_v_1_trp53_mouse | wt late 2 cell rep embryo tag mouse vs trp53 mz ko late 2 cell rep embryo tag mouse |
| GSE183327,GSE183328_1_v_0_ddit3_human | cd34+ cells healthy donor transduced ddit3 overexpression plasmid differentiated days bone marrow condition initial facs gating prior cell culture used trasduction pcdh mcs t2a copgfp mscv time ex vivo expansion 2 erythroid differentiation rna seq gfp+ vs cd34+ cells mds transduced ddit3 differentiated 7 days bone marrow condition knockdown initial facs gating prior cell culture plasmid used trasduction psih1 h1 copgfp time ex vivo expansion 2 erythroid differentiation rna seq gfp+ |
| GSE183327,GSE183328_3_v_0_ddit3_human | cd34+ cells healthy donor transduced control plasmid differentiated days bone marrow condition initial facs gating prior cell culture used trasduction pcdh mcs t2a copgfp mscv time ex vivo expansion 2 erythroid differentiation rna seq gfp+ vs cd34+ cells mds transduced ddit3 differentiated 7 days bone marrow condition knockdown initial facs gating prior cell culture plasmid used trasduction psih1 h1 copgfp time ex vivo expansion 2 erythroid differentiation rna seq gfp+ |
| GSE234514,GSE234516_2_v_0_mitf_human | mcf 7 wt cells breast cell line cancer vs mcf 7 pr shmitf cells breast cell line cancer mitf knockdown |
| GSE246053_4_v_2_hnf4a_mouse | liver wt il6 vs liver ko il6 hnf4a |
| GSE246053_1_v_2_hnf4a_mouse | liver wt pbs vs liver ko il6 hnf4a |
| GSE210842_3_v_1_hnf4a_mouse | liver cell line cells hepatocytes wt vs hnf4a rna cell line liver cells hepatocytes ko |
| GSE157911_1_v_0_hnf4a_mouse | ctrl kidney hnf4af/f (control) tamoxifen 100mg/kg/day control vs ko kidney ubc creert2 hnf4af/f (hnf4ako) tamoxifen 100mg/kg/day hnf4ako |
| GSE246053_4_v_3_hnf4a_mouse | liver wt il6 vs liver ko pbs hnf4a |
| GSE246053_1_v_3_hnf4a_mouse | liver wt pbs vs liver ko pbs hnf4a |
| GSE212760_0_v_1_fxr1_human | umscc74b cells control cell line mesenchymal shrna time 72 hrs vs umscc74b cells fxr1 knockdown cell line mesenchymal shrna time 72 hrs |
| GSE243552_1_v_0_gpr107_human | hpc cells hg day 5 kidney cell line podocytes wt gene expression vs hpc gpr107 ko cells hg day 5 kidney cell line podocytes knock gene expression |
| GSE123372,GSE123373_10_v_2_mecp2_mouse | kowt nuclear wild type sex male strain c57bl/6j age 7 8 weeks cortex nucleus vs tgwt cell mecp2 overexpression sex male strain fvb age 7 10 weeks cortex whole |
| GSE125155_3_v_1_mecp2_mouse | ko strain background c57bl/6 /variation mecp2 untreated cerebral cortex vs ko gt strain background c57bl/6 /variation mecp2 gene therapy treated cerebral cortex |
| GSE66870,GSE66871_1_v_0_mecp2_mouse | wild type mecp2 transgenic age 7 weeks hypothalamus vs mecp2 knockout age 7 weeks type hypothalamus |
| GSE246461,GSE246463_5_v_0_mecp2_mouse | culture rna wt primary neuron cultures age embryonic day (e) 14.5 none vs culture rna mecp2 oe primary neuron cultures age embryonic day (e) 14.5 overexpression |
| GSE123372,GSE123373_1_v_2_mecp2_mouse | kowt cell wild type sex male strain c57bl/6j age 7 8 weeks cortex whole vs tgwt cell mecp2 overexpression sex male strain fvb age 7 10 weeks cortex whole |
| GSE246461,GSE246463_5_v_2_mecp2_mouse | culture rna wt primary neuron cultures age embryonic day (e) 14.5 none vs culture rna mecp2 kd primary neuron cultures age embryonic day (e) 14.5 knockdown |
| GSE156967_1_v_0_cish_mouse | wt rep. strain c57bl/6 age 4 months alveolar macrophages vs ko rep. strain cish c57bl/6 age 4 months alveolar macrophages |
| GSE164306_5_v_0_tsc1_mouse | cre strain tsc1f/f tg(camk2a creert2 ) tamoxifen drug none control time sacrificed day 8 injection start gene deletion hippocampus murine adult vs cre+ rapa strain tsc1f/f tg (camk2a creert2+) tamoxifen drug 10 mg/kg rapamycin tsc1 gene deletion time sacrificed day 13 injection start / daily 4 hippocampus murine adult |
| GSE241848_1_v_0_tsc1_mouse | liver ecs wt primary endothelial cells age p14 vs liver ecs li tsc1 ko raga gtp primary endothelial cells age p14 |
| GSE196505,GSE196507_3_v_2_kdm2b_human | mock vegf human umblical vein endothelial cells (huvecs) treatment1 control ( kdm2b overexpression) treatment2 vs sikdm2b vegf human umblical vein endothelial cells (huvecs) treatment1 kdm2b knockdown treatment2 |
| GSE196505,GSE196507_1_v_2_kdm2b_human | sicontrol vegf human umblical vein endothelial cells (huvecs) treatment1 control ( kdm2b knockdown) treatment2 vs sikdm2b vegf human umblical vein endothelial cells (huvecs) treatment1 kdm2b knockdown treatment2 |
| GSE89767_2_v_5_cebpa_mouse | expr granulocytes cebpa wt bone marrow cell markers mac1+gr 1+ vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE89767_4_v_5_cebpa_mouse | expr lsk cebpa wt bone marrow cell markers lin sca 1+ ckit vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE89767_0_v_5_cebpa_mouse | expr pregm cebpa wt bone marrow cell markers lin sca 1 ckit+ cd150 cd105 vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE89767_1_v_5_cebpa_mouse | expr monocytes cebpa wt bone marrow cell markers ter119 b220 cd3 nk1.1 cd115+ ckit cd34 fcgrii/iii+ ly6g cd11b+ vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE89767_6_v_5_cebpa_mouse | expr gmp cebpa wt bone marrow cell markers lin sca 1 ckit+ cd150 fcgrii/iii+ vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE89767_7_v_5_cebpa_mouse | expr gmpg cebpa wt bone marrow cell markers lin sca1 ckit+ cd150 cd41 fcgrii/iii(hi) cd115 cfu g vs expr pregm cebpa ko bone marrow cell markers lin sca 1 ckit+ cd150 cd105 |
| GSE220813_0_v_1_zfp750_mouse | strain c57bl/6j skin epidermis wt âx80x93 vs strain c57bl/6j skin epidermis zfp750 / ko âx80x93 |
| GSE103372_0_v_3_smad1_mouse | dsmad1/5 clone 1 untreated replicate cell line nmumg /variation smad1/5 deletion vs parental clone 48 hr tgf beta replicate cell line nmumg /variation b |
| GSE103372_1_v_2_smad1_mouse | parental clone untreated replicate cell line nmumg /variation vs dsmad1/5 clone 1 48 hr tgf beta replicate cell line nmumg /variation smad1/5 deletion b |
| GSE144453,GSE144454_1_v_0_tfdp1_human | rna seq nc cell line ehap wild type knockout gene none human haploid cells vs rna seq tfdp1 cell line ehap knockout gene human haploid cells |
| GSE248501_1_v_0_mst1_mouse | wt sample esophagus cell line esophageal epithelium tamoxifen vs mst1/2 ko sample esophagus cell line esophageal epithelium mst1 mst2 knockout tamoxifen |
| GSE209601_2_v_3_mef2a_human | ac16 wt mef2a cell line vs ac16 ddx41 ko mock cell line |
| GSE209601_0_v_1_mef2a_human | ac16 wt mock cell line vs ac16 ddx41 ko mef2a cell line |
| GSE209601_2_v_1_mef2a_human | ac16 wt mef2a cell line vs ac16 ddx41 ko mef2a cell line |
| GSE84922,GSE84924_4_v_1_sall4_mouse | sall4 wt eaf oocyte replicate [rna seq] /variation wild type development stage early antrum follicle vs sall4 ko eaf oocyte replicate [rna seq] /variation development stage early antrum follicle |
| GSE84922,GSE84924_0_v_1_sall4_mouse | control group oocyte replicate [rna seq] /variation wild type development stage p10.5 7 days vitro culture vs sall4 ko eaf oocyte replicate [rna seq] /variation development stage early antrum follicle |
| GSE84922,GSE84924_0_v_3_sall4_mouse | control group oocyte replicate [rna seq] /variation wild type development stage p10.5 7 days vitro culture vs sall4 ko sf oocyte replicate [rna seq] /variation development stage secondary follicle |
| GSE155972_0_v_1_setdb1_human | rna seq a375 control cell line /variation vitro vs rna seq a375 ko cell line /variation setdb1 vitro |
| GSE102486,GSE102490_1_v_5_setdb1_mouse | rnaseq setdb1 cko imefs wt imef (setdb1 imef) vs rnaseq setdb1 ko imefs long imef (setdb1 cko imef) 2weeks 4oht |
| GSE101546_2_v_4_setdb1_mouse | rnaseq th2 wt lymphocytes number culture days 6 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq th2 th1 setdb1 ko lymphocytes cultured pro differentiation signals number culture days 2 strain c57bl/6 / spleen cd4+ cells |
| GSE101546_3_v_4_setdb1_mouse | rnaseq naives wt lymphocytes number culture days 0 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq th2 th1 setdb1 ko lymphocytes cultured pro differentiation signals number culture days 2 strain c57bl/6 / spleen cd4+ cells |
| GSE101546_2_v_5_setdb1_mouse | rnaseq th2 wt lymphocytes number culture days 6 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq th2 setdb1 ko lymphocytes number culture days 6 strain c57bl/6 / spleen cd4+ cells |
| GSE101546_3_v_5_setdb1_mouse | rnaseq naives wt lymphocytes number culture days 0 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq th2 setdb1 ko lymphocytes number culture days 6 strain c57bl/6 / spleen cd4+ cells |
| GSE101546_2_v_1_setdb1_mouse | rnaseq th2 wt lymphocytes number culture days 6 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq naives setdb1 ko lymphocytes number culture days 0 strain c57bl/6 / spleen cd4+ cells |
| GSE101546_3_v_1_setdb1_mouse | rnaseq naives wt lymphocytes number culture days 0 strain c57bl/6 setdb1+/+ spleen cd4+ cells vs rnaseq naives setdb1 ko lymphocytes number culture days 0 strain c57bl/6 / spleen cd4+ cells |
| GSE168233_0_v_1_setdb1_human | rnaseq ct cell line a549 control (ct) disease lung adenocarcinoma immortalized vs rnaseq ko cell line a549 setdb1 knockout (ko) disease lung adenocarcinoma immortalized |
| GSE235120_1_v_0_pidd1_mouse | mef dmso wt primary mouse embryonic fibroblast vs mef zm pidd ko primary mouse embryonic fibroblast pidd1 / |
| GSE230283_1_v_0_birc2_human | mcf7 gfp sg cell line adenocarcinoma cells wt vs mcf7 birc2 sg3 cell line adenocarcinoma cells ko |
| GSE230283_1_v_2_birc2_human | mcf7 gfp sg cell line adenocarcinoma cells wt vs mcf7 birc2 sg4 cell line adenocarcinoma cells ko |
| GSE68628_1_v_0_abcc5_mouse | wildtype brain strain background fvb/nj /variation abcc5+/+ whole vs abcc5 knockout brain strain background fvb/nj /variation / whole |
| GSE143692_2_v_3_trim8_human | trim8 ipscs derived neural progenitor cells passage 4 7 control gender male vs pou3f2 ipscs derived neural progenitor cells passage 4 7 knockdown gender male |
| GSE143692_2_v_1_trim8_human | trim8 ipscs derived neural progenitor cells passage 4 7 control gender male vs trim8 ipscs derived neural progenitor cells passage 4 7 knockdown gender male |
| GSE143692_0_v_1_trim8_human | pou3f2 ipscs derived neural progenitor cells passage 4 7 control gender male vs trim8 ipscs derived neural progenitor cells passage 4 7 knockdown gender male |
| GSE124014_0_v_1_nnmt_mouse | 3t3 ctrl replicate cell line fibroblast control mouse fibroblasts expressing construct vs 3t3 nnmt replicate cell line fibroblast overexpression mouse fibroblasts expressing construct |
| GSE138938_1_v_2_foxp2_human | foxp2 osteosarcoma epithelial cells cell line u2os wt overexpression vs chir osteosarcoma epithelial cells cell line u2os activate wnt signaling |
| GSE138938_1_v_3_foxp2_human | foxp2 osteosarcoma epithelial cells cell line u2os wt overexpression vs foxp2 dhelix + chir osteosarcoma epithelial cells cell line u2os (lacking residue 264 272) overexpression |
| GSE138938_1_v_4_foxp2_human | foxp2 osteosarcoma epithelial cells cell line u2os wt overexpression vs foxp2 dhelix osteosarcoma epithelial cells cell line u2os (lacking residue 264 272) overexpression |
| GSE134375_4_v_5_stat3_human | skov3 wt cell line /variation parental control ovary vs ov8 ko cell line ovcar8 /variation stat3 ovary |
| GSE134375_0_v_5_stat3_human | ov3 wt cell line ovcar3 /variation parental control ovary vs ov8 ko cell line ovcar8 /variation stat3 ovary |
| GSE134375_6_v_2_stat3_human | ov8 wt cell line ovcar8 /variation parental control ovary vs ov3 ko cell line ovcar3 /variation stat3 ovary |
| GSE108495_1_v_2_stat3_human | hela wt /variation wild type vs hela stat3 ko /variation |
| GSE134375_3_v_7_stat3_human | skov3 con cas9 cell line /variation casp9 control ovary vs skov3 stat3 ko cell line /variation ovary |
| GSE139455_4_v_6_stat3_human | 837sistat3poold grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation il6 cells |
| GSE139455_4_v_3_stat3_human | 837sistat3poold grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation il6 cells |
| GSE139455_4_v_1_stat3_human | 837sistat3poold grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sineg stimulation il6 cells |
| GSE134375_3_v_5_stat3_human | skov3 con cas9 cell line /variation casp9 control ovary vs ov8 ko cell line ovcar8 /variation stat3 ovary |
| GSE139455_7_v_3_stat3_human | grade cell line colorectal cancer sw837 kit dharmacon knockdown sineg stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation il6 cells |
| GSE139455_7_v_6_stat3_human | grade cell line colorectal cancer sw837 kit dharmacon knockdown sineg stimulation control cells vs grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation il6 cells |
| GSE134375_3_v_2_stat3_human | skov3 con cas9 cell line /variation casp9 control ovary vs ov3 ko cell line ovcar3 /variation stat3 ovary |
| GSE231829_0_v_1_stat3_human | rna seq vehicle control u937 derived macrophages vs rna seq stat3 kd u937 derived macrophages knockdown |
| GSE139455_0_v_6_stat3_human | 837sinegq grade cell line colorectal cancer sw837 kit qiagen knockdown sineg stimulation control cells vs grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation il6 cells |
| GSE134375_6_v_5_stat3_human | ov8 wt cell line ovcar8 /variation parental control ovary vs ov8 ko cell line ovcar8 /variation stat3 ovary |
| GSE134375_0_v_2_stat3_human | ov3 wt cell line ovcar3 /variation parental control ovary vs ov3 ko cell line ovcar3 /variation stat3 ovary |
| GSE139455_2_v_1_stat3_human | 837sistat3poolq grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sineg stimulation il6 cells |
| GSE134375_4_v_7_stat3_human | skov3 wt cell line /variation parental control ovary vs skov3 stat3 ko cell line /variation ovary |
| GSE134375_4_v_2_stat3_human | skov3 wt cell line /variation parental control ovary vs ov3 ko cell line ovcar3 /variation stat3 ovary |
| GSE139455_2_v_3_stat3_human | 837sistat3poolq grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation il6 cells |
| GSE139455_2_v_5_stat3_human | 837sistat3poolq grade cell line colorectal cancer sw837 kit qiagen knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit qiagen knockdown sineg stimulation il6 cells |
| GSE139455_4_v_5_stat3_human | 837sistat3poold grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation control cells vs grade cell line colorectal cancer sw837 kit qiagen knockdown sineg stimulation il6 cells |
| GSE134375_0_v_7_stat3_human | ov3 wt cell line ovcar3 /variation parental control ovary vs skov3 stat3 ko cell line /variation ovary |
| GSE139455_0_v_3_stat3_human | 837sinegq grade cell line colorectal cancer sw837 kit qiagen knockdown sineg stimulation control cells vs grade cell line colorectal cancer sw837 kit dharmacon knockdown sistat3pool stimulation il6 cells |
| GSE118794_2_v_1_zmynd8_mouse | rna seq ch12 cells âx80x93 wt clone activated rep vs rna seq ch12 cells âx80x93 zmynd8 clone activated ko |
| GSE118794_0_v_4_zmynd8_mouse | rna seq ch12 cells âx80x93 wt unactivated rep vs rna seq ch12 cells âx80x93 zmynd8 clone unactivated ko |
| GSE118794_5_v_1_zmynd8_mouse | rna seq ch12 cells âx80x93 wt clone unactivated vs rna seq ch12 cells âx80x93 zmynd8 clone activated ko |
| GSE118794_0_v_1_zmynd8_mouse | rna seq ch12 cells âx80x93 wt unactivated rep vs rna seq ch12 cells âx80x93 zmynd8 clone activated ko |
| GSE118794_5_v_4_zmynd8_mouse | rna seq ch12 cells âx80x93 wt clone unactivated vs rna seq ch12 cells âx80x93 zmynd8 clone unactivated ko |
| GSE118794_2_v_4_zmynd8_mouse | rna seq ch12 cells âx80x93 wt clone activated rep vs rna seq ch12 cells âx80x93 zmynd8 clone unactivated ko |
| GSE190681_1_v_0_rtcb_mouse | wt 6w strain c57bl/6 oocyte developmental stage fully grown gv /variation vs rtcb ko 6w strain c57bl/6 oocyte developmental stage fully grown gv /variation knock |
| GSE153484_2_v_0_foxp3_mouse | wild type replicate thymic regulatory cells sorting cd4+cd8 thy1.1+gfp+ strain/ rag2 gfp foxp3 thy1a kaa tcrb transgenic tcra+/null wt b6 age 3 weeks vs il 2 ko replicate thymic regulatory cells sorting cd4+cd8 thy1.1+gfp+ strain/ rag2 gfp foxp3 thy1a kaa tcrb transgenic tcra+/null il2null b6 age 3 weeks |
| GSE164118,GSE168829_2_v_3_foxp3_mouse | background strain c57bl/6 cns4 floxed (wild type) facs sorted cd4+foxp3+ regulatory cells sex male mice vs background strain c57bl/6 cns4 knockout heterozygotes facs sorted cd4+foxp3+ regulatory cells sex female mice |
| GSE220629_0_v_1_foxp3_human | wt mt 2 biol rep cell line regulatory 3 days vitro culture vs foxp3 ko mt 2 biol rep cell line regulatory knockout 3 days vitro culture |
| GSE174751_0_v_1_postn_mouse | p24 control islets strain c57bl/6 age postnatal day 24 pancreatic vs p24 knockout islets strain c57bl/6 age postnatal day 24 dpy30 pancreatic |
| GSE182640_1_v_0_postn_mouse | knee joint cartilaginous tissues wildtype postnatal day 6 mice vs knee joint cartilaginous tissues hbb conditional knockout chondrocytes postnatal day 6 mice |
| GSE89032,GSE89033_0_v_1_sfpq_mouse | ctrl p19 cells condition control mouse stem cell vs sisfpq p19 cells condition sfpq knockdown mouse stem cell |
| GSE197948_2_v_0_atp7b_mouse | wt gfp cu strain c57bl/6 liver progenitor cell redifferentiated hepatocytes 100 mm cucl2 reprogrammed vs ko atp7b cu strain c57bl/6 liver progenitor cell redifferentiated hepatocytes / 100 mm cucl2 reprogrammed |
| GSE197948_2_v_1_atp7b_mouse | wt gfp cu strain c57bl/6 liver progenitor cell redifferentiated hepatocytes 100 mm cucl2 reprogrammed vs ko gfp cu strain c57bl/6 liver progenitor cell redifferentiated hepatocytes atp7b / 100 mm cucl2 reprogrammed |
| GSE248668_1_v_0_atxn1_mouse | control colon cell line organoid epithelial cells strain c57bl/6 non target grna vs atxn1 ko colon cell line organoid epithelial cells strain c57bl/6 grna |
| GSE244518,GSE244520_1_v_0_dnmt3b_human | hct116 rep rna seq cell line background colorectal cancer wt none cells vs dnmt3b ko rep rna seq cell line background hct116 colorectal cancer none knocked |
| GSE237040_6_v_1_notch3_mouse | x557 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k56 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_0_v_3_notch3_mouse | x553 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k47 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_4_v_3_notch3_mouse | k61 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k47 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_0_v_1_notch3_mouse | x553 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k56 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_4_v_5_notch3_mouse | k61 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k54 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_2_v_3_notch3_mouse | k71 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k47 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_0_v_5_notch3_mouse | x553 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k54 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_2_v_1_notch3_mouse | k71 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k56 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_4_v_1_notch3_mouse | k61 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k56 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_6_v_3_notch3_mouse | x557 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k47 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_6_v_5_notch3_mouse | x557 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k54 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE237040_2_v_5_notch3_mouse | k71 wt heart strain c57bl/6j notch3 +/+ (wt) technical replicate vs k54 ko heart strain c57bl/6j notch3 / (n3 ko) technical replicate |
| GSE235707,GSE235712_1_v_0_ctbp1_mouse | sgctrl act splenic cell line primary ot cd8 wt antigen matching tumor 3w stimulation vs sgctbp1 act splenic cell line primary ot cd8 ctbp1 ko antigen matching tumor 3w stimulation |
| GSE218949_0_v_1_cep20_human | sictr cell line a549 non small lung cancer (nsclc) control plasmid transfection vs sicep20 cell line a549 non small lung cancer (nsclc) cep20 knockdown plasmid transfection |
| GSE216523_1_v_0_ptpmt1_mouse | ptpmt1 wt spleen lymph nodes cd8 cells cd3/cd28 antibodies activation vs ptpmt1 ko spleen lymph nodes cd8 cells cd3/cd28 antibodies activation |
| GSE201042_6_v_3_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs (cko) cardiomyocytes ptpmt1 specific knockout mouse line |
| GSE201042_2_v_1_ptpmt1_mouse | wt ptgc cardiomyocytes control ptpmt1 specific knockout gcn2 nockout mouse line vs pko pht cardiomyocytes ptpmt1 specific knockout hri nockout mouse line |
| GSE201042_2_v_3_ptpmt1_mouse | wt ptgc cardiomyocytes control ptpmt1 specific knockout gcn2 nockout mouse line vs (cko) cardiomyocytes ptpmt1 specific knockout mouse line |
| GSE201042_6_v_7_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs dko ptgc cardiomyocytes ptpmt1 specific knockout gcn2 nockout mouse line |
| GSE201042_2_v_4_ptpmt1_mouse | wt ptgc cardiomyocytes control ptpmt1 specific knockout gcn2 nockout mouse line vs dko fst cardiomyocytes ptpmt1 specific knockout eif2a mutant mouse line |
| GSE201042_6_v_4_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs dko fst cardiomyocytes ptpmt1 specific knockout eif2a mutant mouse line |
| GSE201042_6_v_10_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs pko fst cardiomyocytes ptpmt1 specific knockout eif2a mutant mouse line |
| GSE201042_6_v_0_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs fst cardiomyocytes ptpmt1 specific knockout eif2a mutant mouse line |
| GSE201042_2_v_7_ptpmt1_mouse | wt ptgc cardiomyocytes control ptpmt1 specific knockout gcn2 nockout mouse line vs dko ptgc cardiomyocytes ptpmt1 specific knockout gcn2 nockout mouse line |
| GSE201042_6_v_1_ptpmt1_mouse | (ctrl) cardiomyocytes control ptpmt1 specific knockout mouse line vs pko pht cardiomyocytes ptpmt1 specific knockout hri nockout mouse line |
| GSE250089_0_v_3_epcam_human | tylms cells non teatment 1 cell line human leiomyosarcoma dmso vs tylms cells siepcam 1 cell line human leiomyosarcoma epcam knockdown |
| GSE134214_0_v_1_ell2_human | pc 3 control cell line prostate cancer vs pc 3 siell2 sirna knockdown ell2 gene cell line prostate cancer |
| GSE175932_1_v_0_rhoa_mouse | allergen treated wildtype rep alveolar type 2 cells strain c57bl/6 passage single primary cell agent cockroach lung vs allergen treated mutant rep alveolar type 2 cells strain c57bl/6 passage single primary cell agent cockroach rhoa ko lung |
| GSE247862,GSE247863_2_v_5_eomes_mouse | eomes wt cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t12 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE132942_4_v_0_eomes_mouse | sample.wt stage rep strain c57bl/6 spleen wt nk cells vs sample.eomes ko st rep 1 strain c57bl/6 spleen ncr1 icreert2 ki/wt x rosa26yfplsl eomesfl/fl nk cells |
| GSE247862,GSE247863_4_v_3_eomes_mouse | eomes wt cd4 cells t12 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_0_v_3_eomes_mouse | eomes wt cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_4_v_1_eomes_mouse | eomes wt cd4 cells t12 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_2_v_3_eomes_mouse | eomes wt cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_0_v_5_eomes_mouse | eomes wt cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t12 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_2_v_1_eomes_mouse | eomes wt cd4 cells t0 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE247862,GSE247863_0_v_1_eomes_mouse | eomes wt cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre vs eomes ko cd4 cells t24 (replicat [rnaseq] eomesfl/fl cd4cre+ |
| GSE149010_0_v_6_dars2_mouse | k002000128 wt 1 heart ear tag abk sex ckmm cre wt/wt dars2 fl/wt age week vs k002000234 chop ko heart ear tag apj sex ko/ko ckmm cre wt/wt dars2 age 2 weeks |
| GSE149010_0_v_4_dars2_mouse | k002000128 wt 1 heart ear tag abk sex ckmm cre wt/wt dars2 fl/wt age week vs dars2 ko heart ear tag abk sex ckmm cre tg/wt fl/fl age |
| GSE149010_0_v_5_dars2_mouse | k002000128 wt 1 heart ear tag abk sex ckmm cre wt/wt dars2 fl/wt age week vs k002000128 dars2 ko heart ear tag abk sex ckmm cre tg/wt fl/fl age 1 week |
| GSE192663_3_v_5_acly_mouse | wt th17 + acetate genetic background c57bl/6 wild type cd4+ cells vs acly ko th17 + acetate genetic background fl/fl cd4 cre cd4+ cells |
| GSE192663_3_v_2_acly_mouse | wt th17 + acetate genetic background c57bl/6 wild type cd4+ cells vs acly ko th17 genetic background fl/fl cd4 cre cd4+ cells |
| GSE192663_1_v_5_acly_mouse | wt th17 genetic background c57bl/6 wild type cd4+ cells vs acly ko th17 + acetate genetic background fl/fl cd4 cre cd4+ cells |
| GSE192663_1_v_2_acly_mouse | wt th17 genetic background c57bl/6 wild type cd4+ cells vs acly ko th17 genetic background fl/fl cd4 cre cd4+ cells |
| GSE238018_1_v_5_mxra8_human | mda mb 231 cells infected control grna grown 2d culture sample human tnbc cell line vs mxra8 knockout clone v grown 2d culture sample human tnbc cell line mda mb 231 mxra8ko cells grna |
| GSE238018_1_v_4_mxra8_human | mda mb 231 cells infected control grna grown 2d culture sample human tnbc cell line vs mxra8 knockout clone grown tumor ncg mice sample human tnbc cell line mda mb 231 mxra8ko grna |
| GSE238018_1_v_0_mxra8_human | mda mb 231 cells infected control grna grown 2d culture sample human tnbc cell line vs mxra8 knockout clone v grown tumor ncg mice sample human tnbc cell line mda mb 231 mxra8ko grna |
| GSE238018_1_v_2_mxra8_human | mda mb 231 cells infected control grna grown 2d culture sample human tnbc cell line vs mxra8 knockout clone grown 2d culture sample human tnbc cell line mda mb 231 mxra8ko cells grna |
| GSE238018_3_v_4_mxra8_human | mda mb 231 cells infected control grna grown tumor ncg mice sample human tnbc cell line vs mxra8 knockout clone grown tumor ncg mice sample human tnbc cell line mda mb 231 mxra8ko grna |
| GSE238018_3_v_2_mxra8_human | mda mb 231 cells infected control grna grown tumor ncg mice sample human tnbc cell line vs mxra8 knockout clone grown 2d culture sample human tnbc cell line mda mb 231 mxra8ko cells grna |
| GSE238018_3_v_5_mxra8_human | mda mb 231 cells infected control grna grown tumor ncg mice sample human tnbc cell line vs mxra8 knockout clone v grown 2d culture sample human tnbc cell line mda mb 231 mxra8ko cells grna |
| GSE238018_3_v_0_mxra8_human | mda mb 231 cells infected control grna grown tumor ncg mice sample human tnbc cell line vs mxra8 knockout clone v grown tumor ncg mice sample human tnbc cell line mda mb 231 mxra8ko grna |
| GSE225869_2_v_0_cd44_human | u251 shctrl dmso cell line human glioblastoma cells wt time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE193282_3_v_1_cd44_mouse | kidney wt uiri strain c57bl/6 (control cd44 ko) disease model surgery vs kidney î² catenin / uuo strain c57bl/6 bcat ko disease model surgery |
| GSE148657_3_v_0_cd44_human | cd44 wt mda mb 231 rep cell line breast cancer status wild type vs cd44 ko mda mb 231 rep cell line breast cancer status knockout |
| GSE249338_1_v_0_cd44_mouse | ewat high fat diet 17 weeeks [hfd epididymal adipose wild type vs ewat high fat diet 17 weeeks [cd44 epididymal adipose cd44 ko |
| GSE225869_3_v_0_cd44_human | u251 nc tmz cell line human glioblastoma cells wt temozolomide time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE193282_3_v_0_cd44_mouse | kidney wt uiri strain c57bl/6 (control cd44 ko) disease model surgery vs kidney cd44 / uiri strain c57bl/6 ko disease model surgery |
| GSE148657_3_v_1_cd44_human | cd44 wt mda mb 231 rep cell line breast cancer status wild type vs cd44 ko hs578t rep cell line breast cancer status knockout |
| GSE193282_2_v_0_cd44_mouse | kidney wt uuo strain c57bl/6 (control bcat ko) disease model surgery vs kidney cd44 / uiri strain c57bl/6 ko disease model surgery |
| GSE148657_2_v_0_cd44_human | cd44 wt hs578t rep cell line breast cancer status wild type vs cd44 ko mda mb 231 rep cell line breast cancer status knockout |
| GSE148657_2_v_1_cd44_human | cd44 wt hs578t rep cell line breast cancer status wild type vs cd44 ko hs578t rep cell line breast cancer status knockout |
| GSE225869_1_v_0_cd44_human | u251 shcd44 dmso cell line human glioblastoma cells cd44 knockdown time 24h vs u251 shcd44 tmz cell line human glioblastoma cells cd44 knockdown temozolomide time 24h |
| GSE182888_0_v_2_jmjd6_human | 786 jmjd6 wt sgctrl rna cell line sgrna vs 786 jmjd6 ko sg4 rna cell line sgrna |
| GSE182888_0_v_1_jmjd6_human | 786 jmjd6 wt sgctrl rna cell line sgrna vs 786 jmjd6 ko sg2 rna cell line sgrna |
| GSE224294_1_v_2_ngly1_human | midbrain wt 5659 cell line mb organoid differentiation ipsc time day 90 vs midbrain ngly1 ko cell line mb organoid differentiation ipsc time day 90 |
| GSE224294_3_v_2_ngly1_human | midbrain wt pcs cell line mb organoid differentiation ipsc time day 90 vs midbrain ngly1 ko cell line mb organoid differentiation ipsc time day 90 |
| GSE224294_4_v_2_ngly1_human | midbrain wt jb cell line mb organoid differentiation ipsc time day 90 vs midbrain ngly1 ko cell line mb organoid differentiation ipsc time day 90 |
| GSE215351,GSE215794_4_v_0_kdm8_mouse | whole ventricles wildtype 24 weeks rna seq replicate wt age vs whole ventricles mutant 24 weeks rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_2_v_0_kdm8_mouse | whole ventricles wildtype 16 weeks nad injection rna seq replicate wt age vs whole ventricles mutant 24 weeks rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_1_v_0_kdm8_mouse | whole ventricles wildtype 16 weeks untreated rna seq replicate wt age vs whole ventricles mutant 24 weeks rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_4_v_3_kdm8_mouse | whole ventricles wildtype 24 weeks rna seq replicate wt age vs whole ventricles mutant 16 weeks nad injection rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_1_v_3_kdm8_mouse | whole ventricles wildtype 16 weeks untreated rna seq replicate wt age vs whole ventricles mutant 16 weeks nad injection rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_7_v_0_kdm8_mouse | whole ventricles mutant 16 weeks untreated rna seq replicate kdm8 knockout age vs whole ventricles mutant 24 weeks rna seq replicate kdm8 knockout age |
| GSE215351,GSE215794_2_v_3_kdm8_mouse | whole ventricles wildtype 16 weeks nad injection rna seq replicate wt age vs whole ventricles mutant 16 weeks nad injection rna seq replicate kdm8 knockout age |
| GSE131633_1_v_0_slamf9_mouse | wild type bm pdcs strain c57bl/6 genomic background bone marrow vs slamf9 / replica bm pdcs strain c57bl/6 genomic background knockout bone marrow |
| GSE213988_0_v_1_rrm2_human | shnc cell line s462ty schwann wt vs shrrm2 cell line s462ty schwann rrm2 knockdown |
| GSE196199_0_v_1_zbtb20_mouse | cochlear wt strain c57bl/6 cochleae age postnatal day 10 zbtb20 +/+ cre vs cochlear zb20 ko strain c57bl/6 cochleae age postnatal day 10 zbtb20 f/f cre |
| GSE125007,GSE125008_3_v_0_uhrf1_mouse | wt baseline rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE125007,GSE125008_6_v_0_uhrf1_mouse | wt phx 4wks rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE125007,GSE125008_10_v_0_uhrf1_mouse | wt phx 96hrs rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE125007,GSE125008_5_v_0_uhrf1_mouse | wt phx 7days rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE125007,GSE125008_1_v_0_uhrf1_mouse | wt phx 24hrs rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE125007,GSE125008_4_v_0_uhrf1_mouse | wt phx 40hrs rep strain c57bl/6 liver time mouse vs ko baseline rep strain c57bl/6 liver uhrf1hepko time mouse |
| GSE140997_4_v_5_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line h9 nsun6 knockout (clone 1 nucleotide indel exon2) human embryonic stem cells |
| GSE140997_4_v_7_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line hek293 nsun6 knockout (clone 2 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE140997_2_v_5_nsun6_human | rna seq cell line h9 control (wild type crispr (random)) 3 human embryonic stem cells vs rna seq cell line h9 nsun6 knockout (clone 1 nucleotide indel exon2) human embryonic stem cells |
| GSE140997_10_v_1_nsun6_human | rna seq cell line h9 control (wild type) human embryonic stem cells vs rna seq cell line hek293 nsun6 knockout (clone 1 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE140997_4_v_3_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line h9 nsun6 knockout (clone 4 nucleotide indel exon2) 2 human embryonic stem cells |
| GSE140997_2_v_8_nsun6_human | rna seq cell line h9 control (wild type crispr (random)) 3 human embryonic stem cells vs rna seq cell line h9 nsun6 knockout (clone 2 nucleotide indel exon2) human embryonic stem cells |
| GSE140997_10_v_5_nsun6_human | rna seq cell line h9 control (wild type) human embryonic stem cells vs rna seq cell line h9 nsun6 knockout (clone 1 nucleotide indel exon2) human embryonic stem cells |
| GSE140997_4_v_1_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line hek293 nsun6 knockout (clone 1 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE140997_4_v_6_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line h9 nsun6 knockout (clone 3 nucleotide indel exon9) human embryonic stem cells |
| GSE140997_4_v_8_nsun6_human | rna seq cell line hek293 control (wild type) 4 human embryonic kidney 293 cells vs rna seq cell line h9 nsun6 knockout (clone 2 nucleotide indel exon2) human embryonic stem cells |
| GSE140997_2_v_7_nsun6_human | rna seq cell line h9 control (wild type crispr (random)) 3 human embryonic stem cells vs rna seq cell line hek293 nsun6 knockout (clone 2 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE140997_2_v_3_nsun6_human | rna seq cell line h9 control (wild type crispr (random)) 3 human embryonic stem cells vs rna seq cell line h9 nsun6 knockout (clone 4 nucleotide indel exon2) 2 human embryonic stem cells |
| GSE140997_10_v_7_nsun6_human | rna seq cell line h9 control (wild type) human embryonic stem cells vs rna seq cell line hek293 nsun6 knockout (clone 2 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE140997_2_v_1_nsun6_human | rna seq cell line h9 control (wild type crispr (random)) 3 human embryonic stem cells vs rna seq cell line hek293 nsun6 knockout (clone 1 nucleotide indel) 4 human embryonic kidney 293 cells |
| GSE103003_1_v_0_zeb2_mouse | gsh2 cre zeb2fl/wt strain cd1/swiss v svz age p2 ctrl vs gsh2 cre zeb2fl/ko strain cd1/swiss v svz age p2 ko |
| GSE205788_0_v_1_gfap_mouse | brain lateral ventricular gfap expressing cells wildtype biol rep ventricle positive (gfap gfp) vs brain lateral ventricular gfap expressing cells knockout biol rep ventricle positive (tsk ko gfp) |
| GSE248634_1_v_0_gnas_human | u 251 mg control replicate [20684 cell line human glioblastoma astrocytoma mock transfected vs u 251 mg m2 replicate [20684 cell line human glioblastoma astrocytoma regnase 2 overexpression |
| GSE144231_2_v_7_cxcr2_mouse | wt pit strain balb/c age 12 weeks housing sopf pituitary vs cxcr2 ko gm strain balb/c age 12 weeks housing sopf mammary gland |
| GSE144231_4_v_5_cxcr2_mouse | wt pit c strain balb/c age 12 weeks housing conventional pituitary vs cxcr2 ko pit strain balb/c age 12 weeks housing pituitary |
| GSE144231_3_v_5_cxcr2_mouse | wt gm strain balb/c age 12 weeks housing sopf mammary gland vs cxcr2 ko pit strain balb/c age 12 weeks housing pituitary |
| GSE144231_2_v_1_cxcr2_mouse | wt pit strain balb/c age 12 weeks housing sopf pituitary vs cxcr2 ko c strain balb/c age 12 weeks housing conventional mammary gland |
| GSE144231_4_v_7_cxcr2_mouse | wt pit c strain balb/c age 12 weeks housing conventional pituitary vs cxcr2 ko gm strain balb/c age 12 weeks housing sopf mammary gland |
| GSE144231_4_v_1_cxcr2_mouse | wt pit c strain balb/c age 12 weeks housing conventional pituitary vs cxcr2 ko c strain balb/c age 12 weeks housing conventional mammary gland |
| GSE144231_6_v_5_cxcr2_mouse | wt gm c strain balb/c age 12 weeks housing conventional mammary gland vs cxcr2 ko pit strain balb/c age 12 weeks housing pituitary |
| GSE144231_3_v_1_cxcr2_mouse | wt gm strain balb/c age 12 weeks housing sopf mammary gland vs cxcr2 ko c strain balb/c age 12 weeks housing conventional mammary gland |
| GSE144231_6_v_7_cxcr2_mouse | wt gm c strain balb/c age 12 weeks housing conventional mammary gland vs cxcr2 ko gm strain balb/c age 12 weeks housing sopf mammary gland |
| GSE196110_1_v_2_ndrg3_mouse | liver /variation wild type food ad libitum strain background c57bl/6 vs liver /variation ndrg3 exon4 deletion food ad libitum strain background c57bl/6 |
| GSE101467_0_v_1_dock8_human | control activated activation status khyg1 cells vs dock8 ko activated activation status khyg1 cells |
| GSE201657_0_v_1_ash2l_human | u nt2 cell line u373 glioblastoma control transduced guide rna vs u ash cell line u373 glioblastoma ash2l knockout transduced guide rna |
| GSE101767_1_v_0_wdr11_mouse | cell description mouse mb cells none control g3 tumorspheres # 19568 vs cell description mouse mb cells wdr11 overexpression g3 tumorspheres # 19568 |
| GSE216538_1_v_6_mrs2_mouse | wt wd l whole liver western diet vs ko cd f inguinal white adipose iwat (lymph nodes removed) mrs2 chow diet |
| GSE216538_5_v_2_mrs2_mouse | wt cd l whole liver chow diet vs ko wd l whole liver mrs2 western diet |
| GSE216538_1_v_4_mrs2_mouse | wt wd l whole liver western diet vs ko cd l whole liver mrs2 chow diet |
| GSE216538_5_v_3_mrs2_mouse | wt cd l whole liver chow diet vs ko wd f inguinal white adipose iwat (lymph nodes removed) mrs2 western diet |
| GSE216538_7_v_2_mrs2_mouse | wt wd f inguinal white adipose iwat (lymph nodes removed) western diet vs ko wd l whole liver mrs2 western diet |
| GSE216538_5_v_6_mrs2_mouse | wt cd l whole liver chow diet vs ko cd f inguinal white adipose iwat (lymph nodes removed) mrs2 chow diet |
| GSE216538_1_v_3_mrs2_mouse | wt wd l whole liver western diet vs ko wd f inguinal white adipose iwat (lymph nodes removed) mrs2 western diet |
| GSE216538_1_v_2_mrs2_mouse | wt wd l whole liver western diet vs ko wd l whole liver mrs2 western diet |
| GSE216538_7_v_4_mrs2_mouse | wt wd f inguinal white adipose iwat (lymph nodes removed) western diet vs ko cd l whole liver mrs2 chow diet |
| GSE216538_0_v_2_mrs2_mouse | wt cd f inguinal white adipose iwat (lymph nodes removed) chow diet vs ko wd l whole liver mrs2 western diet |
| GSE216538_0_v_3_mrs2_mouse | wt cd f inguinal white adipose iwat (lymph nodes removed) chow diet vs ko wd f inguinal white adipose iwat (lymph nodes removed) mrs2 western diet |
| GSE216538_0_v_4_mrs2_mouse | wt cd f inguinal white adipose iwat (lymph nodes removed) chow diet vs ko cd l whole liver mrs2 chow diet |
| GSE216538_7_v_6_mrs2_mouse | wt wd f inguinal white adipose iwat (lymph nodes removed) western diet vs ko cd f inguinal white adipose iwat (lymph nodes removed) mrs2 chow diet |
| GSE248887_0_v_1_dkk1_human | panc 1 wt biol pancreas cell line control vs panc 1 dkk1 se ko biol pancreas cell line knockout gene editing |
| GSE247230_0_v_1_anp32b_human | rko cells sictrl cell line human colorectal cancer anp32b wild type vs rko cells sianp32b cell line human colorectal cancer anp32b knockdown |
| GSE146045_1_v_0_lama3_mouse | control strain background c57bl/6 /variation wild type skin epidermis mouse vs lama3 ko strain background c57bl/6 /variation deficient skin epidermis mouse |
| GSE157609,GSE158123_0_v_1_ifi16_human | ifi16+/+ a549 lung cell line cells wildtype infection inoculated pr8/h1n1 virus moi 1 vs ifi16 / a549 lung cell line cells knockout infection inoculated pr8/h1n1 virus moi 1 |
