This is a permanent results page for your analyzed data. Please save the link in your browser's address bar.
| Title / Description | Activator protein-2gamma silencing effect on MCF-7 breast tumor cell line |
| Accession | GSE15481 |
| Summary | Analysis of MCF-7 cells silenced for activator protein (AP)-2γ transcription factor using three distinct self-targeting sequences (AP-2γ siRNA1-3). AP-2γ overexpression in breast tumors is a predictor of poor outcome. Results provide further insight into the role of AP-2γ in breast carcinoma. |
| Organism | Homo sapiens |
| Platform | GPL570 |
| Normalized | False |
| Parsed SOFT file |
| Differential expression method | Characteristic Direction |
| Cutoff | 500 |
| Organism | Homo sapiens |
| Cell_type | MCF-7 |
| Pert_name | AP-2 gamma targeting siRNA |
| Pert_id | CCACACUGGAGUCGCCGAAUA |
| Organism | human |
| Pert_type | genetic |
| Gene lists | Enrichr | L1000CDS2 | PAEA | Crowdsourcing | |
| Up |
|
||||
| Down |
|
||||
| Combined |
|
|
|
|
