MCF7_BD2K_LINCS_DCIC_COURSERA gene signatures (156)

All reports

Custom Report Builder

  1. Using the checkboxes in the right-most column, select gene signatures.
  2. Select at least 3 signatures.
  3. Name the report.
  4. (Optional) Select a metadata field upon which to categorize the signatures. The percentage indicates what percentage of gene signatures have values for that metadata field.
  5. Click Build report
Title Organism Platform Optional Metadata
1 Breast adenocarcinoma MCF-7 cell line response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell MCF7
Perturbation Estrogen
Disease Breast cancer
Pert_name Estrogen
Pert_type chemical
2 Breast adenocarcinoma MCF-7 cell line response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell MCF7
Perturbation ethanol and estrogen
Disease breast cancer
Pert_name estrogen
Pert_type chemical
3 Estradiol effect on breast cancer cell line: ... Homo sapiens Homo sapiens
Organism Homo sapiens
Pert_name estradiol
Pert_id estradiol
Pert_type chemical
4 Leukemia inhibitory factor effect on ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7
Pert_name SIN3A
Pert_id SIN3A
Organism human
Pert_type genetic
5 Estradiol effect on ERK1/ERK2-deficient MCF-7 ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7
Pert_name MC
Pert_id ka
Organism human
Pert_type Estradiol
6 Folic acid induces cell type-specific changes ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type breastcancercells
Pert_name folicacid
Pert_id DB00158
Organism human
Pert_type chemical
7 PI3K inhibition results in enhanced estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BYL-719
Pert_id PubChemCID:56649450
Organism human
Pert_type chemical
8 PI3K inhibition results in enhanced estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BYL-719
Pert_id PubChemCID:56649450
Organism human
Pert_type chemical
9 PI3K inhibition results in enhanced estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BYL-719
Pert_id PubChemCID:56649450
Organism human
Pert_type chemical
10 PI3K inhibition results in enhanced estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BYL-719
Pert_id PubChemCID:56649450
Organism human
Pert_type chemical
11 PI3K inhibition results in enhanced estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BYL-719
Pert_id PubChemCID:56649450
Organism human
Pert_type chemical
12 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name glutamine
Pert_id PubChemCID:5961
Organism human
Pert_type chemical
13 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name histidine
Pert_id PubChemCID:6274
Organism human
Pert_type chemical
14 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name isoleucine
Pert_id PubChemCID:6306
Organism human
Pert_type chemical
15 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name leucine
Pert_id PubChemCID:6106
Organism human
Pert_type chemical
16 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name valine
Pert_id PubChemCID:6287
Organism human
Pert_type chemical
17 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name phenylalanine
Pert_id PubChemCID:6140
Organism human
Pert_type chemical
18 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name glycine
Pert_id PubChemCID:750
Organism human
Pert_type chemical
19 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name arginine
Pert_id PubChemCID:6322
Organism human
Pert_type chemical
20 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name cysteine
Pert_id PubChemCID:5862
Organism human
Pert_type chemical
21 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name lysine
Pert_id PubChemCID:5962
Organism human
Pert_type chemical
22 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name methionine
Pert_id PubChemCID:6137
Organism human
Pert_type chemical
23 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name serine
Pert_id PubChemCID:5951
Organism human
Pert_type chemical
24 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name threonine
Pert_id PubChemCID:6288
Organism human
Pert_type chemical
25 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name tyrosine
Pert_id PubChemCID:6057
Organism human
Pert_type chemical
26 Comprehensive profiling of amino acid response ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name tryptophan
Pert_id PubChemCID:6305
Organism human
Pert_type chemical
27 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
28 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
29 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
30 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
31 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
32 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
33 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
34 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name epidermalgrowthfactor
Pert_id HGNCsymbol:EGF
Organism human
Pert_type chemical
35 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
36 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
37 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
38 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
39 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
40 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
41 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
42 6KR-EGFR expressing MCF7 following EGF or HRG ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name heregulin
Pert_id HRG
Organism human
Pert_type chemical
43 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
44 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
45 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
46 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
47 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
48 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
49 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
50 Over-expression of FGFR2b from a ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
51 Gene expression profiles of MCF7 breast cancer ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 4-hydroxy-L-tryptophan ...
Pert_id CHEBI:40072
Organism human
Pert_type chemical
52 Gene expression profiles of MCF7 breast cancer ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name endoxifen
Pert_id PubChemCID:10090750
Organism human
Pert_type chemical
53 Gene expression profiles of MCF7 breast cancer ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id CHEBI:23965
Organism human
Pert_type chemical
54 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
55 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
56 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
57 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
58 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
59 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
60 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
61 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
62 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
63 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
64 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
65 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
66 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
67 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
68 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
69 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
70 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
71 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
72 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
73 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
74 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
75 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
76 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
77 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
78 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
79 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
80 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
81 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
82 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
83 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
84 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
85 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
86 Identification and Validation of Genes with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithsiRNAt ...
Organism human
Pert_type genetic
87 Capturing drug responses by quantitative ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name gefitinib
Pert_id DrugBankID:DB00317
Organism human
Pert_type chemical
88 Capturing drug responses by quantitative ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name U0126
Pert_id PubChemCID:3006531
Organism human
Pert_type chemical
89 Capturing drug responses by quantitative ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name wortmannin
Pert_id PubChemCID:312145
Organism human
Pert_type chemical
90 Gene expression profiles of MCF7 with with the ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id CHEBI:23965
Organism human
Pert_type chemical
91 Gene expression profiles of MCF7 with with the ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name AM580
Pert_id PubChemCID:2126
Organism human
Pert_type chemical
92 Prolactin-inducible Stat5a-mediated and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name prolactin
Pert_id CHEBI:81580
Organism human
Pert_type chemical
93 Prolactin-inducible Stat5a-mediated and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name prolactin
Pert_id CHEBI:81580
Organism human
Pert_type chemical
94 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name ActinomycinD
Pert_id CHEBI:27666
Organism human
Pert_type chemical
95 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name ActinomycinD
Pert_id CHEBI:27666
Organism human
Pert_type chemical
96 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name ActinomycinD
Pert_id CHEBI:27666
Organism human
Pert_type chemical
97 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name triptolide
Pert_id CHEBI:9747
Organism human
Pert_type chemical
98 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name triptolide
Pert_id CHEBI:9747
Organism human
Pert_type chemical
99 Expression data from treatment of actinomycin ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name triptolide
Pert_id CHEBI:9747
Organism human
Pert_type chemical
100 Expression data from MCF7 tumor xenografts ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name BMS-754807
Pert_id PubChemCID:24785538
Organism human
Pert_type chemical
101 Expression data from MCF7 tumor xenografts ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Tamoxifen
Pert_id PubChemCID:2733526
Organism human
Pert_type chemical
102 Expression data from MCF7 tumor xenografts ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Letrozole
Pert_id PubChemCID:3902
Organism human
Pert_type chemical
103 The genomic analysis of the interaction ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name lacticacidosis
Organism human
Pert_type chemical
104 The genomic analysis of the interaction ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name hypoxia
Organism human
Pert_type chemical
105 Resveratrol induces downregulation of DNA ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name resveratrol
Pert_id DrugBankID:DB02709
Organism human
Pert_type chemical
106 Resveratrol induces downregulation of DNA ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name resveratrol
Pert_id DrugBankID:DB02709
Organism human
Pert_type chemical
107 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name hypoxia
Organism human
Pert_type physical
108 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name hypoxia
Organism human
Pert_type physical
109 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithPontin ...
Organism human
Pert_type genetic
110 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithPontin ...
Organism human
Pert_type genetic
111 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name transfectionwithPontin ...
Organism human
Pert_type genetic
112 Progesterone receptor-B enhances estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id CHEBI:23965
Organism human
Pert_type chemical
113 Estrogen Coordinates Translation and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
114 Estrogen Coordinates Translation and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
115 Estrogen Coordinates Translation and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estrogen
Pert_id CHEBI:50114
Organism human
Pert_type chemical
116 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name hypoxia
Organism human
Pert_type chemical
117 Genome-wide analysis of gene expression ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name hypoxia
Organism human
Pert_type chemical
118 Gene expression profiles of MCF7 with CARM1 ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id CHEBI:23965
Organism human
Pert_type chemical
119 Gene expression profiles of MCF7 with CARM1 ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name doxorubicin
Pert_id DrugBankID:DB00997
Organism human
Pert_type chemical
120 Gene expression profile of NR2E3 in MCF7 cells Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name knockdownofNR2E3
Organism human
Pert_type genetic
121 Gene expression profile of NR2E3 in MCF7 cells Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name knockdownofESR1
Organism human
Pert_type genetic
122 The gene expression response of MCF7 and ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name glutamine
Pert_id PubChemCID:5961
Organism human
Pert_type chemical
123 Unique signatures of estrogen independent ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id PubChemCID:5757
Organism human
Pert_type chemical
124 Unique signatures of estrogen independent ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id PubChemCID:5757
Organism human
Pert_type chemical
125 Unique signatures of estrogen independent ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 3beta-Adiol(17beta-diol)
Pert_id PubChemCID:15818
Organism human
Pert_type chemical
126 Unique signatures of estrogen independent ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 3beta-Adiol(17beta-diol)
Pert_id PubChemCID:15818
Organism human
Pert_type chemical
127 Expression data from Control and Six1 ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name cloneexpressingSix1
Organism human
Pert_type genetic
128 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 4-hydroxytamoxifen
Pert_id PubChemCID:449459
Organism human
Pert_type chemical
129 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name ICI-182,780(Fulvestrant)
Pert_id PubChemCID:104741
Organism human
Pert_type chemical
130 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Bazedoxifene
Pert_id PubChemCID:154257
Organism human
Pert_type chemical
131 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Raloxifene
Pert_id PubChemCID:5035
Organism human
Pert_type chemical
132 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 4-hydroxytamoxifen(4-OHT)
Pert_id PubChemCID:449459
Organism human
Pert_type chemical
133 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name ICI-182,780(Fulvestrant)
Pert_id PubChemCID:104741
Organism human
Pert_type chemical
134 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Bazedoxifene
Pert_id PubChemCID:154257
Organism human
Pert_type chemical
135 Transcriptional profiling of clinically ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Raloxifene
Pert_id PubChemCID:5035
Organism human
Pert_type chemical
136 Microarray analysis of MCF7 cells treated with ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name NSC59687(Oxyphenisatin ...
Pert_id PubChemCID:8269
Organism human
Pert_type chemical
137 Cyclin D1 determines estrogen dependent ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id PubChemCID:5757
Organism human
Pert_type chemical
138 Gene expression profiles of mammary epithelial ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type human
Pert_name hyperthermicshock
Pert_id Temperature=45degC
Organism MCF7cells
Pert_type physical
139 PLK1 signaling coopereates with estrogen ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name estradiol
Pert_id PubChemCID:5757
Organism human
Pert_type chemical
140 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name doxorubicin
Pert_id PubChemCID:31703
Organism human
Pert_type chemical
141 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Nutlin-3a
Pert_id PubChemCID:11433190
Organism human
Pert_type chemical
142 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name doxorubicin
Pert_id PubChemCID:31703
Organism human
Pert_type chemical
143 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Nutlin-3a
Pert_id PubChemCID:11433190
Organism human
Pert_type chemical
144 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name doxorubicin
Pert_id PubChemCID:31703
Organism human
Pert_type chemical
145 Transcriptome and translatome profiling of ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name Nutlin-3a
Pert_id PubChemCID:11433190
Organism human
Pert_type chemical
146 Gene expression profiles of MCF7 breast cancer ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name 4-hydroxy-L-tryptophan ...
Pert_id ChemBankCID:85479
Organism human
Pert_type chemical
147 Gene expression profiles of MCF7 breast cancer ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF7cells
Pert_name endoxifen
Pert_id PubChemCID:10090750
Organism human
Pert_type chemical
148 Cimicifuga racemosa extract effect on breast ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name Cimicifuga racemosa ...
Organism human
Pert_type chemical
149 Cimicifuga racemosa extract effect on breast ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name estradiol
Pert_id PubChem ID 5757
Organism human
Pert_type chemical
150 Cimicifuga racemosa extract effect on breast ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name tamoxifen
Pert_id PubChem ID 2733526
Organism human
Pert_type chemical
151 Activator protein-2gamma silencing effect on ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name AP-2 gamma targeting ...
Pert_id CCACACUGGAGUCGCCGAAUA
Organism human
Pert_type genetic
152 Activator protein-2gamma silencing effect on ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name AP-2 gamma targeting ...
Pert_id GCGGCCCAGCAACUGUGUAAA
Organism human
Pert_type genetic
153 Activator protein-2gamma silencing effect on ... Homo sapiens Homo sapiens
Organism Homo sapiens
Cell_type MCF-7
Pert_name AP-2 gamma targeting ...
Pert_id AAUGAGAUGGCAGCUAGGAAG
Organism human
Pert_type genetic
154 Estradiol effect on ERK1/ERK2-deficient MCF-7 ... Homo sapiens Homo sapiens
Cell_type MCF-7
Pert_name ESTRADIOL
Organism HUMAN
Pert_type ERK2 KNOCKDOWN
155 Effect of estrogen receptor- or retinoic acid ... Homo sapiens Homo sapiens
Cell_type MCF7
Pert_name ERsiRNA
Organism HOMO SAPIENS
Pert_type GENETIC
156 Estradiol effect on ERK1/ERK2-deficient MCF-7 ... Homo sapiens Homo sapiens
Pert_type Chemical
Pert_id ERK1/ERK2
Cell_type MCF-7
Organism Human
Pert_name Estradiol