| 1 |
Breast adenocarcinoma MCF-7 cell line response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell |
MCF7 |
| Perturbation |
Estrogen |
| Disease |
Breast cancer |
| Pert_name |
Estrogen |
| Pert_type |
chemical |
|
| 2 |
Breast adenocarcinoma MCF-7 cell line response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell |
MCF7 |
| Perturbation |
ethanol and estrogen |
| Disease |
breast cancer |
| Pert_name |
estrogen |
| Pert_type |
chemical |
|
| 3 |
Estradiol effect on breast cancer cell line: ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Pert_name |
estradiol |
| Pert_id |
estradiol |
| Pert_type |
chemical |
|
| 4 |
Leukemia inhibitory factor effect on ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7 |
| Pert_name |
SIN3A |
| Pert_id |
SIN3A |
| Organism |
human |
| Pert_type |
genetic |
|
| 5 |
Estradiol effect on ERK1/ERK2-deficient MCF-7 ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7 |
| Pert_name |
MC |
| Pert_id |
ka |
| Organism |
human |
| Pert_type |
Estradiol |
|
| 6 |
Folic acid induces cell type-specific changes ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
breastcancercells |
| Pert_name |
folicacid |
| Pert_id |
DB00158 |
| Organism |
human |
| Pert_type |
chemical |
|
| 7 |
PI3K inhibition results in enhanced estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BYL-719 |
| Pert_id |
PubChemCID:56649450 |
| Organism |
human |
| Pert_type |
chemical |
|
| 8 |
PI3K inhibition results in enhanced estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BYL-719 |
| Pert_id |
PubChemCID:56649450 |
| Organism |
human |
| Pert_type |
chemical |
|
| 9 |
PI3K inhibition results in enhanced estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BYL-719 |
| Pert_id |
PubChemCID:56649450 |
| Organism |
human |
| Pert_type |
chemical |
|
| 10 |
PI3K inhibition results in enhanced estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BYL-719 |
| Pert_id |
PubChemCID:56649450 |
| Organism |
human |
| Pert_type |
chemical |
|
| 11 |
PI3K inhibition results in enhanced estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BYL-719 |
| Pert_id |
PubChemCID:56649450 |
| Organism |
human |
| Pert_type |
chemical |
|
| 12 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
glutamine |
| Pert_id |
PubChemCID:5961 |
| Organism |
human |
| Pert_type |
chemical |
|
| 13 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
histidine |
| Pert_id |
PubChemCID:6274 |
| Organism |
human |
| Pert_type |
chemical |
|
| 14 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
isoleucine |
| Pert_id |
PubChemCID:6306 |
| Organism |
human |
| Pert_type |
chemical |
|
| 15 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
leucine |
| Pert_id |
PubChemCID:6106 |
| Organism |
human |
| Pert_type |
chemical |
|
| 16 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
valine |
| Pert_id |
PubChemCID:6287 |
| Organism |
human |
| Pert_type |
chemical |
|
| 17 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
phenylalanine |
| Pert_id |
PubChemCID:6140 |
| Organism |
human |
| Pert_type |
chemical |
|
| 18 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
glycine |
| Pert_id |
PubChemCID:750 |
| Organism |
human |
| Pert_type |
chemical |
|
| 19 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
arginine |
| Pert_id |
PubChemCID:6322 |
| Organism |
human |
| Pert_type |
chemical |
|
| 20 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
cysteine |
| Pert_id |
PubChemCID:5862 |
| Organism |
human |
| Pert_type |
chemical |
|
| 21 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
lysine |
| Pert_id |
PubChemCID:5962 |
| Organism |
human |
| Pert_type |
chemical |
|
| 22 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
methionine |
| Pert_id |
PubChemCID:6137 |
| Organism |
human |
| Pert_type |
chemical |
|
| 23 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
serine |
| Pert_id |
PubChemCID:5951 |
| Organism |
human |
| Pert_type |
chemical |
|
| 24 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
threonine |
| Pert_id |
PubChemCID:6288 |
| Organism |
human |
| Pert_type |
chemical |
|
| 25 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
tyrosine |
| Pert_id |
PubChemCID:6057 |
| Organism |
human |
| Pert_type |
chemical |
|
| 26 |
Comprehensive profiling of amino acid response ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
tryptophan |
| Pert_id |
PubChemCID:6305 |
| Organism |
human |
| Pert_type |
chemical |
|
| 27 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 28 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 29 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 30 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 31 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 32 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 33 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 34 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
epidermalgrowthfactor |
| Pert_id |
HGNCsymbol:EGF |
| Organism |
human |
| Pert_type |
chemical |
|
| 35 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 36 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 37 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 38 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 39 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 40 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 41 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 42 |
6KR-EGFR expressing MCF7 following EGF or HRG ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
heregulin |
| Pert_id |
HRG |
| Organism |
human |
| Pert_type |
chemical |
|
| 43 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 44 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 45 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 46 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 47 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 48 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 49 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 50 |
Over-expression of FGFR2b from a ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 51 |
Gene expression profiles of MCF7 breast cancer ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
4-hydroxy-L-tryptophan ... |
| Pert_id |
CHEBI:40072 |
| Organism |
human |
| Pert_type |
chemical |
|
| 52 |
Gene expression profiles of MCF7 breast cancer ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
endoxifen |
| Pert_id |
PubChemCID:10090750 |
| Organism |
human |
| Pert_type |
chemical |
|
| 53 |
Gene expression profiles of MCF7 breast cancer ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
CHEBI:23965 |
| Organism |
human |
| Pert_type |
chemical |
|
| 54 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 55 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 56 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 57 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 58 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 59 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 60 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 61 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 62 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 63 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 64 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 65 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 66 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 67 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 68 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 69 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 70 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 71 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 72 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 73 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 74 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 75 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 76 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 77 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 78 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 79 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 80 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 81 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 82 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 83 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 84 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 85 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 86 |
Identification and Validation of Genes with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithsiRNAt ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 87 |
Capturing drug responses by quantitative ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
gefitinib |
| Pert_id |
DrugBankID:DB00317 |
| Organism |
human |
| Pert_type |
chemical |
|
| 88 |
Capturing drug responses by quantitative ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
U0126 |
| Pert_id |
PubChemCID:3006531 |
| Organism |
human |
| Pert_type |
chemical |
|
| 89 |
Capturing drug responses by quantitative ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
wortmannin |
| Pert_id |
PubChemCID:312145 |
| Organism |
human |
| Pert_type |
chemical |
|
| 90 |
Gene expression profiles of MCF7 with with the ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
CHEBI:23965 |
| Organism |
human |
| Pert_type |
chemical |
|
| 91 |
Gene expression profiles of MCF7 with with the ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
AM580 |
| Pert_id |
PubChemCID:2126 |
| Organism |
human |
| Pert_type |
chemical |
|
| 92 |
Prolactin-inducible Stat5a-mediated and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
prolactin |
| Pert_id |
CHEBI:81580 |
| Organism |
human |
| Pert_type |
chemical |
|
| 93 |
Prolactin-inducible Stat5a-mediated and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
prolactin |
| Pert_id |
CHEBI:81580 |
| Organism |
human |
| Pert_type |
chemical |
|
| 94 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
ActinomycinD |
| Pert_id |
CHEBI:27666 |
| Organism |
human |
| Pert_type |
chemical |
|
| 95 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
ActinomycinD |
| Pert_id |
CHEBI:27666 |
| Organism |
human |
| Pert_type |
chemical |
|
| 96 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
ActinomycinD |
| Pert_id |
CHEBI:27666 |
| Organism |
human |
| Pert_type |
chemical |
|
| 97 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
triptolide |
| Pert_id |
CHEBI:9747 |
| Organism |
human |
| Pert_type |
chemical |
|
| 98 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
triptolide |
| Pert_id |
CHEBI:9747 |
| Organism |
human |
| Pert_type |
chemical |
|
| 99 |
Expression data from treatment of actinomycin ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
triptolide |
| Pert_id |
CHEBI:9747 |
| Organism |
human |
| Pert_type |
chemical |
|
| 100 |
Expression data from MCF7 tumor xenografts ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
BMS-754807 |
| Pert_id |
PubChemCID:24785538 |
| Organism |
human |
| Pert_type |
chemical |
|
| 101 |
Expression data from MCF7 tumor xenografts ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Tamoxifen |
| Pert_id |
PubChemCID:2733526 |
| Organism |
human |
| Pert_type |
chemical |
|
| 102 |
Expression data from MCF7 tumor xenografts ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Letrozole |
| Pert_id |
PubChemCID:3902 |
| Organism |
human |
| Pert_type |
chemical |
|
| 103 |
The genomic analysis of the interaction ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
lacticacidosis |
| Organism |
human |
| Pert_type |
chemical |
|
| 104 |
The genomic analysis of the interaction ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
hypoxia |
| Organism |
human |
| Pert_type |
chemical |
|
| 105 |
Resveratrol induces downregulation of DNA ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
resveratrol |
| Pert_id |
DrugBankID:DB02709 |
| Organism |
human |
| Pert_type |
chemical |
|
| 106 |
Resveratrol induces downregulation of DNA ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
resveratrol |
| Pert_id |
DrugBankID:DB02709 |
| Organism |
human |
| Pert_type |
chemical |
|
| 107 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
hypoxia |
| Organism |
human |
| Pert_type |
physical |
|
| 108 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
hypoxia |
| Organism |
human |
| Pert_type |
physical |
|
| 109 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithPontin ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 110 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithPontin ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 111 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
transfectionwithPontin ... |
| Organism |
human |
| Pert_type |
genetic |
|
| 112 |
Progesterone receptor-B enhances estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
CHEBI:23965 |
| Organism |
human |
| Pert_type |
chemical |
|
| 113 |
Estrogen Coordinates Translation and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 114 |
Estrogen Coordinates Translation and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 115 |
Estrogen Coordinates Translation and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estrogen |
| Pert_id |
CHEBI:50114 |
| Organism |
human |
| Pert_type |
chemical |
|
| 116 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
hypoxia |
| Organism |
human |
| Pert_type |
chemical |
|
| 117 |
Genome-wide analysis of gene expression ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
hypoxia |
| Organism |
human |
| Pert_type |
chemical |
|
| 118 |
Gene expression profiles of MCF7 with CARM1 ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
CHEBI:23965 |
| Organism |
human |
| Pert_type |
chemical |
|
| 119 |
Gene expression profiles of MCF7 with CARM1 ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
doxorubicin |
| Pert_id |
DrugBankID:DB00997 |
| Organism |
human |
| Pert_type |
chemical |
|
| 120 |
Gene expression profile of NR2E3 in MCF7 cells
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
knockdownofNR2E3 |
| Organism |
human |
| Pert_type |
genetic |
|
| 121 |
Gene expression profile of NR2E3 in MCF7 cells
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
knockdownofESR1 |
| Organism |
human |
| Pert_type |
genetic |
|
| 122 |
The gene expression response of MCF7 and ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
glutamine |
| Pert_id |
PubChemCID:5961 |
| Organism |
human |
| Pert_type |
chemical |
|
| 123 |
Unique signatures of estrogen independent ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
PubChemCID:5757 |
| Organism |
human |
| Pert_type |
chemical |
|
| 124 |
Unique signatures of estrogen independent ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
PubChemCID:5757 |
| Organism |
human |
| Pert_type |
chemical |
|
| 125 |
Unique signatures of estrogen independent ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
3beta-Adiol(17beta-diol) |
| Pert_id |
PubChemCID:15818 |
| Organism |
human |
| Pert_type |
chemical |
|
| 126 |
Unique signatures of estrogen independent ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
3beta-Adiol(17beta-diol) |
| Pert_id |
PubChemCID:15818 |
| Organism |
human |
| Pert_type |
chemical |
|
| 127 |
Expression data from Control and Six1 ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
cloneexpressingSix1 |
| Organism |
human |
| Pert_type |
genetic |
|
| 128 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
4-hydroxytamoxifen |
| Pert_id |
PubChemCID:449459 |
| Organism |
human |
| Pert_type |
chemical |
|
| 129 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
ICI-182,780(Fulvestrant) |
| Pert_id |
PubChemCID:104741 |
| Organism |
human |
| Pert_type |
chemical |
|
| 130 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Bazedoxifene |
| Pert_id |
PubChemCID:154257 |
| Organism |
human |
| Pert_type |
chemical |
|
| 131 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Raloxifene |
| Pert_id |
PubChemCID:5035 |
| Organism |
human |
| Pert_type |
chemical |
|
| 132 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
4-hydroxytamoxifen(4-OHT) |
| Pert_id |
PubChemCID:449459 |
| Organism |
human |
| Pert_type |
chemical |
|
| 133 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
ICI-182,780(Fulvestrant) |
| Pert_id |
PubChemCID:104741 |
| Organism |
human |
| Pert_type |
chemical |
|
| 134 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Bazedoxifene |
| Pert_id |
PubChemCID:154257 |
| Organism |
human |
| Pert_type |
chemical |
|
| 135 |
Transcriptional profiling of clinically ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Raloxifene |
| Pert_id |
PubChemCID:5035 |
| Organism |
human |
| Pert_type |
chemical |
|
| 136 |
Microarray analysis of MCF7 cells treated with ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
NSC59687(Oxyphenisatin ... |
| Pert_id |
PubChemCID:8269 |
| Organism |
human |
| Pert_type |
chemical |
|
| 137 |
Cyclin D1 determines estrogen dependent ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
PubChemCID:5757 |
| Organism |
human |
| Pert_type |
chemical |
|
| 138 |
Gene expression profiles of mammary epithelial ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
human |
| Pert_name |
hyperthermicshock |
| Pert_id |
Temperature=45degC |
| Organism |
MCF7cells |
| Pert_type |
physical |
|
| 139 |
PLK1 signaling coopereates with estrogen ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
estradiol |
| Pert_id |
PubChemCID:5757 |
| Organism |
human |
| Pert_type |
chemical |
|
| 140 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
doxorubicin |
| Pert_id |
PubChemCID:31703 |
| Organism |
human |
| Pert_type |
chemical |
|
| 141 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Nutlin-3a |
| Pert_id |
PubChemCID:11433190 |
| Organism |
human |
| Pert_type |
chemical |
|
| 142 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
doxorubicin |
| Pert_id |
PubChemCID:31703 |
| Organism |
human |
| Pert_type |
chemical |
|
| 143 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Nutlin-3a |
| Pert_id |
PubChemCID:11433190 |
| Organism |
human |
| Pert_type |
chemical |
|
| 144 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
doxorubicin |
| Pert_id |
PubChemCID:31703 |
| Organism |
human |
| Pert_type |
chemical |
|
| 145 |
Transcriptome and translatome profiling of ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
Nutlin-3a |
| Pert_id |
PubChemCID:11433190 |
| Organism |
human |
| Pert_type |
chemical |
|
| 146 |
Gene expression profiles of MCF7 breast cancer ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
4-hydroxy-L-tryptophan ... |
| Pert_id |
ChemBankCID:85479 |
| Organism |
human |
| Pert_type |
chemical |
|
| 147 |
Gene expression profiles of MCF7 breast cancer ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF7cells |
| Pert_name |
endoxifen |
| Pert_id |
PubChemCID:10090750 |
| Organism |
human |
| Pert_type |
chemical |
|
| 148 |
Cimicifuga racemosa extract effect on breast ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
Cimicifuga racemosa ... |
| Organism |
human |
| Pert_type |
chemical |
|
| 149 |
Cimicifuga racemosa extract effect on breast ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
estradiol |
| Pert_id |
PubChem ID 5757 |
| Organism |
human |
| Pert_type |
chemical |
|
| 150 |
Cimicifuga racemosa extract effect on breast ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
tamoxifen |
| Pert_id |
PubChem ID 2733526 |
| Organism |
human |
| Pert_type |
chemical |
|
| 151 |
Activator protein-2gamma silencing effect on ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
AP-2 gamma targeting ... |
| Pert_id |
CCACACUGGAGUCGCCGAAUA |
| Organism |
human |
| Pert_type |
genetic |
|
| 152 |
Activator protein-2gamma silencing effect on ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
AP-2 gamma targeting ... |
| Pert_id |
GCGGCCCAGCAACUGUGUAAA |
| Organism |
human |
| Pert_type |
genetic |
|
| 153 |
Activator protein-2gamma silencing effect on ...
|
Homo sapiens
|
Homo sapiens |
| Organism |
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
AP-2 gamma targeting ... |
| Pert_id |
AAUGAGAUGGCAGCUAGGAAG |
| Organism |
human |
| Pert_type |
genetic |
|
| 154 |
Estradiol effect on ERK1/ERK2-deficient MCF-7 ...
|
Homo sapiens
|
Homo sapiens |
| Cell_type |
MCF-7 |
| Pert_name |
ESTRADIOL |
| Organism |
HUMAN |
| Pert_type |
ERK2 KNOCKDOWN |
|
| 155 |
Effect of estrogen receptor- or retinoic acid ...
|
Homo sapiens
|
Homo sapiens |
| Cell_type |
MCF7 |
| Pert_name |
ERsiRNA |
| Organism |
HOMO SAPIENS |
| Pert_type |
GENETIC |
|
